ID: 918118538

View in Genome Browser
Species Human (GRCh38)
Location 1:181517395-181517417
Sequence TACTTTAACCAGAGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918118531_918118538 24 Left 918118531 1:181517348-181517370 CCTGCAGAGGTCAGCAGGGGCCA 0: 1
1: 0
2: 3
3: 60
4: 424
Right 918118538 1:181517395-181517417 TACTTTAACCAGAGGGCAGTGGG 0: 1
1: 0
2: 1
3: 17
4: 174
918118534_918118538 -6 Left 918118534 1:181517378-181517400 CCATTCTGAGTAGTCTGTACTTT 0: 1
1: 0
2: 1
3: 13
4: 235
Right 918118538 1:181517395-181517417 TACTTTAACCAGAGGGCAGTGGG 0: 1
1: 0
2: 1
3: 17
4: 174
918118533_918118538 4 Left 918118533 1:181517368-181517390 CCAGTCTAGGCCATTCTGAGTAG 0: 1
1: 0
2: 0
3: 5
4: 116
Right 918118538 1:181517395-181517417 TACTTTAACCAGAGGGCAGTGGG 0: 1
1: 0
2: 1
3: 17
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918118538 Original CRISPR TACTTTAACCAGAGGGCAGT GGG Intronic
905662746 1:39739805-39739827 CACTTTATCCTGAGGACAGTGGG + Intronic
905914108 1:41673200-41673222 TGCTCTAACCACAGGACAGTTGG + Intronic
906989239 1:50720569-50720591 TACTTTGAACTGAGGGCACTTGG + Intronic
907623073 1:56001665-56001687 AAATTGAACCAGAGGCCAGTGGG - Intergenic
908376660 1:63549082-63549104 TACTTGGAGCAAAGGGCAGTAGG + Intronic
910269679 1:85380496-85380518 TCATGTAACCAGAGGCCAGTGGG - Intronic
911165566 1:94721434-94721456 TAATGCAACCAGAGGGCAGAAGG + Intergenic
911175315 1:94812014-94812036 TATTTTATCCAGAGGGCATCAGG + Intergenic
911646633 1:100343982-100344004 GACTTTATCCAGAGGGCAATGGG - Intergenic
912254298 1:108043542-108043564 TACTTCAGCCAGAGGGAAATAGG + Intergenic
912352651 1:109028908-109028930 GATTTTAACCAGAGGCCAGAAGG - Intronic
914983647 1:152438557-152438579 TACTTTAACCAAAAGGCACAGGG + Intergenic
915146198 1:153797006-153797028 GACTTGATCCAGAGGGTAGTGGG + Intergenic
917858102 1:179118407-179118429 TACTTTAATCAGAGTACAGTAGG + Intronic
918118538 1:181517395-181517417 TACTTTAACCAGAGGGCAGTGGG + Intronic
918535438 1:185569250-185569272 AACTATGACCAGTGGGCAGTAGG + Intergenic
922184276 1:223260140-223260162 TACTTTTACCAAAGGGCACACGG - Intronic
923796815 1:237164656-237164678 CACTTTAGCCAGAGGGCACTTGG + Intronic
924319417 1:242832757-242832779 GACTTTATCCAAAGGACAGTTGG + Intergenic
1065156361 10:22874004-22874026 TACTTTAAACTGAGGGACGTTGG + Intergenic
1065270055 10:24020257-24020279 TAGTTTTACAAGAGGGAAGTTGG + Intronic
1067540495 10:47147653-47147675 TACTTCAAGAAAAGGGCAGTTGG - Intergenic
1067655809 10:48190356-48190378 TCCTTTGACCAAAGGGAAGTAGG + Intronic
1068758446 10:60681292-60681314 GACTTGGACCTGAGGGCAGTGGG - Intronic
1069101694 10:64330266-64330288 GGCTTAAACAAGAGGGCAGTTGG + Intergenic
1069979112 10:72239961-72239983 AACTTCAACCAGAGGACAGTGGG + Intergenic
1074324246 10:112432465-112432487 TCCTTTATTCAGAGGGCAGCAGG + Exonic
1078568035 11:12434148-12434170 TATTTTAACCAGAGGGCACTTGG - Intronic
1078664185 11:13310777-13310799 GACTTTATCCTGAAGGCAGTGGG + Intronic
1078791894 11:14551782-14551804 TACTTTAAAGAGGGGACAGTGGG + Intronic
1079110598 11:17603041-17603063 GACTTTATCCTGAGGGCAATGGG + Intronic
1079126953 11:17723886-17723908 GACTTTATCTCGAGGGCAGTAGG + Intergenic
1079985709 11:27198344-27198366 TTCTTTATCCTGAGAGCAGTAGG + Intergenic
1080201619 11:29678060-29678082 AACTTTAAAGAGAGGTCAGTAGG + Intergenic
1082193870 11:49278540-49278562 TACTTTAGGCTGAAGGCAGTAGG + Intergenic
