ID: 918108049

View in Genome Browser
Species Human (GRCh38)
Location 1:181430002-181430024
Sequence CTGTGTCCCAAAAGGGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918108049_918108053 24 Left 918108049 1:181430002-181430024 CCTATCTCCCTTTTGGGACACAG 0: 1
1: 0
2: 0
3: 17
4: 204
Right 918108053 1:181430049-181430071 ACCTCTACATACTCTTTTCTGGG 0: 1
1: 0
2: 0
3: 13
4: 180
918108049_918108052 23 Left 918108049 1:181430002-181430024 CCTATCTCCCTTTTGGGACACAG 0: 1
1: 0
2: 0
3: 17
4: 204
Right 918108052 1:181430048-181430070 GACCTCTACATACTCTTTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918108049 Original CRISPR CTGTGTCCCAAAAGGGAGAT AGG (reversed) Intronic
901905639 1:12407162-12407184 CATTGTCCCAAGAGGGAAATAGG + Intronic
902548644 1:17206237-17206259 CTGAGTCCCAAGAGGGAGAAAGG - Intronic
902696912 1:18146325-18146347 CTTTGTACCAAGAGGGGGATGGG + Intronic
904707811 1:32404655-32404677 TTTTTTCCCAAAAGGGAGACTGG + Intergenic
905101922 1:35531485-35531507 CTGTGTCCCACTAGGGACCTGGG + Intronic
908156841 1:61362155-61362177 CTCTGTGCCAAAAAGGGGATTGG - Intronic
908448116 1:64221553-64221575 CTGTCTCCCAAAAGGTACAATGG - Intronic
909394474 1:75154555-75154577 CTGGGTCCCATAAGGGAAAAAGG + Intronic
911516431 1:98873593-98873615 CTGAATTCCAAAAGGGAGGTGGG - Intergenic
914492176 1:148159462-148159484 CTGTGGCACAAAAGGAAGATAGG + Intergenic
918108049 1:181430002-181430024 CTGTGTCCCAAAAGGGAGATAGG - Intronic
918388691 1:184036795-184036817 CTTTGTCCCACAAGGGGCATGGG - Intronic
919596555 1:199570838-199570860 CTGAATCCCAAAAGGGAGGAGGG - Intergenic
922501397 1:226099354-226099376 CTGTGTCCTCAAAGAGAGAAAGG + Intergenic
923737462 1:236624277-236624299 CTGTCTCCGAAAAAGGAAATAGG + Intergenic
924262157 1:242243126-242243148 CTGTGCCACAAATGGGGGATTGG + Intronic
924645030 1:245869860-245869882 CTGTGTCCCAAAAGGACAAACGG - Intronic
1065115946 10:22482440-22482462 CTGTCACCCAAAAGGGAAAAAGG - Intergenic
1067292065 10:44950713-44950735 CTGGGTCTCAAGAGGGAGAGAGG - Intergenic
1068164322 10:53308427-53308449 CTGTCTCTCAAAAGGGATAGAGG + Intergenic
1068611294 10:59063341-59063363 CTGAGTCCCGACAGGGACATAGG - Intergenic
1069515035 10:69070588-69070610 CTGGGTCCCACCAGGGAGAAGGG - Intergenic
1071604981 10:86979716-86979738 CTGCATCCCAAAAGTAAGATGGG - Intronic
1071881582 10:89904658-89904680 GTGTTGGCCAAAAGGGAGATGGG - Intergenic
1074530849 10:114297710-114297732 CAGTGACCCAAAAGGGTGAGGGG + Intronic
1075732098 10:124642502-124642524 CGGTGGCCCAACAGGCAGATGGG + Intronic
1077405759 11:2381872-2381894 CTGTGTCCTACAAGGCAGGTGGG - Intronic
1077415477 11:2422535-2422557 CCCTGTCCCAGAAGGGATATTGG - Intronic
1078095729 11:8295538-8295560 TTGTGTCCAAAGAGGAAGATGGG - Intergenic
