ID: 918115120

View in Genome Browser
Species Human (GRCh38)
Location 1:181489570-181489592
Sequence GGGGGCACTCAAATGTAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918115120_918115128 26 Left 918115120 1:181489570-181489592 CCCTGTTACATTTGAGTGCCCCC 0: 1
1: 0
2: 0
3: 12
4: 95
Right 918115128 1:181489619-181489641 ACTCAGAGACTGTGGTTAAGTGG 0: 1
1: 0
2: 0
3: 17
4: 172
918115120_918115127 18 Left 918115120 1:181489570-181489592 CCCTGTTACATTTGAGTGCCCCC 0: 1
1: 0
2: 0
3: 12
4: 95
Right 918115127 1:181489611-181489633 CCTTTTCTACTCAGAGACTGTGG 0: 1
1: 0
2: 2
3: 28
4: 318
918115120_918115129 30 Left 918115120 1:181489570-181489592 CCCTGTTACATTTGAGTGCCCCC 0: 1
1: 0
2: 0
3: 12
4: 95
Right 918115129 1:181489623-181489645 AGAGACTGTGGTTAAGTGGAAGG 0: 1
1: 0
2: 1
3: 19
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918115120 Original CRISPR GGGGGCACTCAAATGTAACA GGG (reversed) Intronic
900698947 1:4032071-4032093 GGGGGCCCTGGAGTGTAACAGGG + Intergenic
903104153 1:21060251-21060273 GGGTGGACTCAAATCTAAGATGG + Intronic
905783688 1:40735062-40735084 GGGGGCCCTCAAATGTAAGCTGG + Intronic
910064107 1:83132274-83132296 GGCCACACTCAAATGAAACATGG + Intergenic
911285265 1:95983737-95983759 GGGGACACTAAAATGAAAAAAGG - Intergenic
916049020 1:161021793-161021815 GGGAGCACTCAACTGGAAAATGG + Intronic
917798173 1:178547054-178547076 GAGTGCAGTCAAATGTAAGAGGG - Intronic
918115120 1:181489570-181489592 GGGGGCACTCAAATGTAACAGGG - Intronic
918216188 1:182393290-182393312 GGCAGCACTGAAATTTAACAAGG - Intergenic
919229211 1:194751752-194751774 GGGGGAACTCAAATGATAGATGG - Intergenic
920654020 1:207861708-207861730 GGGGGCTCTGAATTGTTACAGGG - Intergenic
923593736 1:235343705-235343727 TGGGGCACATAAATGTTACAAGG - Exonic
924934452 1:248756266-248756288 GAGGACCCTCAAATCTAACAAGG - Intergenic
1065756492 10:28935707-28935729 TGGGGCCTTCAAATGTACCATGG + Intergenic
1067960295 10:50840427-50840449 GGTGGCACTCAAATGAAGCATGG + Intronic
1072686220 10:97538950-97538972 GGAGCCACTCATCTGTAACATGG - Intronic
1079159007 11:17975335-17975357 GGGGTCACTCACATTTATCAAGG - Intronic
1087771753 11:102218231-102218253 GGGATGACTCTAATGTAACAAGG - Intronic
1092132671 12:6123583-6123605 GTGGGCACACAAGTGTAAGACGG - Intronic
1093294471 12:17370945-17370967 GGGGACACTCAAATATAAAGAGG + Intergenic
1094834733 12:34317011-34317033 GGGGGCACCCAAAAGTGGCAAGG - Intergenic
1095675610 12:44914286-44914308 GGGGAGACTGAAATGGAACAAGG - Intronic
1096578466 12:52569482-52569504 GGGGGCACCCAAAGGGGACATGG + Intronic
1099530080 12:83768009-83768031 TGAGGCACACAGATGTAACAAGG - Intergenic
1101208732 12:102514609-102514631 GGGGCCAGTGAAATGAAACAAGG + Intergenic
1102219171 12:111182812-111182834 GGGGGCACTTGAATGTATCCTGG - Intronic
1104246962 12:127052747-127052769 GAGTGCACTTAAATGTAATAAGG + Intergenic
