ID: 918109927

View in Genome Browser
Species Human (GRCh38)
Location 1:181446565-181446587
Sequence CTGTAAACATGAATTCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 201}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918109927_918109930 -9 Left 918109927 1:181446565-181446587 CCATGCTGAATTCATGTTTACAG 0: 1
1: 0
2: 0
3: 22
4: 201
Right 918109930 1:181446579-181446601 TGTTTACAGCTTCTTGGCTTGGG 0: 1
1: 0
2: 0
3: 13
4: 228
918109927_918109931 15 Left 918109927 1:181446565-181446587 CCATGCTGAATTCATGTTTACAG 0: 1
1: 0
2: 0
3: 22
4: 201
Right 918109931 1:181446603-181446625 TCTTGAAATCTAGAAGTCTTTGG No data
918109927_918109932 16 Left 918109927 1:181446565-181446587 CCATGCTGAATTCATGTTTACAG 0: 1
1: 0
2: 0
3: 22
4: 201
Right 918109932 1:181446604-181446626 CTTGAAATCTAGAAGTCTTTGGG 0: 1
1: 0
2: 4
3: 50
4: 347
918109927_918109929 -10 Left 918109927 1:181446565-181446587 CCATGCTGAATTCATGTTTACAG 0: 1
1: 0
2: 0
3: 22
4: 201
Right 918109929 1:181446578-181446600 ATGTTTACAGCTTCTTGGCTTGG 0: 1
1: 0
2: 4
3: 18
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918109927 Original CRISPR CTGTAAACATGAATTCAGCA TGG (reversed) Intronic
900826281 1:4929766-4929788 ATGTAAACATGAATGTTGCAGGG + Intergenic
902902459 1:19528784-19528806 ATATAATAATGAATTCAGCAAGG + Intergenic
905905112 1:41612741-41612763 CTTAAAAAATGAATTCATCAGGG + Intronic
906696551 1:47827257-47827279 CCGGAAACATGAATGCATCAGGG + Intronic
907041064 1:51260276-51260298 CTCCTAAAATGAATTCAGCAAGG - Intronic
907601165 1:55771166-55771188 CTGAAAAAATGAATCCATCAGGG - Intergenic
908701184 1:66902698-66902720 CTGCAAAAATAAATTCAGAATGG - Intronic
908768676 1:67576007-67576029 CTGGAAACTTGAAGTCTGCAAGG - Intergenic
909723479 1:78805241-78805263 CTGTGAAATTGAATTCAGCTTGG + Intergenic
911261631 1:95693443-95693465 CTATAAAAATGAATTAGGCATGG + Intergenic
912668628 1:111605736-111605758 CTGCTGACATGACTTCAGCAAGG - Intronic
913262837 1:117015985-117016007 CAACAAACATGAATTCTGCAAGG - Intronic
915149861 1:153821860-153821882 CTTTAAAAATGAATTCAGGCCGG - Intronic
915255923 1:154628471-154628493 GTGTAAACACAAATTCAGGATGG - Intergenic
916263341 1:162864563-162864585 ATGTAAACATGTAAACAGCATGG + Intronic
917821755 1:178769983-178770005 CTGTAAGCTTTAATTCAGGAAGG - Intronic
918109927 1:181446565-181446587 CTGTAAACATGAATTCAGCATGG - Intronic
918902140 1:190436132-190436154 CTAGAAACATGAAATAAGCAGGG - Intronic
919145477 1:193629219-193629241 GTAGAAACATGTATTCAGCAGGG + Intergenic
919357205 1:196538297-196538319 TGGTAAACCTGAAATCAGCATGG + Intronic
919734965 1:200942281-200942303 ATGTAGACAGAAATTCAGCAAGG - Intergenic
919958859 1:202446034-202446056 CGGTAATCATTAATTCAGCCAGG + Intronic
924293846 1:242565929-242565951 CTGAAAACATGAATTAAACGTGG - Intergenic
1064465955 10:15582081-15582103 GTTTAAACATTAACTCAGCATGG + Intronic