1078224646 11:9380920-9380942 CTGTATCCAAAAAAGGAGCTTGG - Intergenic
1078823166 11:14903305-14903327 TTGTGTGCCAAAAGGTAGTTGGG - Intergenic
1079754093 11:24234518-24234540 CTGTGGTACAAAGGGGAGATAGG + Intergenic
1079789258 11:24714977-24714999 CTGTTTCTCAAAAGGCTGATGGG - Intronic
1084025450 11:66445629-66445651 CTGAATTCCAAAAGGGAGAAGGG - Intronic
1084025850 11:66448879-66448901 CTGAATTCCAAAAGGGAGAAGGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1086643994 11:89196406-89196428 CTGTTACCCAAAAGGGAAAAAGG + Intronic
1087643201 11:100777538-100777560 CTGTTTCCCAAATGAGAAATAGG + Intronic
1089123884 11:116162607-116162629 CTGTGTCCCAACAGGTGGTTGGG - Intergenic
1089298119 11:117481674-117481696 AGGGGTCCCAAAAGGGAGAATGG + Intronic
1089875654 11:121719228-121719250 CTGTATCCAAACAGGGAGGTGGG + Intergenic
1096048675 12:48586833-48586855 CTGTGGCCCAAAATGGAGTGAGG + Intergenic
1096804285 12:54130907-54130929 TTGTCTCCCAAAAGTGGGATGGG + Intergenic
1096885534 12:54715460-54715482 CTGTGTGCCATCAGGGAGTTTGG + Intergenic
1098402643 12:70090189-70090211 CTGAGTCCGAAAAGAGAGTTAGG - Intergenic
1098652434 12:72990184-72990206 CTGTCTCACCAAAGGGAGTTGGG - Intergenic
1098974329 12:76886771-76886793 TTATGTCCCAAAAAGGAGGTGGG - Intergenic
1099430830 12:82583594-82583616 CTGGTTCCCAAAAGGAAGAGTGG + Intergenic
1099456740 12:82872194-82872216 CTCTGTCCCAGAAGGGAAATGGG + Intronic
1101713042 12:107286504-107286526 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
1101975297 12:109352923-109352945 CTGTGTCTCAATAGGGATTTGGG - Intronic
1104374252 12:128250070-128250092 GTTCGTCCCAAAAGAGAGATGGG - Intergenic
1115303461 14:31910896-31910918 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
1117333782 14:54739207-54739229 TTTTGTCCCAAAATGGGGATAGG - Intronic
1120622988 14:86789047-86789069 CTGTATTCCAAAAGGGAGGAGGG - Intergenic
1121475500 14:94197691-94197713 CTGGGTTACAAAAGGGACATGGG - Intronic
1121669992 14:95701732-95701754 CAGAGGCCAAAAAGGGAGATGGG - Intergenic
1124121184 15:26890567-26890589 CTGCGTGCCTACAGGGAGATCGG - Intronic
1124279177 15:28348860-28348882 TTGGGTCCCAGGAGGGAGATGGG + Intergenic
1124303521 15:28562748-28562770 TTGGGTCCCAGGAGGGAGATGGG - Intergenic
1125909132 15:43420728-43420750 CTGTTTCTCTAAAGAGAGATAGG + Exonic
1126319213 15:47404117-47404139 GTGTATCTCAAAAGGGATATGGG + Intronic
1127718292 15:61673559-61673581 CTCTGTCCCAAAAGGCCAATGGG + Intergenic
1128216556 15:65938312-65938334 CTGTGACCCAAATGGGAGCTAGG - Intronic
1128670106 15:69568258-69568280 CTGTGTCCCAGAAGGCAGGGGGG - Intergenic
1132603098 16:782608-782630 CTGTGGCCCAGGAGGGAGACAGG + Intronic
1133097828 16:3458937-3458959 CTGTGTGCCCAAACGGAGACAGG + Intronic
