ID: 918117966

View in Genome Browser
Species Human (GRCh38)
Location 1:181512881-181512903
Sequence ATAGTATTACAGAACTATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918117966 Original CRISPR ATAGTATTACAGAACTATAT TGG Intronic
901561995 1:10079491-10079513 ATAGGATTACACAATTATATAGG + Intronic
901706214 1:11075325-11075347 TTAGTATTACATATCTTTATAGG + Intronic
907531381 1:55101279-55101301 TTAGTATTTTAGAAATATATAGG - Intronic
912004537 1:104880888-104880910 ATAATATTACAAAAATATACAGG - Intergenic
912673921 1:111658969-111658991 AGAGTATTACATAACGATAAAGG - Intronic
913444064 1:118931121-118931143 AAATTATTACACAACTTTATTGG - Intronic
918117966 1:181512881-181512903 ATAGTATTACAGAACTATATTGG + Intronic
918800644 1:188966499-188966521 ATATAAGTACATAACTATATGGG - Intergenic
918841139 1:189541053-189541075 ATAGTATTTCAAAACTGTTTTGG + Intergenic
918985150 1:191615896-191615918 AGAGTATTAAAGAAAGATATTGG + Intergenic
918991148 1:191698526-191698548 ATACTAATACATAAATATATGGG + Intergenic
921311047 1:213843685-213843707 ATAGTATTTAAGAATTATTTTGG - Intergenic
921617125 1:217282326-217282348 ACTGTATTACATAACCATATAGG - Intergenic
921911918 1:220558970-220558992 CTAGTGTTAGAGAACTAAATAGG + Intronic
921970109 1:221138401-221138423 ATAGTAATAAAGAACAATAAAGG + Intergenic
924079293 1:240376901-240376923 ATAGTATTACACAACTTCACAGG + Intronic
1065283509 10:24164840-24164862 ATAATATTTCTGAACTATTTGGG + Intronic
1068048148 10:51913913-51913935 ATATTTTCACAGTACTATATGGG - Intronic
1069087610 10:64159595-64159617 ATGGTAGTAAAGAACTACATTGG - Intergenic
1070335966 10:75455451-75455473 AAATTATTAGAGAACAATATGGG + Intronic
1073993107 10:109286685-109286707 ATTGTATTACATAAGGATATCGG + Intergenic
1075914230 10:126153755-126153777 ATATTCCTACAGAACTATTTTGG + Intronic
1077674757 11:4186265-4186287 ATAGTTTTACAGCACTTTTTAGG + Intergenic
1077766942 11:5168827-5168849 ATAGTAATACAGGACTGTAATGG + Intronic
1078628757 11:12982688-12982710 AGAGCATTACAGGACTGTATAGG - Intergenic
1078711793 11:13799530-13799552 ATACAAATACAGAACTATATAGG - Intergenic
1081392948 11:42551033-42551055 ATAGTATGCCAGAACTATAAAGG + Intergenic
1086241877 11:84704400-84704422 ATAGTTTTATAGAGCTAAATGGG - Intronic
1088517232 11:110650872-110650894 TTAGAATTCCAGAACTACATTGG - Intronic
1092133652 12:6130790-6130812 ATTGTATTTTATAACTATATGGG - Intergenic
1092317704 12:7436974-7436996 AAAATGTTAAAGAACTATATAGG + Intronic
1093603260 12:21057185-21057207 ATAGTACTATCGAACAATATGGG + Intronic
1094806552 12:34099904-34099926 AGAGTATAACAGAACTAATTAGG + Intergenic
1095125397 12:38471365-38471387 AGAGTATAACAGAACTAATTAGG + Intergenic
1095549881 12:43422900-43422922 ATAGCATAACAAAAATATATTGG + Intronic
1097293468 12:57940072-57940094 ATAGTATTTCAAATGTATATAGG + Intergenic
1099079142 12:78154234-78154256 ATAGTAATATATAAATATATAGG - Intronic
1099840773 12:87963072-87963094 ATATTATTAAATAAATATATTGG - Intergenic
1100126009 12:91426032-91426054 ATTGGATTACAGAAAAATATGGG - Intergenic