1083238649 11:61369280-61369302 TACTTGACCCAGAGGGAAGATGG + Exonic
1085018450 11:73190415-73190437 GACCTTATCCAGAGGGCAGTGGG + Intergenic
1086672275 11:89562519-89562541 TACTTTAGGCTGAAGGCAGTAGG - Intergenic
1091820845 12:3474135-3474157 GACTTTATCCTGAAGGCAGTGGG - Intronic
1096753678 12:53780948-53780970 GACTTTATCCTGAGGGCAGAAGG + Intergenic
1099259925 12:80365549-80365571 TACTTTAAAAAGATGGCATTAGG - Intronic
1100237237 12:92673021-92673043 TACTTTATCCTGAGAGCAATGGG + Intergenic
1100331021 12:93582314-93582336 GAATTTATCCTGAGGGCAGTAGG + Intronic
1100699180 12:97128268-97128290 TGCTTTATCCAGAGGGCTCTGGG + Intergenic
1101527867 12:105548083-105548105 TCCATGAACCAGAGGGCTGTAGG + Intergenic
1103471009 12:121181071-121181093 TACTTTTAAGAGAGGGCAGTTGG - Intronic
1105435878 13:20378070-20378092 GACTTTAACCTAAGGACAGTGGG - Intergenic
1106734340 13:32573776-32573798 TACTTTATCCCCAGGGCACTTGG + Intergenic
1107043700 13:35974277-35974299 TACTTTAAAATGAGGTCAGTGGG + Intronic
1108404037 13:50081851-50081873 TACTTGGAGCAAAGGGCAGTCGG - Intergenic
1109432198 13:62250768-62250790 TAATTCAACCAGAGGGCATAAGG + Intergenic
1109836476 13:67863827-67863849 ATATTTAACCAGAAGGCAGTGGG + Intergenic
1110077900 13:71273081-71273103 TACTTTAAACAGAGGACAATTGG - Intergenic
1110591477 13:77267461-77267483 TACTTTAACAACAGTGCAGTTGG - Intronic
1111980739 13:95012886-95012908 TACTTTTCTCAGAGGGCTGTTGG - Intergenic
1112551878 13:100428888-100428910 TACTTTATCCCTAGGTCAGTAGG + Intronic
1113598519 13:111551477-111551499 CAATTTAATTAGAGGGCAGTGGG + Intergenic
1113957934 13:114109101-114109123 TCCTTAAGCCAGAGGGCAGGCGG + Intronic
1116174473 14:41450000-41450022 TTACTTAACCAGAGGGCACTTGG + Intergenic
1116605442 14:46987475-46987497 TCCTTTATGCAGAGGGCAGAAGG + Intronic
1118079266 14:62339512-62339534 TAGTTGCACCAGAGGGCTGTGGG + Intergenic
1119331899 14:73801039-73801061 GACTTTATCCACAGGACAGTGGG - Intergenic
1122674758 14:103402581-103402603 TACATTAAATAGAAGGCAGTTGG + Intronic
1128693262 15:69741702-69741724 TCCTTTATCCAGTGGGCAATGGG - Intergenic
1129076062 15:72997111-72997133 TACTTTGAACAGAGAGCACTTGG - Intergenic
1129935865 15:79449864-79449886 TACTCTAGGCAGAGGGCAGAAGG - Intronic
1133820088 16:9228216-9228238 GACTTTATCCTGAGGGCAATGGG + Intergenic
1134780846 16:16893996-16894018 TATTTTGACCAGAGGCCAGTAGG - Intergenic
1135972205 16:27080742-27080764 GACTTTACCCCGAGGGCAATGGG - Intergenic
1138096881 16:54218841-54218863 GACTTTAGCCTGAGGTCAGTGGG + Intergenic
1138496086 16:57410265-57410287 GGCTTTAGCCAGAGGGCACTGGG - Intronic
1139614986 16:68083549-68083571 GACTTTATCCTGACGGCAGTAGG - Intergenic
1143375729 17:6466000-6466022 GACTCTACGCAGAGGGCAGTGGG - Intronic
1144464352 17:15485091-15485113 TACTTTTAACTGAGGGCATTTGG + Intronic
1146227954 17:31083592-31083614 CACGTTAAGCAGAGGGCATTAGG + Intergenic
1156902430 18:42316056-42316078 CACTAAAACCAGAGGGCAGAAGG - Intergenic
1157374289 18:47149465-47149487 GACTTTATCCAGAGGTCAGCGGG - Intronic
1157436343 18:47672668-47672690 TAATTTGACTAGAGGGCAGCAGG + Intergenic
1157850022 18:51039945-51039967 TTCTTCAAACTGAGGGCAGTTGG - Intronic
1163177835 19:15576908-15576930 GACTTGATCCAGAGGGCACTGGG + Intergenic
1163187651 19:15650256-15650278 AACTTGACCCAGAGGGCACTGGG + Intronic
1163189664 19:15667314-15667336 GACTTGATCCAGAGGGCACTGGG + Intergenic
1163201231 19:15770891-15770913 GACTTCATCCAGAGGGCACTGGG - Intergenic