1066641074 10:37554778-37554800 CTGTAAACACAAATTCACCCTGG - Intergenic
1067173037 10:43923093-43923115 CTGAGCACATGAATTCAGGAGGG + Intergenic
1067807771 10:49404983-49405005 CTGTAAACAGCAGGTCAGCATGG + Intergenic
1067835434 10:49636051-49636073 TAGAATACATGAATTCAGCAAGG + Intronic
1068965394 10:62906805-62906827 AGGTAAAGATGAATTCAGCACGG - Intronic
1070536415 10:77381446-77381468 GTGTAAACATGAACACATCATGG + Intronic
1070660287 10:78300766-78300788 CCATAAACATGAAGTCAGCATGG - Intergenic
1071043700 10:81346233-81346255 TTGTAAAACTGAGTTCAGCAAGG - Intergenic
1072627081 10:97119480-97119502 CTGGAAACATGAATTCACAATGG + Intronic
1073302569 10:102480010-102480032 CTGTAAACATTAGTGTAGCAAGG + Exonic
1073395529 10:103214240-103214262 CTGAAATCAGGAAGTCAGCAGGG - Intergenic
1074949407 10:118315070-118315092 CTGTAAAGATGAATGCCTCAAGG - Intronic
1077670775 11:4155097-4155119 GTGAAGACATGAATTCAGCTTGG - Intergenic
1080474644 11:32578381-32578403 CTTTTAAAATGATTTCAGCAAGG - Intergenic
1081320996 11:41691523-41691545 TTGGAAACATGAATCCAGCTTGG + Intergenic
1085379668 11:76103232-76103254 CTGTAAACATAAAATTATCAAGG + Intronic
1087124394 11:94608615-94608637 CTGTAAAGATGCACTCAGCAAGG + Exonic
1087737436 11:101850893-101850915 CTGTTACCATGTATTCACCATGG - Intronic
1088828952 11:113518938-113518960 CTGTAGAAATGAAACCAGCATGG - Intergenic
1090598410 11:128344084-128344106 CTATAAACATGCATTCTGCTGGG - Intergenic
1091702263 12:2671610-2671632 ATGGAAGCAAGAATTCAGCAGGG + Intronic
1095621366 12:44258915-44258937 CTGTAAGCATAAAGTCACCATGG + Intronic
1098661653 12:73101878-73101900 CTGAAAACTAGAATTCAGAATGG - Intergenic
1099062301 12:77927232-77927254 CTGTTAAGATGAATTCCCCATGG + Intronic
1099213489 12:79823463-79823485 ATGTTAACATGTATTCAGAAAGG + Intronic
1100648703 12:96560856-96560878 CTGTAATAATTAATTCAGGAAGG - Intronic
1104684178 12:130773610-130773632 CGGTGCACATGAATTCAGAACGG - Intergenic
1107055528 13:36099600-36099622 CCGGAAACATCGATTCAGCATGG - Intronic
1107159114 13:37205252-37205274 CAGTCTACATGCATTCAGCATGG + Intergenic
1107229627 13:38092674-38092696 CTGTATGCCTGGATTCAGCATGG + Intergenic
1108535225 13:51370014-51370036 CAGTAGAGATGAATTCAGCTGGG - Intronic
1109039991 13:57320764-57320786 TTGTAAAAATGAATCCAGAAGGG + Intergenic
1109503779 13:63272605-63272627 CTGAAAAGCTGAATTCAGCTGGG + Intergenic
1111284097 13:86065541-86065563 CTGTAAAGATATATTCAACACGG + Intergenic
1111596130 13:90413257-90413279 CAGTGAACATGAATTTTGCAGGG - Intergenic
1116554242 14:46283231-46283253 CTGTAAAGATGAATGTAGCTGGG - Intergenic
1116640811 14:47460285-47460307 CTGTAAACATGGATACACGAAGG + Intronic
1118112379 14:62736018-62736040 CTGAAATCAAGACTTCAGCAGGG - Intronic
1120526422 14:85581978-85582000 CTGTAAACATGAATGCAGTTTGG + Intronic