1133518817 16:6536523-6536545 CTCTGTCACAAAAGGACGATGGG + Intronic
1133559524 16:6937867-6937889 CTGAATTCCAAAAGGGAGATGGG + Intronic
1134483648 16:14639552-14639574 CTGTCTACCAAAATGGAGGTGGG - Intronic
1135611316 16:23870113-23870135 CTATGTTCCAAAAAGGAGTTTGG + Intronic
1135674653 16:24405106-24405128 CTGTGACTCAGAAGGGAGAGCGG - Intergenic
1136777950 16:32881628-32881650 CTGTGTCCCCAAGGCAAGATAGG + Intergenic
1136892672 16:33979886-33979908 CTGTGTCCCCAAGGCAAGATAGG - Intergenic
1140588157 16:76319378-76319400 CTCTGTCTCAAAAGAGAGAGAGG + Intronic
1203080368 16_KI270728v1_random:1143737-1143759 CTGTGTCCCCAAGGCAAGATAGG + Intergenic
1143207898 17:5158558-5158580 CTCTGTCTCAAAAGAGAGAGAGG + Intronic
1144052008 17:11504896-11504918 CTGTGTCCCAAGAGGCAACTGGG + Intronic
1146579643 17:34025331-34025353 CTGTGTGCCAAAATGGTGCTGGG + Intronic
1148492265 17:48030919-48030941 CTGGGACCCAAAAGGGAGTGGGG - Intronic
1148575146 17:48705328-48705350 CTGGGTCCGCAAAGGCAGATCGG + Intergenic
1148744338 17:49910134-49910156 CTGTTCTCCAAAAGGGAGCTGGG + Intergenic
1149527058 17:57364765-57364787 CTCAATCCCAAAAGGGAGCTTGG - Intronic
1150446689 17:65231969-65231991 CTGTGTCAGAGAAGGGAGAGGGG + Intergenic
1150796185 17:68239227-68239249 CTGGATGCCAAAAGGGAGTTGGG - Intergenic
1155235743 18:23817013-23817035 CTGGGTCCCAAGAGGGAAACAGG - Intronic
1158484909 18:57857665-57857687 CTGAGTCCGCGAAGGGAGATAGG - Intergenic
1159017087 18:63110168-63110190 CTGAGTCCCAAGTGGGAGAAAGG - Intergenic
1159615104 18:70570798-70570820 CTGTTTCTCAAAAGGCTGATGGG + Intergenic
1159615739 18:70577615-70577637 CTGTGTTGCAAAAGGGAGCTGGG + Intergenic
1160125252 18:76165717-76165739 CTGTGTTCCAAGTGGGAGCTGGG + Intergenic
1160586381 18:79915642-79915664 CTGTGGCCCGATGGGGAGATGGG + Intronic
1160599501 18:80001838-80001860 CTGTGTCCCAGATGAGAGTTTGG + Intronic
1162435128 19:10653722-10653744 CTGTGCCTCTCAAGGGAGATGGG + Intergenic
1163533415 19:17863592-17863614 CTGTGTCTCACAAGGCAGTTGGG - Intronic
1164957799 19:32402127-32402149 CTCTTTCCAAAAAGGGAGAAGGG + Intergenic
1165093680 19:33399404-33399426 ATGTGCCCCAAAAGGAAGACAGG - Intronic
1165249774 19:34520581-34520603 CTGAATTCCAAAAGGGAGATGGG + Intergenic
1165257175 19:34585175-34585197 CTGAATTCCAAAAGAGAGATAGG + Intergenic
1165819006 19:38662685-38662707 CTGTGTCCCAAACGTGGGGTAGG - Intronic
1166899340 19:46046511-46046533 GTGTGTCCCACATGTGAGATGGG - Intronic
925224897 2:2175215-2175237 CTGTGTCCCACAGGGGTGGTGGG - Intronic
929881888 2:45843941-45843963 CTGTGTCCCAAAAGGAAAAATGG + Intronic
929921711 2:46176822-46176844 GAGTGTCCCAACAGAGAGATAGG + Intronic
932287823 2:70552077-70552099 CAAAGTCCCAAAAGAGAGATGGG + Intronic
935120396 2:100179121-100179143 CTGATTACCAAAGGGGAGATGGG + Intergenic