1101230284 12:102733908-102733930 ATTGTATTAAAGAATTAAATTGG - Intergenic
1108179622 13:47827895-47827917 AAAATATAACAGAATTATATAGG - Intergenic
1108591286 13:51915133-51915155 AAAGTATTGCAGAAGTGTATTGG - Intergenic
1109094874 13:58101112-58101134 ATTGTATTTCAGAACAATAAGGG + Intergenic
1109552675 13:63924945-63924967 ATATTCTTATAGGACTATATAGG + Intergenic
1110270347 13:73582104-73582126 AGAGTGTTACAGAAATATAAGGG + Intergenic
1110611320 13:77491266-77491288 ATAGTATAACACAAATATCTAGG - Intergenic
1112493955 13:99890984-99891006 ATAATATTTCAAAAATATATAGG + Intronic
1112678824 13:101738407-101738429 ATTGCATTTCAGAACTATGTGGG - Intronic
1112780149 13:102891664-102891686 ATAGAATTACAGAATTAATTGGG - Intergenic
1115104382 14:29743028-29743050 ATTGGATTACAGAAATATAAAGG - Intronic
1117469862 14:56032373-56032395 AAATTATAACATAACTATATTGG + Intergenic
1118028459 14:61795263-61795285 ATAGTATCACAAAACCTTATAGG - Exonic
1118963578 14:70558580-70558602 ATAAGAGTACAGAACTATAGTGG + Intergenic
1119187797 14:72655852-72655874 AAAACATTACAGAACTAAATGGG + Intronic
1120429471 14:84396760-84396782 AAATTATTGCAGAACTGTATAGG + Intergenic
1123634998 15:22296313-22296335 ATTGAATTACTGAATTATATGGG + Intergenic
1125068912 15:35528393-35528415 ATAGTTTTACTGAGCGATATTGG - Intronic
1125268344 15:37910331-37910353 ATATTTTTACAAAACTAAATTGG + Intergenic
1126026053 15:44447265-44447287 ATAGTATTTTAGAACTTTTTTGG + Intronic
1129950253 15:79580847-79580869 ATAGTCTGACAGAAATATACTGG + Intergenic
1132422801 15:101688079-101688101 ATATTTTTACATAAATATATAGG + Intronic
1133630838 16:7619570-7619592 GTACTATTACAGAACTATTTAGG - Intronic
1135577804 16:23599430-23599452 ATGGTATTAGAGATCTATAAAGG - Intergenic
1137924581 16:52528093-52528115 ATATTTTAACAGAACTATCTGGG - Intronic
1140609390 16:76580262-76580284 ATAGTATGTGAAAACTATATAGG + Intronic
1140627291 16:76809586-76809608 ACAGTATAACAGAACAATGTGGG + Intergenic
1149149804 17:53547602-53547624 ATAATATTACAAAAGTATACTGG + Intergenic
1156017830 18:32566235-32566257 ATTGTATTACAGATATATTTCGG + Intergenic
1158926371 18:62267089-62267111 AAAGTATTATAGAACTAATTAGG - Intronic
1159197674 18:65139219-65139241 ATATAATTACTGAACTATTTGGG - Intergenic
1159284448 18:66330944-66330966 ATATTTTAACAAAACTATATAGG + Intergenic
1159748549 18:72270874-72270896 ATAATAGTACATAAATATATAGG - Intergenic
1165263845 19:34644088-34644110 AAAGTTTTGCAGAACTCTATTGG + Intronic
1166244611 19:41516708-41516730 AAAATAATACAGAACAATATGGG + Intergenic
928516561 2:32050025-32050047 ATAGTATTAAAAAAATATCTGGG + Intergenic
929657178 2:43745338-43745360 ATAGAATTACAGAACCACAAGGG + Intronic
930340560 2:50109318-50109340 ATAGAATTACAGAACCAGAAAGG - Intronic
931215920 2:60244561-60244583 ATATTTTTCCAAAACTATATAGG - Intergenic
931499609 2:62850675-62850697 AAAGTATTATATAAATATATTGG + Intronic
931833446 2:66075407-66075429 ATAGAATTTCAGACCTAGATTGG + Intergenic
933353353 2:81184116-81184138 GTATTATTACAGCAATATATTGG + Intergenic
