ID: 918107337

View in Genome Browser
Species Human (GRCh38)
Location 1:181426117-181426139
Sequence TTGGCTGGACACACCCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918107335_918107337 -5 Left 918107335 1:181426099-181426121 CCTGGTGTGGAGACAGTGTTGGC 0: 1
1: 0
2: 3
3: 17
4: 143
Right 918107337 1:181426117-181426139 TTGGCTGGACACACCCAGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 191
918107331_918107337 22 Left 918107331 1:181426072-181426094 CCAGTGGTCAGTTCTGGGGACAG 0: 1
1: 0
2: 2
3: 20
4: 214
Right 918107337 1:181426117-181426139 TTGGCTGGACACACCCAGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918107337 Original CRISPR TTGGCTGGACACACCCAGCT TGG Intronic
900843828 1:5080077-5080099 TTGTTTGGACACACACAGCCAGG + Intergenic
901321628 1:8343669-8343691 CTCGCAGGACACACCGAGCTCGG + Intronic
901527999 1:9836081-9836103 TTGGCAGCACAGGCCCAGCTTGG + Intergenic
901712723 1:11128316-11128338 CTGGCTGGACAGACCCTCCTGGG + Intronic
901788841 1:11642561-11642583 TGGGCAGGACAGACACAGCTTGG + Intergenic
902287322 1:15414921-15414943 TTGCCTGGAGCAACCCAGCTGGG - Intronic
902686179 1:18079194-18079216 CTCTCTGGCCACACCCAGCTTGG - Intergenic
904113161 1:28142617-28142639 GGAGCTGGACATACCCAGCTAGG + Intergenic
904559779 1:31388681-31388703 ATGCCTGGACCCACCCAGCTGGG - Intergenic
905119056 1:35667711-35667733 TTGGTTGGAAACAGCCAGCCAGG + Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
907487798 1:54789268-54789290 TGGGCAGGCCACTCCCAGCTGGG + Intronic
914195759 1:145447157-145447179 CAGCATGGACACACCCAGCTCGG + Intergenic
915529625 1:156495922-156495944 GTCGCTGGCCACACCCAGGTGGG - Intronic
915624045 1:157103733-157103755 TGGGCTAGACACACAAAGCTTGG + Intergenic
918107337 1:181426117-181426139 TTGGCTGGACACACCCAGCTTGG + Intronic
920277882 1:204821230-204821252 TGGGCCAGACCCACCCAGCTGGG - Intergenic
920427158 1:205887555-205887577 TTGGCTGGACATGATCAGCTGGG + Intergenic
921069541 1:211647838-211647860 GTGTCTGGTCAGACCCAGCTTGG + Intergenic
921094990 1:211878760-211878782 TTGGCTGGATAACCCCATCTAGG + Intergenic
921713130 1:218392882-218392904 GTGGCGGGGCACACCCTGCTAGG - Intronic
922090301 1:222389440-222389462 GTCACTGGACACACCCAGTTAGG + Intergenic
922984951 1:229859195-229859217 GTGGCTGGACACCCCCAGGCTGG - Intergenic
923274824 1:232386827-232386849 ATGGCTGAACACATCCGGCTGGG + Intergenic
924602024 1:245499520-245499542 TTGGCTGAGGACACACAGCTCGG + Intronic
1063275160 10:4557820-4557842 TTGGCTGCACACACACAGTTTGG + Intergenic
1063522325 10:6752161-6752183 TAGGCTGGACTCAGCCTGCTTGG + Intergenic
1069469422 10:68674244-68674266 TTGGCTTGAACCAACCAGCTAGG + Intronic
1069705469 10:70456640-70456662 TTGGAGGGACCCACCCTGCTGGG + Intergenic
1070784379 10:79154544-79154566 TGGTCTGGCCACCCCCAGCTAGG + Intronic
1072716698 10:97757136-97757158 TTGGCTGGACACAGTGAGCCAGG - Intronic
1074545777 10:114401363-114401385 TTGGCTGAACTCACCCAGTGTGG - Intronic
1075172309 10:120127445-120127467 TTGGAGGGTCTCACCCAGCTGGG + Intergenic