1121201152 14:92119511-92119533 CCATAAACATCAATTCAGGAAGG - Intronic
1124503033 15:30246989-30247011 ATGTAAAAATGAATTCAGAATGG + Intergenic
1124740523 15:32291657-32291679 ATGTAAAAATGAATTCAGAATGG - Intergenic
1125574610 15:40746720-40746742 CTGTAAGGATGCAGTCAGCACGG - Intronic
1126484868 15:49169105-49169127 CTGTATACATGTATACAGAAGGG + Intronic
1127822713 15:62674173-62674195 CTGTTAACATGCATTGAGGAAGG + Intronic
1128659339 15:69486593-69486615 CTGTAAAAATGAAGACACCAAGG - Intergenic
1130877189 15:88024675-88024697 GTGGAAAAATGGATTCAGCATGG + Intronic
1132561995 16:599554-599576 CTGTCAGCGTGGATTCAGCAAGG + Intronic
1133566046 16:6994382-6994404 CTGAAAACATGAATAGTGCATGG + Intronic
1134120624 16:11581797-11581819 GTGTAAATATGCATTCAGCTGGG - Intronic
1138218374 16:55226103-55226125 CTGTGAAAAGGAATTCAGGAAGG + Intergenic
1138840681 16:60500976-60500998 ATGGAAACATGATTTAAGCATGG - Intergenic
1143276939 17:5718648-5718670 CTGTGACCATGACTACAGCATGG - Intergenic
1146409140 17:32566984-32567006 CTGTGAACATGGATGGAGCACGG - Intronic
1146489702 17:33271511-33271533 CTGGTAACATGAATTGAGAATGG - Intronic
1146578693 17:34016464-34016486 CTGTAAAGATGGATTCATGATGG - Intronic
1147395047 17:40135927-40135949 CTGTAAACTTCATTGCAGCAAGG + Intronic
1147697597 17:42367663-42367685 CTGTAAAGGAGAATTCAGCAGGG - Intronic
1148788033 17:50155340-50155362 CTGTAAATATGTATTTTGCAAGG + Intergenic
1148824023 17:50378907-50378929 CTTTTAACATGAAATCACCAGGG - Intronic
1153747305 18:8193098-8193120 CCCTAAATATGACTTCAGCATGG - Intronic
1154475838 18:14756560-14756582 GTGTAAAAATTAATTCAGGATGG - Intronic
1155365870 18:25048520-25048542 CTGTACACATGACTTCAGCCAGG - Intergenic
1155667972 18:28334634-28334656 ATGGTAACGTGAATTCAGCAAGG - Intergenic
1158033799 18:53000090-53000112 CTGAAAACAAGATGTCAGCAGGG - Intronic
1158692485 18:59673046-59673068 CTGGAAACATGACTCCAACATGG + Intronic
1159233402 18:65638292-65638314 CTGTAAACAATAAATAAGCAAGG + Intergenic
1164622023 19:29702217-29702239 AGGTAAACATGATTCCAGCATGG + Intronic
1166919444 19:46219123-46219145 ATGTCAACATGAATTCTCCATGG + Intergenic
1167190695 19:47987148-47987170 TGGTAAACATGAATTCTGGAAGG + Intronic
1167975138 19:53220369-53220391 CTGTCCAGATGAATTCAGCTGGG - Intergenic
926107779 2:10163111-10163133 CTGAAAAAATCAAATCAGCAAGG - Intronic
928439261 2:31278124-31278146 CTGTGAGCATTAATTAAGCAAGG + Intergenic
930290722 2:49490319-49490341 GAGAAAACAGGAATTCAGCAGGG + Intergenic
936630446 2:114196728-114196750 CTGGAAACATGAAGGCATCAGGG + Intergenic
937717490 2:125050269-125050291 CAGAAACCATGAATTCAGCTTGG - Intergenic
939240158 2:139547980-139548002 CTGTAAAAAAAAATTCAGAAGGG - Intergenic
941872935 2:170404643-170404665 GTGTAAAAATGAAATCAACATGG - Intronic
943003616 2:182361694-182361716 CCTTAAACATTAATTTAGCAGGG + Intronic
943726947 2:191261640-191261662 CTATATGCCTGAATTCAGCAAGG + Intronic