934537819 2:95150824-95150846 AAAGTATTATAGAGCTATAGTGG - Intronic
937494793 2:122406596-122406618 ATAGAATTAAAGATCTATTTTGG - Intergenic
937813728 2:126227828-126227850 ATAGTTTCTCAGAACAATATGGG - Intergenic
938886769 2:135657729-135657751 CCAGTATTACAGAAGTATGTGGG - Intronic
941461769 2:165780434-165780456 CTAGAAATACAGATCTATATTGG - Intronic
943447314 2:188003620-188003642 ATAGTGTCACACAACTGTATTGG - Intergenic
945599964 2:211848633-211848655 ATAATACTACAAAACCATATTGG + Intronic
945734368 2:213580484-213580506 ATTGTATTACATAATTCTATGGG + Intronic
946681391 2:222220724-222220746 ATATTATTACACAAATATTTAGG - Intronic
948287070 2:236794010-236794032 CTAGTATTTCAGAACAAAATGGG - Intergenic
948511753 2:238471405-238471427 ATAATATCACAGAAATATAAAGG - Intergenic
1171802868 20:29642704-29642726 TTAATTTTACAGAAATATATTGG - Intergenic
1172377714 20:34458931-34458953 ATAGTATTACAGACTGTTATGGG - Intronic
1177192661 21:17869188-17869210 AAAGGATTACAGAACCATGTAGG + Intergenic
1177474161 21:21596972-21596994 AAAGTATTACATAACAATAAAGG - Intergenic
1177529100 21:22337346-22337368 ATTGTATTTCAGACCTCTATGGG + Intergenic
1177558339 21:22719030-22719052 ATTTTATTACAGAACTCTTTGGG - Intergenic
1178073926 21:28998339-28998361 ATAGTACTAGAGGAATATATAGG + Intergenic
1178461241 21:32804444-32804466 ATAATACTACAGAACTATTCAGG - Intronic
1178860137 21:36282083-36282105 ATAGAACTTCAGAAGTATATTGG + Intronic
1180904247 22:19397361-19397383 TTTGGATTACAGATCTATATGGG - Intronic
1182187643 22:28423521-28423543 GTAGTATTATAGAACTATAGAGG - Intronic
951674632 3:25223481-25223503 AAAGTATTAAAAAAATATATTGG - Intronic
952154905 3:30632080-30632102 AAAGAATTACAGAAGAATATGGG - Intronic
952764204 3:36941118-36941140 AGAGAATTATAGCACTATATTGG - Intronic
952894511 3:38068915-38068937 GTAGTATGATATAACTATATTGG + Intronic
955131898 3:56178308-56178330 ATAGATTTACAGAACAATAATGG - Intronic
955350225 3:58188152-58188174 ATTGTATTTTACAACTATATTGG + Intergenic
956345807 3:68277205-68277227 AAAGCATTACTGAACTATCTAGG - Intronic
956368334 3:68530936-68530958 ATAGAATTAAAAAAATATATTGG - Intronic
956389023 3:68751991-68752013 ATAGACATACACAACTATATGGG - Intronic
956934508 3:74084660-74084682 ATAGTATGTCAGAAATATAGAGG + Intergenic
957469876 3:80645176-80645198 ATTGACTTACAGAAGTATATAGG - Intergenic
957742965 3:84298306-84298328 ATATAATTACAGAACAATATTGG - Intergenic
958767043 3:98381406-98381428 ATACGATTACAAGACTATATTGG - Intergenic
961161211 3:124727957-124727979 CTAATATTCCATAACTATATTGG - Intergenic
963654456 3:148027056-148027078 ATAGTTTTACAGAAGTATTTAGG - Intergenic
964210701 3:154224035-154224057 ATAGTATTTCAGTACTATTTAGG + Intronic
964796784 3:160506774-160506796 ATAGTGTTACAGAACTAATTAGG - Intronic
966046170 3:175552613-175552635 ATAGTCTTACAGTGCTATGTTGG + Intronic
970122930 4:12777512-12777534 ATAGTTTTACATAAATAAATAGG + Intergenic
974139058 4:57860490-57860512 ATAGAATTACAGAAAATTATAGG - Intergenic