1075668792 10:124249016-124249038 TATGCTGGACACTCCCAGCCTGG + Intergenic
1076225536 10:128771972-128771994 TTGGCTGCTCACATCCAGCCTGG + Intergenic
1076270772 10:129150392-129150414 TGAGGTGGACACACCGAGCTGGG - Intergenic
1083294283 11:61706887-61706909 CTGGCTTGACAGCCCCAGCTGGG + Intronic
1084482469 11:69429937-69429959 TTGGCTGCATACCCTCAGCTAGG + Intergenic
1084580580 11:70020541-70020563 TTGGCCGGACCCACTGAGCTGGG - Intergenic
1084781312 11:71411269-71411291 TTGGTTGGCCACACCATGCTGGG - Intergenic
1091897590 12:4117641-4117663 CTGCCTGGACACACCCTGCCAGG + Intergenic
1092579104 12:9820099-9820121 TTGGGTGGTCACACCCAGTGAGG - Intergenic
1093036037 12:14333359-14333381 TGGTCTGGACCCTCCCAGCTGGG - Intergenic
1094405096 12:30108891-30108913 TTGGCCGGGCACACACAGCTGGG - Intergenic
1094497000 12:30994871-30994893 TTGTCTTGCCACCCCCAGCTGGG + Exonic
1095636862 12:44445159-44445181 CTGGCTGAACAAACCCACCTTGG - Intergenic
1096100820 12:48969707-48969729 TTGGCTGGACAAGCCCAGGCTGG - Intronic
1098715839 12:73827806-73827828 TCTTCTGGACACTCCCAGCTGGG - Intergenic
1102116552 12:110407529-110407551 TTAGCTGGACACAATCAGCAGGG + Intergenic
1102530183 12:113540606-113540628 TGAGCTGGAACCACCCAGCTGGG - Intergenic
1103850206 12:123928167-123928189 TGAGCTGGTCACACCCAGCCTGG - Exonic
1104553757 12:129780983-129781005 TTGTCTGGCCACTCCCTGCTGGG + Intronic
1104893995 12:132153050-132153072 TCGGCAGGACACAGCCAGCGTGG - Intergenic
1108815575 13:54286768-54286790 TTGGAGGGCCTCACCCAGCTGGG + Intergenic
1110845538 13:80187141-80187163 TTAGCTGGACACAATCAGCAGGG - Intergenic
1112468726 13:99668760-99668782 TGGCCAGGACACCCCCAGCTTGG - Intronic
1113676884 13:112213881-112213903 TTGCCTGGCCACAGCCAGCCAGG + Intergenic
1115238548 14:31232212-31232234 CAGGCTTGACACACCCAACTGGG + Intergenic
1118464003 14:66014401-66014423 TTGGCTGGACTCACCTGTCTGGG - Intergenic
1119332661 14:73806702-73806724 TCCGCTTGACACACCCATCTCGG + Intergenic
1119807281 14:77490522-77490544 TTGCCTGGAGTCACACAGCTAGG + Intronic
1122298682 14:100719698-100719720 CTGGCTGCAGACAGCCAGCTTGG + Intergenic
1128251473 15:66166984-66167006 TCCCCTGGACACACTCAGCTTGG + Intronic
1130349543 15:83078951-83078973 GTGGCTGGGCACAGACAGCTGGG - Intergenic
1134602512 16:15544582-15544604 CTGGCTTGACACTCACAGCTTGG + Intronic
1135207932 16:20498945-20498967 TTGCCTGGCCACACAAAGCTGGG - Intergenic
1135210967 16:20524755-20524777 TTGCCTGGCCACACAAAGCTGGG + Intergenic
1135259599 16:20969635-20969657 TTGGGTGCACACACACAGCCTGG + Intronic
1136035255 16:27534358-27534380 TCGGCTGGACAAGCACAGCTTGG + Intronic
1136591278 16:31219228-31219250 TTGGCTGGAGACCCCTAGCCTGG - Intronic
1139563696 16:67759559-67759581 ATGGCTCAACTCACCCAGCTCGG + Intronic
1144788124 17:17843111-17843133 TCGGCTGGACTCCCACAGCTTGG - Intergenic
1145270230 17:21400980-21401002 TATGCTGGACACACCGAGCCTGG - Intronic
1145795734 17:27654377-27654399 TGGGCTTGACACAGCCAGCCTGG + Intergenic