945081690 2:206092256-206092278 CTGAAAACATGACTTCAGTTGGG - Intergenic
945823674 2:214695947-214695969 CAGAACACAGGAATTCAGCAAGG + Intergenic
948397149 2:237653619-237653641 CTGTAACCATCAAAACAGCATGG + Intronic
948617547 2:239210732-239210754 CTGTCACCAGGAATTCAGGATGG - Intronic
1169631106 20:7633026-7633048 CTTTATAAATGAATTCAACAAGG - Intergenic
1170107083 20:12763330-12763352 CTGGAAAGCTAAATTCAGCAAGG - Intergenic
1172866613 20:38104635-38104657 ATGTAAAAATCAATTCAGAATGG + Intronic
1173364781 20:42375337-42375359 GTTTGAACATGAATTCAGTAGGG - Intronic
1174769591 20:53286138-53286160 ATGTAAACAAGAATCCAGGAAGG - Intronic
1175062593 20:56257261-56257283 GTGTAGACTTGATTTCAGCACGG - Intergenic
1175149320 20:56920712-56920734 CTGAAATCATGATGTCAGCAGGG + Intergenic
1178468844 21:32873674-32873696 TTTTAAAAATAAATTCAGCAAGG + Intergenic
1179312963 21:40213027-40213049 CTGAAATCAAGAAGTCAGCAGGG - Intronic
1182555560 22:31126756-31126778 CTGGAGCCAGGAATTCAGCAGGG - Intronic
1184334732 22:43846442-43846464 CAGGAAATATGAATTGAGCATGG - Intronic
949194762 3:1291358-1291380 AGGTAAAAATGAATTCACCAGGG + Intronic
950336056 3:12194167-12194189 ATATAAAAATGAATTAAGCAAGG + Intergenic
951522254 3:23620895-23620917 TTGAAAACATGATTTCACCACGG + Intergenic
952690947 3:36205103-36205125 CTGTAAACATCATGACAGCAGGG - Intergenic
953612344 3:44457689-44457711 TTGTACACTTGAATTCAGAATGG + Intronic
957229153 3:77489419-77489441 CTGTTCAAATGAACTCAGCAGGG - Intronic
957532512 3:81458757-81458779 CTGTAAACTTGAGTTAGGCAAGG + Intergenic
960258205 3:115533580-115533602 CTGTCAACCTGAAGTCTGCAGGG - Intergenic
960594876 3:119399154-119399176 CTGTTAATATGCATTCATCAAGG + Intronic
961654665 3:128434630-128434652 CTTTAAAGATAAATTCAGCCTGG - Intergenic
964091028 3:152875465-152875487 CTGTAAACATTAATTATCCAGGG + Intergenic
964201050 3:154120066-154120088 CTGCATTCATGCATTCAGCAGGG - Intergenic
965850907 3:173021865-173021887 CTGGAAACATCCATTCAGTAAGG - Intronic
969051412 4:4375918-4375940 TTGTAAACGGGAATTCTGCAGGG - Intronic
970566297 4:17335316-17335338 CTGAAAGCAAGAAGTCAGCAGGG - Intergenic
971193590 4:24450660-24450682 TTGTAATGATGAATTCAACAAGG - Intergenic
971695823 4:29901628-29901650 CTGTAAAAAGGAACACAGCACGG + Intergenic
972975943 4:44636290-44636312 CAATAAACATTAATTGAGCATGG + Intronic
973266256 4:48214257-48214279 ATTTAAACAGGAATTCAGAAAGG + Intronic
977849849 4:101813724-101813746 CAGTAAACATAACTTCTGCATGG - Intronic
977982633 4:103343200-103343222 CTGGAAAACTGAATTCATCAAGG + Intergenic
978836033 4:113150508-113150530 CAGTAAGCATGTATTCAGCCAGG + Intronic
979185597 4:117788025-117788047 ATTGAAACATGATTTCAGCAAGG - Intergenic
979952002 4:126904838-126904860 CCTTAAACAGGAATTTAGCATGG + Intergenic
981169765 4:141607538-141607560 CTATAACCATGCATTCATCATGG - Intergenic