935919320 2:107994045-107994067 CTGTGTCTCTAAGGGTAGATTGG - Intronic
936075886 2:109401633-109401655 CTGTGTCCCAAGAGGGCCAGGGG + Intronic
936481198 2:112886375-112886397 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
936935330 2:117834354-117834376 CTGAGTCCCAGAAGGGAGAGTGG - Intergenic
937410883 2:121673958-121673980 CTGTGTCACAAAAGGAAGGAGGG + Intergenic
938342905 2:130547301-130547323 CTGTGTGCCCAAAGGGAGTCAGG - Intronic
938346928 2:130573421-130573443 CTGTGTGCCCAAAGGGAGTCAGG + Intronic
938908769 2:135865501-135865523 CTGTGTCATAAATGGGAGTTTGG - Intronic
939899860 2:147838814-147838836 GTGTTTCACAAAAGGAAGATAGG - Intergenic
940052891 2:149482762-149482784 TTGTGTCCTAAAAAGGAGAGGGG - Intergenic
940240315 2:151555699-151555721 CTCTGTAACAAAAGAGAGATGGG + Intronic
940971482 2:159901411-159901433 CTGTTTCCAACAAGGGTGATGGG - Intronic
942234495 2:173890716-173890738 CTGAGTACCAAGAGGGTGATGGG - Intergenic
944122045 2:196251044-196251066 CCCTGTCTCAAAAGGGGGATAGG - Intronic
946192523 2:218015106-218015128 CTGTTTCAGAACAGGGAGATGGG - Intergenic
948439517 2:237977735-237977757 CAAAGTCCCAAAAGGGAGTTTGG - Intronic
1168839018 20:897131-897153 CTGAGTCTGAAAAAGGAGATGGG - Intronic
1169152396 20:3299906-3299928 CTGTGTCTCAAAAAAGAAATAGG - Intronic
1169868415 20:10225397-10225419 CTGTATCCCTAAAAAGAGATGGG + Intronic
1175263090 20:57686944-57686966 CAGCCTCCCAAAAGGGTGATGGG + Intronic
1175591311 20:60194084-60194106 CAATTTCCCCAAAGGGAGATGGG + Intergenic
1175774616 20:61645205-61645227 CACTGTTCCAAAAGGCAGATGGG - Intronic
1177450285 21:21257600-21257622 CTCTGTCTCAAAAGAGAGAGAGG - Intronic
1178387963 21:32170673-32170695 GTGAGTCCCAAAAGGAATATAGG + Intergenic
1179025572 21:37676104-37676126 CTGAGTGCGGAAAGGGAGATGGG + Intronic
1180975082 22:19843828-19843850 CTCAGACCCAGAAGGGAGATGGG - Intronic
1182021956 22:27088972-27088994 CTGGGTCCCAAATGGAAGAATGG + Intergenic
1182517914 22:30869431-30869453 CTGTGTTCCTGCAGGGAGATCGG + Intronic
1182893268 22:33836940-33836962 CTGAGAACGAAAAGGGAGATGGG + Intronic
1184557815 22:45242487-45242509 CAGAGCCCCAGAAGGGAGATGGG + Intergenic
949403329 3:3688436-3688458 CTGTATTCCAAAAGGGAGGAGGG + Intergenic
950075551 3:10184406-10184428 CTGCTTTCCACAAGGGAGATAGG + Intronic
950145110 3:10643532-10643554 ATGTGCCCCACAATGGAGATGGG - Intronic
951186970 3:19724393-19724415 CTGTGTCCTATAATGGAGAAGGG + Intergenic
951202244 3:19888640-19888662 CTGTATAACAGAAGGGAGATGGG - Exonic
954002921 3:47571834-47571856 AGGAGTCACAAAAGGGAGATTGG - Intronic
954334747 3:49909723-49909745 CTGTGGGCCAAAAGGGACAAAGG + Intronic
955273175 3:57521879-57521901 CTGTGTCTCAAAAAAGAGACAGG + Intronic