1146923260 17:36727736-36727758 TTGGCTGGACCCAACCAGGCCGG + Intergenic
1147249425 17:39144146-39144168 TTCCCTGGCCACCCCCAGCTGGG - Intronic
1147960964 17:44167372-44167394 CTGGCTGGGCACCCACAGCTGGG - Intergenic
1150617902 17:66786159-66786181 TTGCCTGTGGACACCCAGCTGGG + Intronic
1152445298 17:80339301-80339323 TTGGAGGGACACACCCTGCTTGG - Exonic
1161616918 19:5276075-5276097 TTGGCTGGACATGCACAGCCAGG + Intronic
1162575659 19:11497413-11497435 TTGCCTGGAGCTACCCAGCTTGG - Intronic
1162769302 19:12939290-12939312 TTGTCTGTACACACACAGCCGGG + Intronic
1163818966 19:19485334-19485356 TTGGCTGGTCCCGCCCAGCTGGG + Intronic
1165151649 19:33764072-33764094 CTGGCTGGAGCCTCCCAGCTGGG - Intronic
1165718607 19:38063234-38063256 GGTGCTGGACACACACAGCTGGG - Intronic
926147340 2:10404779-10404801 TGGCCTAGACACATCCAGCTGGG - Intronic
926647998 2:15310775-15310797 AAGGCAGGACACACCCAGGTGGG - Intronic
927163612 2:20294461-20294483 TTGGCTGGATACACCCCCCATGG + Exonic
933032064 2:77341183-77341205 CTAGCTGAACACACCCAGGTAGG + Intronic
938405384 2:131030031-131030053 CTGACTGCACACACCCAGCAGGG + Intronic
939224986 2:139353697-139353719 TAGGCTGCACACACACAGCACGG - Intergenic
942886369 2:180929117-180929139 TTGGCTGGAAATTCTCAGCTTGG + Intergenic
943699315 2:190972533-190972555 TTGGCAGAAGACAGCCAGCTTGG + Intronic
1169217157 20:3800583-3800605 CTGCCTGGGGACACCCAGCTGGG - Intronic
1169741309 20:8897788-8897810 TTAGCTGGGCTCACTCAGCTGGG - Intronic
1172214729 20:33227187-33227209 TTGGCAGGGCACAGCCTGCTTGG - Intronic
1172457687 20:35090984-35091006 CTGTCTCTACACACCCAGCTCGG + Intronic
1173841113 20:46157893-46157915 TGAGCTTGAAACACCCAGCTGGG + Intergenic
1176027631 20:62993940-62993962 CTGGCCGAACACGCCCAGCTGGG - Intergenic
1176348956 21:5774651-5774673 TTGGTAGGTCTCACCCAGCTAGG - Intergenic
1176355770 21:5895235-5895257 TTGGTAGGTCTCACCCAGCTAGG - Intergenic
1176543277 21:8172721-8172743 TTGGTAGGTCTCACCCAGCTAGG - Intergenic
1176562228 21:8355766-8355788 TTGGTAGGTCTCACCCAGCTAGG - Intergenic
1176791923 21:13328137-13328159 TCTTCTGGACCCACCCAGCTCGG + Intergenic
1177991315 21:28039140-28039162 TCTTCTGGACCCACCCAGCTCGG + Intergenic
1178764081 21:35432917-35432939 TTTTCTGGACCCTCCCAGCTGGG + Intronic
1180137414 21:45870763-45870785 CTAGCTGGACACACGCAGCTGGG - Intronic
1181010308 22:20036469-20036491 AGGCCTGGACACACCGAGCTGGG - Intronic
1182653308 22:31869678-31869700 TTGGCTGGACACATACACATGGG + Intronic
1184229432 22:43150853-43150875 GGGGCTGGACACACCCTGCATGG + Intergenic
1184504255 22:44891478-44891500 CTGGCTGGACACCCCCTGCCAGG + Intronic
1185156589 22:49196684-49196706 TTGTCAGGACACAGCCAGTTGGG - Intergenic
1185182509 22:49371582-49371604 ATGGCTGGAAACACCCACCCGGG - Intergenic
1203248146 22_KI270733v1_random:88940-88962 TTGGTAGGTCTCACCCAGCTAGG - Intergenic
949264823 3:2144498-2144520 TTGGCTGGACACACAGATCAAGG + Intronic
949936418 3:9119541-9119563 TTGGCAGCCCACACCAAGCTAGG - Intronic
950617684 3:14175126-14175148 TTGGCTGGACACAGCGAGCGAGG - Intronic
950887385 3:16373759-16373781 TTGGCTGGGCAGTCCAAGCTGGG + Intronic
951387283 3:22058055-22058077 TTGGCTATACACACCCTTCTAGG + Intronic
953995405 3:47515452-47515474 TTGGCCTGACACTCACAGCTAGG + Intergenic
954467887 3:50667592-50667614 TTGCCTGGGGTCACCCAGCTAGG + Intergenic
956462384 3:69485177-69485199 GTGGGTGCACACACCCGGCTGGG + Intronic
956495942 3:69825853-69825875 TTGGAGGGAAACAACCAGCTAGG - Intronic
959258770 3:104048605-104048627 TTGGTGGGACTCACCCAGTTGGG - Intergenic
961362775 3:126378494-126378516 TGGGCTTGTCACACACAGCTGGG - Intergenic
962386645 3:134937493-134937515 TTGGCTGGCCCCAGCCAGCATGG + Intronic
962751019 3:138434866-138434888 CTGGCTGGACAGGCGCAGCTCGG - Exonic
968565437 4:1310159-1310181 GTGGCAGGACACACTCAGATAGG + Intronic
971225175 4:24745350-24745372 TTGGATGGACACACACACCCAGG + Intergenic
972146936 4:36039473-36039495 TGGGCTGCACAGACCCAGATAGG - Intronic
973134223 4:46686078-46686100 GTGGCTGAACACTCCAAGCTAGG - Intergenic
974289340 4:59910780-59910802 TACTCTGGACACTCCCAGCTGGG - Intergenic
974747166 4:66090910-66090932 TTTTCTGGACCCTCCCAGCTGGG + Intergenic
975977525 4:80116024-80116046 CTGGCTGGGAAGACCCAGCTGGG - Intronic
976605663 4:86980329-86980351 TTGGCTTAAAAAACCCAGCTGGG + Intronic
977167833 4:93723479-93723501 TTAGCTACACACAACCAGCTTGG + Intronic
978206223 4:106083623-106083645 TTGGATGGTCTCACCCAGTTGGG - Intronic
978931846 4:114323834-114323856 TTGTCCAAACACACCCAGCTAGG + Intergenic
980497787 4:133607361-133607383 TTTTCTGGACCCTCCCAGCTGGG + Intergenic
980601909 4:135037485-135037507 TTTTCTGGACCCTCCCAGCTGGG - Intergenic
980744605 4:136998960-136998982 TTGGAAGGTCTCACCCAGCTAGG + Intergenic
980905450 4:138944194-138944216 TTGGCTGGACTCAGCCAGTGAGG + Intergenic
980957518 4:139444389-139444411 TTTCCTGGACCCTCCCAGCTGGG - Intergenic
986199782 5:5570302-5570324 TCGGCTGGGACCACCCAGCTAGG + Intergenic
986664003 5:10084162-10084184 TTGGCTGGAGAGTCTCAGCTGGG - Intergenic
988400321 5:30753143-30753165 TAGGCTGGACAAAACCAGCAAGG + Intergenic
989660114 5:43789567-43789589 TTAGCTGGACACAATCAGCAGGG - Intergenic
993187130 5:84635449-84635471 GAGCCTGCACACACCCAGCTGGG + Intergenic
993232154 5:85249527-85249549 TTTTCTGGACACTCCCAGCTAGG + Intergenic
993412835 5:87593802-87593824 TCTTCTGGACACTCCCAGCTGGG + Intergenic
993791531 5:92216932-92216954 TTTGCTGGACCCTCCCAGCTTGG - Intergenic
994352551 5:98763499-98763521 ATTGATGGACAGACCCAGCTGGG + Intergenic
994626636 5:102228730-102228752 ATCTCTGGACACACCCAGCAGGG - Intergenic
996760835 5:126984381-126984403 TTGGCTGGACCTAACCTGCTTGG - Intronic
1001355841 5:171022253-171022275 TTGGAGGGACTCACCCAGTTGGG + Intronic
1001433437 5:171681485-171681507 TTGCCTAGAGACACACAGCTAGG + Intergenic
1001695526 5:173667235-173667257 CTTCCTGGACACAGCCAGCTGGG - Intergenic
1003758343 6:9148059-9148081 TTTTCTGGACCCTCCCAGCTGGG - Intergenic
1007832266 6:44647559-44647581 TGTGCTGGGCACAGCCAGCTTGG + Intergenic
1008400031 6:51053500-51053522 TTTTCTGGACCCTCCCAGCTGGG - Intergenic