981580447 4:146244396-146244418 CTGTATAGATGAACTGAGCACGG - Intergenic
981719730 4:147789187-147789209 CTGTAAGCTTAAGTTCAGCATGG + Intronic
982954845 4:161751328-161751350 CTATAAACATGTATTCAAAAAGG - Intronic
984385783 4:179055891-179055913 GTGTCAACATGAATTTTGCAGGG - Intergenic
987931258 5:24401841-24401863 CTGAAAGCAAGACTTCAGCAGGG + Intergenic
988385154 5:30553478-30553500 CTGCAAACATTATTTTAGCAAGG - Intergenic
989310849 5:40015988-40016010 CTGCAAACATCAATTCGGCCTGG - Intergenic
989329796 5:40243557-40243579 CTGTAAACATATATTGAACAAGG + Intergenic
992593655 5:78323643-78323665 CTGCAAACATGAATAAGGCATGG - Intergenic
993303371 5:86242273-86242295 CTGTAGACATTAATTCCCCAAGG + Intergenic
995998389 5:118328010-118328032 CGGTAAAGATGAAGTCAGCCAGG + Intergenic
996034918 5:118748146-118748168 ATATAAACATGAATTTAACATGG + Intergenic
1000053164 5:157579413-157579435 TTGTTAACATGAACCCAGCAAGG + Intergenic
1000505739 5:162115520-162115542 CTGATAAAATGAATTCAGCATGG + Intronic
1001226867 5:169952325-169952347 ATGTAAAAATCAATGCAGCATGG + Intronic
1002724843 5:181287882-181287904 ATGTAAAAATCAATGCAGCATGG + Intergenic
1004782991 6:18933002-18933024 CTTTAAACATAAATTCAGGAGGG + Intergenic
1004824910 6:19408928-19408950 CAGTAAAAACAAATTCAGCATGG - Intergenic
1007875073 6:45088878-45088900 CTGTAAACAATAGTTCAGTATGG - Intronic
1008899920 6:56600340-56600362 CTGTAAACATGATAGCAGTAGGG + Intronic
1009335793 6:62489863-62489885 CTGGAAACACGAAGTCAGAAAGG - Intergenic
1009766330 6:68080407-68080429 ATGTAAACATAAATTAAGAAAGG - Intergenic
1011911231 6:92442049-92442071 CTATAAAAAGGAAGTCAGCAGGG - Intergenic
1012075598 6:94680827-94680849 GTGTAGACATAAACTCAGCAGGG + Intergenic
1012648527 6:101721258-101721280 CTATAAAAATGTATTCAGCAAGG + Intronic
1014330995 6:120063457-120063479 CTGTGAACATGATTTCATAATGG - Intergenic
1015458570 6:133461005-133461027 CTGGAAACATGTATTTAACATGG + Intronic
1015679476 6:135789066-135789088 CAATAAACATGAAATCAGAATGG + Intergenic
1015800236 6:137052940-137052962 CTGTACAGATGAGTTCAGCTTGG - Intergenic
1016045493 6:139476651-139476673 ATGTAAACATGAATCCAGCCTGG - Intergenic
1016554481 6:145320448-145320470 CTTTAAAAATAAATTCAACATGG - Intergenic
1016831394 6:148436780-148436802 CTGTGAATATGAATTCAGAAAGG - Intronic
1017340217 6:153312455-153312477 ACGCAAACATGAATCCAGCATGG + Intergenic
1017772405 6:157653322-157653344 CTTTAAACATGACTACGGCATGG - Intronic
1018931143 6:168241241-168241263 CTGGAAACATGACATCAGCAAGG + Intergenic
1020346219 7:7166774-7166796 GTGTAAACATTAAATCAGTAAGG + Intronic
1021286988 7:18792879-18792901 CTGTAAACCTGCAGTCAGAAAGG + Intronic
1021607150 7:22419647-22419669 CTGTCAACATGGATCCGGCAGGG - Intronic
1021904648 7:25321482-25321504 CTGCAAACAAGGATTCATCATGG - Intergenic
1024115325 7:46187422-46187444 ATGTCAACATGAATGCAGAATGG + Intergenic