960029742 3:113045157-113045179 CTGTGTCCCCAAAAGGTGAAAGG - Intergenic
960287457 3:115845527-115845549 CTTGGTCCCAAAAGGAAGAAAGG - Intronic
961957441 3:130818564-130818586 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
962040910 3:131706616-131706638 CTGAATCCCAAAAGGGAGGAGGG - Intronic
967188485 3:186965455-186965477 CTGTGTCCCAAAGGAGGGATAGG + Intronic
968661080 4:1799090-1799112 CTGTGTCCCAAAAGGGCCAAAGG - Intronic
969122958 4:4923305-4923327 CTGTGTCCCCATAGGCAGAATGG + Intergenic
969519960 4:7671003-7671025 CTGGCTCCCAAAAGGGAAAAGGG - Intronic
969707390 4:8819227-8819249 CTGTAGCCCAAGAGGGAGAAGGG + Intergenic
970026411 4:11628861-11628883 ATCTGTCCCAAAAGGGATTTTGG - Intergenic
970745706 4:19292651-19292673 CTGTGTCCCAAGAGTGTGTTTGG + Intergenic
974323049 4:60377046-60377068 CTGTGTCCCTCAAGCTAGATAGG + Intergenic
976112072 4:81686269-81686291 CTGAGTTCCAAAAGGGAGAAAGG + Intronic
976904310 4:90217527-90217549 TATTGTCCCAAAAGAGAGATAGG + Intronic
976929811 4:90552007-90552029 CTGTGTCCCCACATGGAGAAAGG + Intronic
978171844 4:105681042-105681064 CTTTGACCCCAAAGGGAAATTGG + Intronic
980492023 4:133540737-133540759 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
983941687 4:173539583-173539605 CTGTGTCTGAAAAGGGGGATGGG - Intergenic
986735868 5:10666829-10666851 CTGTTTCCCAAAAAGGTTATGGG + Intergenic
989462131 5:41712981-41713003 CTGTCTCCCTAAAGGGATAGGGG - Intergenic
989711535 5:44403319-44403341 TGGTGTCCCAAAAGAGAGAAGGG + Intergenic
995701458 5:114939710-114939732 TTCTGTTCCAAATGGGAGATTGG - Intergenic
995836710 5:116406637-116406659 CTGTGTGCAAAATGAGAGATGGG - Intronic
995858633 5:116619092-116619114 CTGAGTCTGAAAAGGGAGATAGG + Intergenic
997623340 5:135314861-135314883 CTGGGTTCAAAAAGGGAGAGAGG - Intronic
998846402 5:146314570-146314592 ATGTGTCCCTAAAGGGACAGAGG - Intronic
1003768264 6:9266283-9266305 GTTTGTACCAAAAAGGAGATGGG - Intergenic
1005252104 6:23959103-23959125 TTGTGTCAGAAAGGGGAGATGGG - Intergenic
1005893384 6:30158281-30158303 CTGTATCCCAGATGGGAGGTGGG - Intronic
1006797538 6:36741304-36741326 CTGAGGCCCAAAAGGTAGAAGGG + Exonic
1009719355 6:67446533-67446555 CTGAATTCCAAAAGAGAGATGGG - Intergenic
1012562760 6:100605004-100605026 CTGGGTCCCAAAAGAGGTATAGG + Intronic
1014396543 6:120930753-120930775 CTGAGTCCGAAAAGAGAGTTAGG - Intergenic
1015599966 6:134902462-134902484 CTGATTCCCAGCAGGGAGATAGG - Intergenic
1016428475 6:143958520-143958542 CTGTGTCCCGAGAGGCAGACAGG - Intronic
1019370353 7:660008-660030 CTTTGTCACTAAAGGGAGAGAGG - Intronic
1024874730 7:54008986-54009008 CTGTGTTGCACAAGGGAGAGAGG + Intergenic
1028293809 7:89102069-89102091 CTGTGTCCCCAATGGTTGATTGG - Intronic
1029415083 7:100437284-100437306 CTGTGTCCCAGAAGGGAGTCCGG - Intergenic