1008675198 6:53811741-53811763 TTGCCTGGGGACACTCAGCTAGG + Intronic
1013807892 6:114014576-114014598 TTAGCTGGACACAATCAGCAGGG + Intergenic
1014249333 6:119099588-119099610 TTGGGTGGAGAAACCCAGCAAGG - Intronic
1014804443 6:125813258-125813280 TGGGCTGCACATAGCCAGCTAGG + Intronic
1020525332 7:9251506-9251528 TTGGATGGTCTCACCCAGTTGGG - Intergenic
1021075247 7:16295805-16295827 TTGGGTGGGCTCAACCAGCTTGG + Intronic
1023086067 7:36571252-36571274 CTGGCAGCACCCACCCAGCTGGG - Intronic
1023816250 7:43952454-43952476 ATGGCTGTAAACCCCCAGCTGGG - Intronic
1023849164 7:44140698-44140720 GTGGGTGCACGCACCCAGCTGGG + Exonic
1025101801 7:56141769-56141791 TGGGCTGGACCCACCAACCTGGG + Intergenic
1025614636 7:63107067-63107089 CTGGCTGGATAGACACAGCTTGG + Intergenic
1026244787 7:68610193-68610215 ATGCCTGAACACAACCAGCTTGG + Intergenic
1026317523 7:69240052-69240074 TGGGCTGGACCCACCAACCTGGG - Intergenic
1026352121 7:69526501-69526523 TTGGCTGCACCCACCCAGGATGG + Intergenic
1026442908 7:70459533-70459555 TTCTCTGGACACAGCCAGCCAGG - Intronic
1032153372 7:129448924-129448946 TCTGCTGGACCCTCCCAGCTGGG + Intronic
1034952997 7:155313577-155313599 TTAGTTGCAAACACCCAGCTAGG + Intergenic
1036391472 8:8327998-8328020 TTGACTGGACACGCTCAGCTGGG + Exonic
1036437987 8:8753271-8753293 ATGCATGGACACACCCATCTTGG - Intergenic
1036555465 8:9855813-9855835 TTGCCTGGACACATGCAGCAGGG - Intergenic
1039370232 8:36977198-36977220 TTGGCTGCTCACAGCCAGATGGG + Intergenic
1039956603 8:42212102-42212124 TGGGCTGGGCACACCCAGTGTGG - Intergenic
1040138920 8:43887605-43887627 TTGGCTGGAAACACTCATTTTGG + Intergenic
1042001317 8:64125955-64125977 TTTTCTGGACCCTCCCAGCTGGG + Intergenic
1044817914 8:96131770-96131792 TTGACTGGACATAACCAGGTAGG + Intergenic
1051197018 9:14573194-14573216 TTGGCTGTACATTCCCAGCAGGG - Intergenic
1051966156 9:22832248-22832270 TTTTCTGGACTCTCCCAGCTGGG - Intergenic
1052120006 9:24702880-24702902 TTGGCTGCACCCACCCAGGATGG - Intergenic
1056760975 9:89414780-89414802 TGGGCCGGACTCACCCAGCAGGG + Intronic
1057171705 9:92966758-92966780 TCCCCTGGACACCCCCAGCTGGG + Intronic
1057882946 9:98807384-98807406 TTGGCTGAATACACCCTGCAGGG - Intergenic
1061645514 9:131997736-131997758 TTGTCTGGAGGCCCCCAGCTAGG - Intronic
1061878478 9:133556709-133556731 TTGTCTGGACAGTCACAGCTGGG + Intronic
1062126361 9:134865081-134865103 TTTGCTGGCCACGTCCAGCTGGG - Intergenic
1062586137 9:137250883-137250905 CTGGCTGGCCAGACACAGCTGGG + Intergenic
1203464548 Un_GL000220v1:72191-72213 TTGGTAGGTCTCACCCAGCTAGG - Intergenic
1185751606 X:2614635-2614657 GTGGCTCTACCCACCCAGCTGGG - Intergenic
1192330206 X:70169350-70169372 TTGCCTGGGGCCACCCAGCTTGG - Intergenic
1193366477 X:80639591-80639613 TTGGCTGGACACACAATTCTTGG - Intergenic
1197302145 X:124794269-124794291 TTGGCTGGATACACAAACCTAGG - Intronic
1197772565 X:130098581-130098603 TGGGATGGACACAGACAGCTTGG - Intronic
1200006637 X:153089555-153089577 TTGGCTCTACAGCCCCAGCTCGG - Intergenic