1106930846 13:34662836-34662858 ACTGGCACTAAAATGTAACATGG + Intergenic
1109959585 13:69613211-69613233 GGGGGCACTCCACTGAAAAAGGG - Intergenic
1113304418 13:109061249-109061271 GTGGGCACACGAATGTAAGAAGG - Intronic
1121000423 14:90448211-90448233 GGGGGCACTGCAAAGTTACATGG - Intergenic
1122478420 14:102028648-102028670 GGGGGCACTAAAGTGTTAGACGG - Intronic
1126069217 15:44851102-44851124 GGGGCCCCTCAAATGCCACATGG - Intergenic
1126089596 15:45039670-45039692 GGGGCCCCTCAAATGCCACATGG + Intronic
1129961225 15:79686935-79686957 GGGGGCAGTCAAGTGTGGCAAGG - Intergenic
1132438461 15:101833761-101833783 GGAGGCACTTAAATGTCATATGG + Intergenic
1134364494 16:13564330-13564352 GGGGGCACACAAAGGGAACAGGG - Intergenic
1135548152 16:23379329-23379351 GGGGGCAAACATATGTAAAAAGG + Intronic
1140916367 16:79497403-79497425 GGAGGCACTCACAGCTAACAGGG - Intergenic
1141187534 16:81798552-81798574 GGGGCCACTCCACTGTCACAGGG + Intronic
1143353981 17:6310872-6310894 TGGGGATCTCAAATGTAAAATGG - Intergenic
1146055312 17:29577927-29577949 GGGGACAGACAAATGGAACAAGG + Intronic
1147249253 17:39143438-39143460 GGGGGAACTCAAATCTACCAGGG - Intronic
1148956857 17:51361355-51361377 GGGGGCACTCCACTGGAAAAGGG - Intergenic
1149156447 17:53635801-53635823 TGTGGCAGTCAAATTTAACAAGG + Intergenic
1149447366 17:56724056-56724078 GGGGGCACTGTAAAGTCACATGG + Intergenic
1150500324 17:65644306-65644328 CTTGGCACTCAAATGGAACATGG - Intronic
1151645250 17:75426248-75426270 GGGAACATTCAAATGTAACTCGG + Intergenic
1153296856 18:3554606-3554628 GGTGGCCTGCAAATGTAACAGGG + Intronic
1155695136 18:28676347-28676369 GGGGGCACTAAAAGGTAAGCAGG - Intergenic
1168337533 19:55605101-55605123 GGAGGCACTCAAAAGTCACGAGG + Intergenic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
936140246 2:109933476-109933498 GGGGGCATACAAATGGAACATGG - Intergenic
936176936 2:110231421-110231443 GGGGGCATACAAATGGAACATGG - Intergenic
936204449 2:110438010-110438032 GGGGGCATACAAATGGAACATGG + Intronic
937413599 2:121697190-121697212 GGGGACACTCAAAGGTAAATGGG + Intergenic
937805581 2:126139851-126139873 GGGGGAAAGCAAATGTAAAAAGG - Intergenic
947637302 2:231686532-231686554 GGGGGCACTCAAAGGGCTCAAGG - Intergenic
1168974354 20:1953071-1953093 GGAGGCACTCAAATATGAGAGGG + Intergenic
1168989088 20:2079052-2079074 GGGGCCAAGCAATTGTAACATGG - Intergenic
1169621708 20:7514252-7514274 GAGAGCACTCAAATTTAAGAAGG - Intergenic
1175281716 20:57808263-57808285 AGGGCCACTCAAATGTCAGAAGG - Intergenic
1178823473 21:35995725-35995747 GAGGGCAGTCAAATGTAACCTGG - Intronic
1179799611 21:43804810-43804832 GGGGACACTCGAATGCAGCAGGG - Exonic
1180610760 22:17096250-17096272 GGAGGCAATATAATGTAACATGG + Intronic
954850556 3:53596256-53596278 AGGGGCACTCAAAGGGTACAGGG - Intronic
959217441 3:103469751-103469773 GAGGGCACTCAAATGTAGTTAGG + Intergenic
960450506 3:117801156-117801178 GGGGCCACTCAGATAGAACAAGG - Intergenic
970986267 4:22162503-22162525 GGTGGCACTAAAATATAAAATGG - Intergenic
985996534 5:3600208-3600230 GGGGGCACTCAATGGAGACAAGG + Exonic
987177514 5:15330585-15330607 GGAGGTACTCAAAAGTCACATGG - Intergenic
990444506 5:55881615-55881637 GGGGGCATTCCAATGGAAAAGGG - Intronic
990820701 5:59837024-59837046 GGGGGAAGTGAAGTGTAACATGG - Intronic
994061009 5:95476254-95476276 GGGGGCACTGGAATGTCCCATGG + Intronic
994469484 5:100184675-100184697 GGGTGCACTCAAATGTAATTAGG - Intergenic
994893317 5:105667890-105667912 TGGAGCACTCAAATGTATAAAGG - Intergenic
995453977 5:112332665-112332687 GGGGGGACTAAAATATAACCTGG - Intronic
1001658405 5:173371960-173371982 GGGGGGAATAAAATGTAAAAGGG + Intergenic
1004639865 6:17504780-17504802 GAGGGCATTCACATGTAATAAGG - Intronic
1006589834 6:35146532-35146554 GGAGGCACTCCAGTGTCACAGGG - Intronic
1009512241 6:64567985-64568007 GTGGGAACACAAATGGAACATGG + Intronic
1013741167 6:113287444-113287466 GGGGGAACTCAAACTTAGCACGG - Intergenic
1019030529 6:169006524-169006546 GGGTGCTCTAAAATGTAACCTGG - Intergenic
1023056233 7:36292134-36292156 CGGGGCACTCACATGTAGCGTGG - Intronic
1023627740 7:42133252-42133274 GTTGGCATTCAAATGAAACAAGG + Intronic
1032476150 7:132212776-132212798 TGGGGCACTCCCATGAAACAAGG - Intronic
1032627306 7:133605866-133605888 GGGGGCACTCAAATGCTAAAAGG + Intronic
1040968251 8:53106308-53106330 GGGAGCAGATAAATGTAACATGG + Intergenic
1042667407 8:71221837-71221859 GGGGGCACTCCACTGGAAAAGGG + Intronic
1043043963 8:75297208-75297230 GGAAGCACTCAAAAATAACATGG + Intergenic
1048434232 8:134400924-134400946 TGGGTCCCTCAAATTTAACATGG - Intergenic
1048662224 8:136617938-136617960 GGAGGCACTGCAATGTCACATGG - Intergenic
1050385739 9:5088818-5088840 GGTGGAACTCTAATGTGACAAGG - Intronic
1050480588 9:6083392-6083414 GGGGCCACTCAAAAGTGACTGGG - Intergenic
1052054091 9:23883689-23883711 ATGGACACTAAAATGTAACAAGG - Intergenic
1056120352 9:83481697-83481719 TGGGACATTCAAATGTAACATGG + Intronic
1061993683 9:134173565-134173587 TGGGGCACTGAAATGTCACCTGG - Intergenic
1186680598 X:11869942-11869964 GGGTGCAGTCAATAGTAACAGGG - Intergenic
1187595408 X:20766223-20766245 GTGGGCCTTCAAATATAACATGG + Intergenic
1189024251 X:37375051-37375073 AGAGGAACTCAAATGTAACAGGG - Intronic
1195219370 X:102731877-102731899 GGGGGCACTCCACTGGAAAAGGG - Intronic
1202279964 Y:23172938-23172960 GGTGGCGCTCAAAGCTAACAAGG + Intronic
1202280693 Y:23183783-23183805 GGTGGCGCTCAAAGCTAACAAGG + Intronic
1202281422 Y:23194631-23194653 GGTGGCGCTCAAAGCTAACAAGG + Intronic
1202284469 Y:23223888-23223910 GGTGGCGCTCAAAGCTAACAAGG - Intronic
1202433094 Y:24809016-24809038 GGTGGCGCTCAAAGCTAACAAGG + Intronic
1202436143 Y:24838274-24838296 GGTGGCGCTCAAAGCTAACAAGG - Intronic
1202436871 Y:24849124-24849146 GGTGGCGCTCAAAGCTAACAAGG - Intronic