1024215881 7:47247714-47247736 CTGGAAGCCTGAAGTCAGCAGGG - Intergenic
1024614869 7:51103103-51103125 CTGTAAACAGGCTTTCAGAAAGG + Intronic
1025232179 7:57210211-57210233 CTCAAAAGATGAATTCAGTAAGG - Intergenic
1025240122 7:57264779-57264801 CTGTAAACATACATTCAGGATGG - Intergenic
1028297980 7:89159347-89159369 CTGTTAAAGTGAATTGAGCAAGG + Intronic
1028632905 7:92955394-92955416 TTGTAAACATGAATAAAGCATGG + Intergenic
1030514291 7:110520630-110520652 CTGTAAACATTAATCCTTCATGG + Intergenic
1030579570 7:111336780-111336802 ATGTAAACATGAATTCATTTTGG - Intronic
1030964776 7:115977791-115977813 CTATAAATATCAATTCAGAAAGG + Intronic
1031675586 7:124607882-124607904 CTGGAATCATGAATTCTTCAAGG + Intergenic
1035700215 8:1632686-1632708 CAGTTAACCTGAAGTCAGCATGG - Intronic
1036579818 8:10063528-10063550 ATTTCAACATGAATTCAGTAGGG - Intronic
1037091998 8:14931177-14931199 ATGTAATCAAGAATCCAGCAAGG - Intronic
1039531491 8:38267324-38267346 CTGTACACATCAAGTCAGAATGG + Exonic
1041424415 8:57703941-57703963 CTGAAAACAAGAACACAGCAAGG + Intergenic
1043028013 8:75095496-75095518 CTGTAAACATGATTTAGACATGG + Intergenic
1048276525 8:133070192-133070214 CTGGAAACTGGAAGTCAGCATGG - Intronic
1048575104 8:135684026-135684048 CTCAAAACAGAAATTCAGCAAGG + Intergenic
1049558962 8:143298049-143298071 CTGTCATCATGAATTAAGCGAGG + Exonic
1050320631 9:4448741-4448763 CTGGAAACTTCAATTCAGCATGG - Intergenic
1053532296 9:38894714-38894736 CTGAGACCATGATTTCAGCAAGG - Intergenic
1053539648 9:38960017-38960039 ATGTAAACATGAACTCAGAATGG + Intergenic
1054204521 9:62119123-62119145 CTGAGACCATGATTTCAGCAAGG - Intergenic
1054226039 9:62458802-62458824 ATGTAAAAATCAATGCAGCATGG + Intergenic
1054626493 9:67403901-67403923 ATGTAAACATGAACTCAGAATGG - Intergenic
1054633841 9:67469241-67469263 CTGAGACCATGATTTCAGCAAGG + Intergenic
1058238886 9:102530121-102530143 CTTTTAACACGAATTCAGGAGGG + Intergenic
1059731580 9:117062202-117062224 CTGTAACCATGGATTTATCAAGG + Intronic
1186320171 X:8415699-8415721 ATATGAACATGCATTCAGCAGGG + Intergenic
1186337013 X:8600007-8600029 CTCAAAACATAACTTCAGCAAGG + Intronic
1187314173 X:18176799-18176821 CTGCAAACATGATTACACCAGGG + Intronic
1188046487 X:25431016-25431038 CAGTAAACATGAAATGAACAGGG + Intergenic
1189926158 X:45957814-45957836 CTATAGAGATAAATTCAGCAGGG + Intergenic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1190461788 X:50684092-50684114 GGGTAAACATGAATTTTGCAGGG - Intronic
1191047282 X:56152185-56152207 CTGTCTAAATGAATTCAACAAGG + Intergenic
1196160486 X:112477287-112477309 CTGGAAACATGATTTCAGAAAGG - Intergenic
1198049752 X:132939285-132939307 ACTTAAAAATGAATTCAGCAAGG + Intronic
1199012793 X:142777293-142777315 CTGTAGACATGAATGGAACATGG + Intergenic
1201451611 Y:14121667-14121689 GTGGAAAGATGAATTCAGCATGG + Intergenic