974601526 4:64088633-64088655 AAAGTATCACAGAAATAAATTGG + Intergenic
974762627 4:66297975-66297997 AGAGTATAATAGAACAATATAGG + Intergenic
974915857 4:68177356-68177378 ATGGTACTACAGAAGCATATGGG - Intergenic
975314923 4:72940511-72940533 AAAATATTACTTAACTATATAGG - Intergenic
976843819 4:89463731-89463753 ATAGTAAAACAGAAATTTATTGG - Intergenic
977059015 4:92233354-92233376 ATAAGATTACTGAAATATATGGG + Intergenic
977924960 4:102689500-102689522 ATAGTAATACAGATCTTCATGGG - Intronic
978079938 4:104579755-104579777 ATCGTATTACAAAAGTTTATTGG - Intergenic
979193126 4:117887587-117887609 ATAGTATTTCAGATACATATGGG + Intergenic
981805454 4:148710176-148710198 CAAATAATACAGAACTATATAGG - Intergenic
982986418 4:162213173-162213195 ATAGTTTTATAGAATTATTTTGG - Intergenic
983350950 4:166587413-166587435 ATTGTTTTACAAAATTATATGGG + Intergenic
987730904 5:21771470-21771492 ATGGAATCACAGAAGTATATTGG - Intronic
989109541 5:37893978-37894000 ATAGTAGGACAGAATTATGTTGG - Intergenic
989461967 5:41710753-41710775 AGAGCATTACATAACTATAAAGG - Intergenic
990565864 5:57028197-57028219 TTATTATAGCAGAACTATATTGG + Intergenic
991341849 5:65620447-65620469 ATAATACTATAAAACTATATAGG + Intronic
993845878 5:92942550-92942572 ATAGTAACACAGATTTATATAGG - Intergenic
994275345 5:97830162-97830184 ATTGTATGAAAGAACTATCTGGG - Intergenic
995099985 5:108288572-108288594 ATAGTGTTATATAAATATATTGG + Intronic
995281728 5:110343102-110343124 ACAGTATTACAGAACTGGAGAGG + Intronic
995813789 5:116142679-116142701 ATAATATTACAAAAATATCTGGG - Intronic
998915735 5:147009357-147009379 AGTGTCTTACAGAAGTATATAGG - Intronic
1003992704 6:11502465-11502487 ATAGCATTAGACAACTATATTGG - Intergenic
1005273701 6:24193694-24193716 AAAGTATTACAAAATTATAGTGG + Intronic
1010070051 6:71733397-71733419 ATAGTATTATAAAACTATAAAGG + Intergenic
1012783693 6:103595844-103595866 ATAGTGGTACAGAGGTATATAGG + Intergenic
1013689432 6:112623138-112623160 AAAGTATAACAAAACTATAAAGG - Intergenic
1014091161 6:117404817-117404839 ATAAAATTTCAGAAATATATTGG - Intronic
1014150612 6:118050415-118050437 ATAGTATTACAGTGCAATAAGGG + Intronic
1014205752 6:118653051-118653073 AAAATATTACAGAAATATCTTGG + Intronic
1016175395 6:141072779-141072801 ATGGGATTACAGGACTGTATTGG - Intergenic
1016674840 6:146751905-146751927 TTTGTTTTACAGTACTATATTGG + Intronic
1017288018 6:152700992-152701014 GTATTATTCCACAACTATATAGG - Intronic
1017709677 6:157156450-157156472 TTAGAATTACAGAACTATTATGG + Intronic
1020146462 7:5647815-5647837 ATAATACTACAAACCTATATTGG + Intronic
1020648490 7:10845116-10845138 ACAGTATCACACCACTATATAGG + Intergenic
1022955920 7:35379981-35380003 AGAGTATTATAGAACCAAATAGG + Intergenic
1023427942 7:40058931-40058953 ATAGTATAAAAGAAGTACATGGG + Intronic
1026212891 7:68322684-68322706 AGACTATTACAGAACCATACCGG + Intergenic
1028045408 7:86111128-86111150 ATAGATTTACTGAACTATTTTGG + Intergenic
1028468885 7:91183529-91183551 AAACTCTTACAGAAATATATTGG - Intronic
1030942699 7:115674295-115674317 ATAATTTTACATAACTATCTTGG + Intergenic