1033532208 7:142275751-142275773 CTGTGGCCCAAGAGTGTGATTGG - Intergenic
1033708260 7:143909946-143909968 CTGTGTGCCAAGAGTGAGAGTGG + Intergenic
1034463600 7:151212377-151212399 CTGTATCCCAATAGGAAGAGAGG + Intronic
1036377116 8:8210197-8210219 ATGTGTCCCAAAAAGGCAATGGG - Intergenic
1039196910 8:35042637-35042659 ATGTGTGCCAAATGGGTGATGGG - Intergenic
1039648560 8:39314841-39314863 CTGTGGCCAAAAAGGCAGAGAGG + Intergenic
1041494005 8:58465916-58465938 CTGAGTCCGAAAAGAGAGTTAGG - Intergenic
1041758582 8:61339521-61339543 CAGTGCCCCATAAGGGACATGGG - Intronic
1042144799 8:65716535-65716557 CTGTGCACCCAAAGGGACATGGG + Intronic
1042875681 8:73438302-73438324 ATGTGTCCCAGCAGGGAGACAGG + Intronic
1043050011 8:75375220-75375242 CTGTCCTCCAAAAGGAAGATGGG - Intergenic
1043752319 8:83953218-83953240 GTGTGTGCCCAAAGGGAGTTGGG + Intergenic
1044816109 8:96115118-96115140 CTGAGTCCTAGAAGGAAGATGGG - Intergenic
1046733501 8:117751200-117751222 TTGTGTGCCAACAGGGAAATGGG + Intergenic
1049709998 8:144059165-144059187 CTGTGTCCCAACAGGCCGGTCGG + Intronic
1049905846 9:215333-215355 CCGGGTCCCAGAAGGGTGATAGG + Exonic
1050344934 9:4676890-4676912 CTGTGTCGCAAAAGAAAGAAAGG - Intergenic
1051130662 9:13856495-13856517 ATGTGTACAAGAAGGGAGATTGG + Intergenic
1051152723 9:14101437-14101459 CTGTGAACCAATATGGAGATAGG + Intronic
1057912803 9:99033448-99033470 CTGGGCCCCAGAAGGTAGATAGG - Intronic
1059242074 9:112815189-112815211 CTGTTCCCCAAAAGTGAAATTGG + Intronic
1059300997 9:113313376-113313398 CTTTTTCCCAGAAGGGAGAGAGG - Exonic
1059408152 9:114115180-114115202 CTGAATCCCAAAAGGGAGGAGGG + Intergenic
1061388843 9:130306106-130306128 CTGTGACCCAAAAAGTGGATAGG - Intronic
1185648428 X:1631454-1631476 CTGAGTCACAGGAGGGAGATAGG - Intronic
1187013076 X:15299593-15299615 CTGAGTTCCAAAAGGGAGGAGGG + Intronic
1189188081 X:39071140-39071162 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
1189385308 X:40532092-40532114 CTGGGTGGCAAAAGGGGGATGGG + Intergenic
1189659605 X:43283176-43283198 CTGTGTTCCAAAAGTGTGATTGG + Intergenic
1190846286 X:54194417-54194439 CTGTGTGCCTAAAGGGCAATGGG - Exonic
1191718186 X:64206896-64206918 GTGTGTCTAAAAAGGGAGGTGGG + Intergenic
1192240815 X:69326540-69326562 CTGTCTCCCAGGAGGGAGAATGG - Intergenic
1192478226 X:71462206-71462228 CTGTGCCCCAAAAGAAAAATGGG + Intronic
1193621743 X:83761210-83761232 CAGTGTACCAAATGGTAGATTGG + Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1195405986 X:104513912-104513934 CAGTGACCCAAAAGGGAAATAGG - Intergenic
1195432512 X:104805094-104805116 CTGTATCTCAAAAGAGAAATAGG - Intronic
1196138851 X:112238987-112239009 CTGTTTCCCAGTGGGGAGATTGG - Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic