ID: 918115396

View in Genome Browser
Species Human (GRCh38)
Location 1:181491919-181491941
Sequence ACACCTGGTCTTACAGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918115396_918115412 21 Left 918115396 1:181491919-181491941 CCAGGACCTGTAAGACCAGGTGT 0: 1
1: 0
2: 0
3: 10
4: 114
Right 918115412 1:181491963-181491985 GGTTGCCAGGAGGTGGTGTGAGG 0: 1
1: 0
2: 12
3: 137
4: 852
918115396_918115403 -8 Left 918115396 1:181491919-181491941 CCAGGACCTGTAAGACCAGGTGT 0: 1
1: 0
2: 0
3: 10
4: 114
Right 918115403 1:181491934-181491956 CCAGGTGTAGCCCCAGGGAGGGG 0: 1
1: 0
2: 2
3: 25
4: 316
918115396_918115409 8 Left 918115396 1:181491919-181491941 CCAGGACCTGTAAGACCAGGTGT 0: 1
1: 0
2: 0
3: 10
4: 114
Right 918115409 1:181491950-181491972 GGAGGGGACAGGAGGTTGCCAGG 0: 1
1: 0
2: 3
3: 64
4: 519
918115396_918115413 22 Left 918115396 1:181491919-181491941 CCAGGACCTGTAAGACCAGGTGT 0: 1
1: 0
2: 0
3: 10
4: 114
Right 918115413 1:181491964-181491986 GTTGCCAGGAGGTGGTGTGAGGG 0: 1
1: 0
2: 4
3: 78
4: 708
918115396_918115410 11 Left 918115396 1:181491919-181491941 CCAGGACCTGTAAGACCAGGTGT 0: 1
1: 0
2: 0
3: 10
4: 114
Right 918115410 1:181491953-181491975 GGGGACAGGAGGTTGCCAGGAGG 0: 1
1: 0
2: 2
3: 48
4: 449
918115396_918115415 28 Left 918115396 1:181491919-181491941 CCAGGACCTGTAAGACCAGGTGT 0: 1
1: 0
2: 0
3: 10
4: 114
Right 918115415 1:181491970-181491992 AGGAGGTGGTGTGAGGGCAGTGG 0: 1
1: 0
2: 8
3: 145
4: 1141
918115396_918115401 -9 Left 918115396 1:181491919-181491941 CCAGGACCTGTAAGACCAGGTGT 0: 1
1: 0
2: 0
3: 10
4: 114
Right 918115401 1:181491933-181491955 ACCAGGTGTAGCCCCAGGGAGGG 0: 1
1: 0
2: 0
3: 18
4: 175
918115396_918115404 -3 Left 918115396 1:181491919-181491941 CCAGGACCTGTAAGACCAGGTGT 0: 1
1: 0
2: 0
3: 10
4: 114
Right 918115404 1:181491939-181491961 TGTAGCCCCAGGGAGGGGACAGG 0: 1
1: 0
2: 2
3: 47
4: 379
918115396_918115411 14 Left 918115396 1:181491919-181491941 CCAGGACCTGTAAGACCAGGTGT 0: 1
1: 0
2: 0
3: 10
4: 114
Right 918115411 1:181491956-181491978 GACAGGAGGTTGCCAGGAGGTGG 0: 1
1: 0
2: 4
3: 51
4: 657
918115396_918115405 0 Left 918115396 1:181491919-181491941 CCAGGACCTGTAAGACCAGGTGT 0: 1
1: 0
2: 0
3: 10
4: 114
Right 918115405 1:181491942-181491964 AGCCCCAGGGAGGGGACAGGAGG 0: 1
1: 0
2: 13
3: 95
4: 790
918115396_918115400 -10 Left 918115396 1:181491919-181491941 CCAGGACCTGTAAGACCAGGTGT 0: 1
1: 0
2: 0
3: 10
4: 114
Right 918115400 1:181491932-181491954 GACCAGGTGTAGCCCCAGGGAGG 0: 1
1: 0
2: 3
3: 9
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918115396 Original CRISPR ACACCTGGTCTTACAGGTCC TGG (reversed) Intronic
900154749 1:1199402-1199424 ACACCTGCTCTTAGGGGTCAGGG + Intergenic
901695894 1:11007971-11007993 ACACCTGTGGTTACAGGTACTGG - Intergenic
903263172 1:22142282-22142304 ACGCCTGGTCTCCCAGGGCCCGG - Intronic
903929723 1:26855243-26855265 ACACCTTGTCTTCCAGCTCCTGG - Exonic
904465054 1:30702619-30702641 CCTCCTGGTCTTGCAGGTTCTGG + Intergenic
908097985 1:60760670-60760692 GCACCTGGTCTTACAGATGCAGG + Intergenic
908354561 1:63317545-63317567 ACACCTGGGCTGGCAGGCCCCGG + Intergenic
912985101 1:114419748-114419770 ACAGCTGCTCTTACAGGAGCAGG + Intronic
915321727 1:155060239-155060261 CCTCCTGGTCTTATTGGTCCTGG + Exonic
917797951 1:178545363-178545385 ACACCCCGTCTTCCAGGCCCAGG + Intronic
918115396 1:181491919-181491941 ACACCTGGTCTTACAGGTCCTGG - Intronic
920195802 1:204226306-204226328 ACACATGGGCTTACATGTCAGGG - Intronic
1065696958 10:28388709-28388731 ACCTCTGTTGTTACAGGTCCCGG + Intergenic
1066456226 10:35574661-35574683 GCAGCAGGTCTTACAGGACCTGG + Intergenic
1067068671 10:43117453-43117475 ACACCTGGTCCAAGGGGTCCTGG + Intronic
1068453432 10:57223380-57223402 AAACCTGGTCTTACAGGAACTGG + Intergenic
1070422050 10:76246812-76246834 CCACCTGGTCTTTCAGGACAAGG - Intronic
1073136984 10:101225619-101225641 ACGCTTGGGCTTACAGTTCCAGG + Intergenic
1073558736 10:104479478-104479500 ACTCCTGGTTTTACAGGAACAGG - Intergenic
1078063731 11:8064460-8064482 AGCCCTGGTTTTACAGGTACTGG - Intronic
1084581518 11:70026890-70026912 ACACCTGGTGTTTGAGGACCTGG - Intergenic
1084686042 11:70696002-70696024 ACACCTGTTCTGCCAGGTCCTGG - Intronic
1087063656 11:94008014-94008036 ACACCTGGTCTTCCAGGAAGAGG - Intergenic
1088716577 11:112554619-112554641 AGACCTGAGCTTACAGGTACAGG - Intergenic
1089071138 11:115700625-115700647 ACACCTGCTGTTACTTGTCCAGG + Intergenic
1090732852 11:129586782-129586804 ACACCTGTGCTCACAGGTCAAGG + Intergenic
1091276538 11:134356596-134356618 ACACCTGGTATTGCAGGGGCTGG + Intronic
1095666071 12:44799925-44799947 ACAGATGGTTTCACAGGTCCAGG - Intronic
1096324550 12:50647751-50647773 ACACCTGGGCTTTAAGGACCAGG - Intronic
1098553032 12:71785587-71785609 ACACCTCGCCTTGCAGTTCCCGG - Exonic
1102467236 12:113137064-113137086 ACTCCTGGTCTCACCGGTCTGGG - Intergenic
1106382802 13:29256392-29256414 AGACCTCGTCTTACAGGGCTTGG - Intronic
1108733028 13:53254720-53254742 AAATACGGTCTTACAGGTCCAGG - Intergenic
1111580016 13:90210440-90210462 ACACCTGGTATGACAGGAACTGG - Intergenic
1112655936 13:101452696-101452718 ACACCCAGGCTTGCAGGTCCGGG - Exonic
1114297922 14:21346744-21346766 CCAGCTGGTCTTTCAGCTCCTGG + Intronic
1114778710 14:25514970-25514992 AGACATGGTTTTCCAGGTCCAGG - Intergenic
1121990739 14:98554296-98554318 ACACCTGGGCTAACTTGTCCAGG + Intergenic
1122723314 14:103734480-103734502 TCACTTGGTCTTAGGGGTCCTGG + Exonic
1124208647 15:27744206-27744228 CCACCAGGTCTTAAAGATCCAGG - Intergenic
1125676087 15:41503276-41503298 GCACCTGGTCCTGCAGGACCCGG - Exonic
1125770424 15:42161767-42161789 CCCCCTGTTCTTCCAGGTCCAGG - Exonic
1125958771 15:43811082-43811104 ACTCCTACTCCTACAGGTCCAGG + Intronic
1127215912 15:56822962-56822984 ACTCCTGGGCTTACATGGCCGGG - Intronic
1128679152 15:69635190-69635212 ACACTTTCTCTTACAGGTCAAGG - Intergenic
1130722556 15:86403743-86403765 ACAGCTGGTGTTACAGAGCCAGG + Intronic
1134606183 16:15573108-15573130 ACAGCTGGTCTTACTGTGCCAGG - Intronic
1138652829 16:58471568-58471590 AAACCTGGTCTCACAGAGCCAGG + Intronic
1138843049 16:60532666-60532688 GTACCTGGTATTACAGGTGCAGG + Intergenic
1141431290 16:83971511-83971533 GCACCTGGTCTTGTAGGTTCAGG + Intronic
1143138058 17:4723144-4723166 ATACCTGGGCTTAGAGGTCAAGG - Intergenic
1145739124 17:27257511-27257533 GCCCCAGGTCTTACTGGTCCAGG + Intergenic
1147041715 17:37724368-37724390 CCAGCTGTTCTGACAGGTCCAGG + Intronic
1147346420 17:39799052-39799074 ACCTCTGGTCTTACAGATACAGG - Intronic
1151462384 17:74262199-74262221 CCAGCTGCTCTTACAGGACCAGG + Intergenic
1153987979 18:10369614-10369636 AAAGCTGCTCTTGCAGGTCCAGG + Intergenic
1155294847 18:24375654-24375676 ACACCTGCACTTCCAGATCCTGG + Intronic
1162631073 19:11927222-11927244 ACACCTGGGACTACAGGTGCAGG - Intronic
1163294315 19:16402410-16402432 GCACCTGGTCATACTGCTCCAGG + Exonic
1163720780 19:18897195-18897217 ACACCTGGCCTTCAAGGTGCAGG + Intergenic
1164273112 19:23691388-23691410 ATAGCTGGTATTACAGGTGCAGG - Intergenic
1165445719 19:35856054-35856076 CCTCCAGTTCTTACAGGTCCAGG + Intronic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1166133391 19:40760620-40760642 TCCCCTGGTCATGCAGGTCCTGG - Intronic
1167276566 19:48543625-48543647 ACAGCTGGTTTGACTGGTCCTGG + Intergenic
927768198 2:25833175-25833197 CCACCTGGTTTTACTGGTACCGG - Intronic
945940247 2:215942105-215942127 ACACCTGGTTTTACAGTTCATGG - Intergenic
947167018 2:227273009-227273031 CCAGCTGGTCCTGCAGGTCCTGG - Exonic
1168774167 20:434389-434411 TCACCTGGTCTTTCTGGTGCAGG + Intergenic
1170691124 20:18615893-18615915 AGACGTGGTCTTCCAGCTCCTGG - Intronic
1172795853 20:37536894-37536916 ACACAGGGTCTTACAGGCCAAGG - Intergenic
1172930157 20:38580794-38580816 ACAGCTGGTATTACAGGACCTGG + Intergenic
1174417673 20:50378229-50378251 ACACCTGTTCTGACTGGTCAGGG - Intergenic
1178706288 21:34876125-34876147 ACACTTGGCCTTACAGGGCTGGG + Intronic
1183456614 22:37926472-37926494 ACACCTGGTCACACATGGCCAGG - Intronic
1183777176 22:39973898-39973920 ACAACTGGTCCAACAGGACCTGG - Intergenic
1185148942 22:49153440-49153462 CTTCCTGGTCTTACAGGTCCCGG - Intergenic
1185345398 22:50308427-50308449 CCACCTGGTCCTTCAGGGCCAGG + Intergenic
950579864 3:13855062-13855084 ACATCTGGCCTTCCAGATCCTGG - Intronic
952849482 3:37715751-37715773 GCAAGTGGTCTTCCAGGTCCTGG - Intronic
953252438 3:41258594-41258616 ACTCATGGACTCACAGGTCCAGG - Intronic
955510467 3:59675627-59675649 AGACCAGGTCTCCCAGGTCCTGG + Intergenic
956751009 3:72343921-72343943 GCACCTGGTCTCAGAGGTCAGGG + Intergenic
964071238 3:152635705-152635727 ACAACTGGTCTGAAAAGTCCAGG - Intergenic
964875872 3:161367926-161367948 ACAAGTGGCCTCACAGGTCCTGG + Intronic
968590748 4:1458616-1458638 AGGACTGGTCTTACAGGGCCGGG - Intergenic
969543080 4:7806069-7806091 TCTCCTGGGCTTACAAGTCCTGG - Intronic
970450346 4:16160202-16160224 ACCCATGGTCTTAAGGGTCCTGG + Intergenic
976120010 4:81769666-81769688 ACAGCTGGACTTATAGGTCTGGG - Intronic
978192957 4:105937033-105937055 GCACCTGTGCTTACAGGGCCGGG - Exonic
984428591 4:179619853-179619875 TCACCAGGCCTTACAGGACCTGG + Intergenic
986519845 5:8603068-8603090 ACACATGGTATTACAGGTTCTGG + Intergenic
989029848 5:37107592-37107614 TATCCAGGTCTTACAGGTCCAGG + Exonic
990123363 5:52483842-52483864 ACAGCTTGTCTCACAGGTACTGG - Intergenic
990739190 5:58895012-58895034 GCATCTGGTCACACAGGTCCAGG + Intergenic
993149425 5:84142066-84142088 ACACCTGGTCTTCTTTGTCCTGG + Intronic
996873707 5:128218143-128218165 TCACATGGCCTTACATGTCCTGG - Intergenic
1002465126 5:179404554-179404576 ACACCTGGTCTTGCTGGCCTAGG + Intergenic
1004637450 6:17482737-17482759 ACACCTAGTCGTACAGGACCAGG + Intronic
1006524716 6:34594017-34594039 AGACCTGGTGTAACAGGTTCTGG + Intronic
1020947219 7:14627297-14627319 ACAACTGGTCTTAAAGTACCTGG + Intronic
1022942575 7:35254349-35254371 CCACCTGGTCTCACAGCCCCGGG + Intergenic
1025252976 7:57364321-57364343 ACACCTGTTCTGATAGGTCAGGG + Intergenic
1026461840 7:70621257-70621279 TCTCCTGGCCTTTCAGGTCCAGG + Intronic
1029843435 7:103389570-103389592 ACACCTGGATTTTCAGGACCTGG + Intronic
1031194465 7:118594586-118594608 CCACCTGGACTTACAGATCTAGG + Intergenic
1037408085 8:18565141-18565163 CCACCAGGTCGTTCAGGTCCAGG - Intronic
1037821863 8:22138947-22138969 ACACCTGGTCCTCCAGGTAGAGG + Exonic
1039708828 8:40034988-40035010 ACTCCTGGTCTTACAATTGCAGG - Intergenic
1040089245 8:43379545-43379567 ACACCTTTTCTTACAGGTGCAGG + Intergenic
1040415290 8:47189456-47189478 TCACCTGCTTTTCCAGGTCCAGG + Intergenic
1043024517 8:75049357-75049379 ACACCTGACCTTACAGGAACTGG + Intergenic
1047575078 8:126144027-126144049 AGTCCTGGGATTACAGGTCCAGG - Intergenic
1055553075 9:77449197-77449219 ACACCTGGGCTACCAGGTCTAGG - Intronic
1055594461 9:77850918-77850940 ACACAGGGTCTTAGAGCTCCTGG + Intronic
1055604402 9:77953232-77953254 AGACCTGGTCCTACATTTCCTGG - Intronic
1056207912 9:84338058-84338080 GCACCAGGTCTTACAGGCACAGG + Intronic
1057007319 9:91572089-91572111 ATACCTGGTCTTAAACCTCCAGG + Intronic
1061092478 9:128434326-128434348 ACACCCGCTCCTACAGGGCCAGG - Intronic
1062558453 9:137128123-137128145 ATCCGTGGTCCTACAGGTCCTGG - Intergenic
1062727495 9:138083850-138083872 ACACCTGTTCTCACAGAACCTGG + Intronic
1186511327 X:10132039-10132061 ACACCTGGTTTTACTGCACCGGG - Intronic
1188726883 X:33596209-33596231 ATACATGGTCTTACAGGTAGTGG - Intergenic
1190445081 X:50515738-50515760 GCCCCTGGTCTTACAGTTTCTGG - Intergenic
1195600391 X:106740391-106740413 CCACCTGGTCTGAAAGGTTCAGG + Intronic