1031010699 7:116523686-116523708 AAAGTATAAAAGAACTATAAAGG - Intergenic
1031476895 7:122234226-122234248 AAAATATTTCAGTACTATATAGG + Intergenic
1031626018 7:123993770-123993792 ATAATATGATAGAACCATATTGG - Intergenic
1032346640 7:131122578-131122600 AGTGTATTACAGAACTGTAGTGG - Intronic
1033796796 7:144854831-144854853 ATAATAATAAAGAATTATATAGG + Intergenic
1033885477 7:145939582-145939604 TTAGTACTACAGAAGTATAAAGG + Intergenic
1036385657 8:8278270-8278292 AGAGTATCACAGAAATAAATAGG - Intergenic
1043084024 8:75804621-75804643 ACCGTATTTCAGAAATATATGGG - Intergenic
1043509638 8:80936880-80936902 ATAATATAACAGAAATAAATAGG - Intergenic
1043629874 8:82316983-82317005 ATAGCATTTTAAAACTATATAGG + Intergenic
1046321616 8:112584593-112584615 ACTGTATGACATAACTATATTGG - Intronic
1048736906 8:137512321-137512343 ATAATATTACAGAAATAATTGGG - Intergenic
1052086617 9:24274900-24274922 ATACTATTACTGAAATATTTGGG + Intergenic
1052387673 9:27840960-27840982 ATTGTATTACAGAAATATAGGGG + Intergenic
1053716913 9:40906191-40906213 ATAGGATTCCAGAACAATCTCGG + Intergenic
1054075750 9:60527355-60527377 ATAGGATTCCAGAACAATCTCGG - Intergenic
1058343544 9:103928396-103928418 AAAGCATTAGGGAACTATATGGG + Intergenic
1061460711 9:130736261-130736283 AGAGTAATAGAGATCTATATTGG + Intronic
1062605444 9:137346303-137346325 ATGTTATTAAAAAACTATATGGG + Intronic
1186290698 X:8094692-8094714 ATAGTATTACTGTATTTTATTGG + Intergenic
1187657666 X:21496124-21496146 ATATCATTACATAATTATATGGG + Intronic
1187821173 X:23290073-23290095 ATATTCTTACAACACTATATAGG + Intergenic
1188565251 X:31519932-31519954 ATAGGATGAAAGAACTATCTAGG - Intronic
1189165688 X:38858635-38858657 ATAATATTACAGAAATAAAGGGG + Intergenic
1189259031 X:39664495-39664517 ATAGTACTACTGAAATATAAAGG - Intergenic
1189651621 X:43196035-43196057 ATATTATTACAGTAATATAATGG - Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1190178098 X:48167920-48167942 TGTGTAATACAGAACTATATTGG - Intergenic
1190180052 X:48184509-48184531 TGTGTAATACAGAACTATATTGG + Intergenic
1190189993 X:48269011-48269033 TGTGTAATACAGAACTATATTGG - Intronic
1190193066 X:48293731-48293753 TGTGTAATACAGAACTATATTGG + Intergenic
1190197221 X:48329704-48329726 TGTGTAATACAGAACTATATTGG - Intergenic
1190199042 X:48344708-48344730 TGTGTAATACAGAACTATATTGG + Intergenic
1190659575 X:52642344-52642366 TGTGTAATACAGAACTATATTGG + Intergenic
1190663953 X:52680080-52680102 TGTGTAATACAGAACTATATTGG - Intronic
1190665802 X:52695178-52695200 TGTGTAATACAGAACTATATTGG + Intronic
1190673616 X:52763232-52763254 TGTGTAATACAGAACTATATTGG - Intronic
1190675469 X:52778342-52778364 TGTGTAATACAGAACTATATTGG + Intronic
1190677154 X:52792000-52792022 TGGGTAATACAGAACTATATTGG - Intergenic
1193670521 X:84379223-84379245 ATAATATTTCAGATCTATATGGG - Intronic
1194904369 X:99556088-99556110 ATACTATTACAGAAATATGGAGG - Intergenic
1199925545 X:152459776-152459798 ATAGTATCACAGAAATACAAAGG + Intergenic