1163220194 19:15913475-15913497 AACTTTATCCTGTGGGCAGTAGG - Exonic
1163568096 19:18063747-18063769 TACTTTCTCCTGAGGGCAGTAGG + Intronic
1166007500 19:39917459-39917481 GACTTTATCTAGAGGGCAATGGG + Intronic
1166565570 19:43763510-43763532 GACTTTGACAGGAGGGCAGTGGG + Intergenic
1168521524 19:57054731-57054753 AACTTTTTCCAGAGGGCAGCAGG - Intergenic
1168581638 19:57559907-57559929 TACATTACCTAGAAGGCAGTGGG - Intergenic
925661251 2:6205313-6205335 ATCTTTAACCAGATGGCTGTTGG - Intergenic
931523160 2:63121669-63121691 TACTTTAAAAAAGGGGCAGTAGG - Exonic
932344439 2:70986361-70986383 GACTTTATCCTGAGGGCAGCAGG + Exonic
933569340 2:83991255-83991277 TACTTTAAACAGAGGTAATTTGG + Intergenic
934085666 2:88507085-88507107 AACTTTATCCTTAGGGCAGTAGG + Intergenic
935122101 2:100192022-100192044 CACTTTATCCCGAGGGCACTGGG - Intergenic
935419488 2:102852766-102852788 TAATCTTGCCAGAGGGCAGTTGG + Intergenic
936882071 2:117265686-117265708 TACTTTAAATAGAGTGCAGTTGG - Intergenic
937417901 2:121731562-121731584 GAATTTATCCTGAGGGCAGTGGG - Intronic
937611222 2:123863928-123863950 CACTTTAAGCTGAGGGCACTTGG - Intergenic
938035087 2:128028382-128028404 TGCCTTAACCTGAGGGCACTGGG + Intergenic
941422185 2:165296175-165296197 TACTTTAGACAGAGGGAAGGAGG - Intronic
945084554 2:206118166-206118188 CACTTTAAGCAGAGGGTATTTGG + Intronic
947838355 2:233190835-233190857 TACCTTATCCCGAGGGCAGTAGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1178241055 21:30901200-30901222 TAATTTACCCAGAGGTCTGTGGG + Intergenic
1181528738 22:23504074-23504096 GACTTTATCCAGAGGGCAGCAGG - Intergenic
1184284190 22:43458846-43458868 CACAATAACCAGAAGGCAGTGGG - Intronic
1184848490 22:47103526-47103548 TACTTGATCCTGAAGGCAGTGGG + Intronic
949325296 3:2856855-2856877 TACTTTATCCAGGAGGCAGTGGG + Intronic
950104168 3:10377777-10377799 GACTTTATCCTGAGGACAGTGGG - Intronic
950398674 3:12753651-12753673 TCCTCTAACCAGGGGGCAGCTGG - Intronic
952329948 3:32355677-32355699 TGCTTTATCCGAAGGGCAGTGGG - Intronic
952427486 3:33190675-33190697 TACTTCAAACTGAGGGCACTTGG + Intronic
953249739 3:41233848-41233870 TACCTTTATCAGAGGCCAGTGGG - Exonic
953540748 3:43815540-43815562 TACTTTAACCATGGGGCACATGG + Intergenic
953908237 3:46879073-46879095 CACTTTAACCAGAGGCCCGAGGG + Intronic
958572598 3:95906993-95907015 TACTGTATCCACAGGGAAGTTGG - Intergenic
959142256 3:102500487-102500509 TATTTTAACCAGAATTCAGTAGG + Intergenic
963982000 3:151548434-151548456 TAATTTAGGCAGAGCGCAGTAGG - Intergenic
966135688 3:176695645-176695667 TTCTTTATCCTGAGGGCACTGGG + Intergenic
966346628 3:178988199-178988221 TACTTTAAACTGAGAGCACTTGG - Intergenic
969170413 4:5357865-5357887 TTCTTTAACCAGATGACAATTGG - Intronic
970345933 4:15152163-15152185 AGCCTGAACCAGAGGGCAGTTGG + Intergenic
970471661 4:16385430-16385452 TAATTCAATCAGAGTGCAGTGGG + Intergenic
970672305 4:18410918-18410940 AGCTGTGACCAGAGGGCAGTTGG + Intergenic
971437052 4:26638759-26638781 TACCTTTTCCAGAGGCCAGTTGG + Exonic
973706967 4:53590715-53590737 TACTGTAACCAAAGGTCAGCAGG + Intronic
974318230 4:60309695-60309717 TAGTTTAACCAGGGTGCTGTAGG - Intergenic
974793841 4:66723062-66723084 TAATTTAACCAGTCTGCAGTAGG + Intergenic
980854353 4:138421532-138421554 GACTTTATGCAGAGGGAAGTGGG + Intergenic
981798549 4:148628720-148628742 TTCTTTAACCAGAAGGTGGTTGG - Intergenic
991045151 5:62214676-62214698 TCCTGTAACCAGAGGGCTGCTGG - Intergenic
991982886 5:72251623-72251645 TACCTCAACCAGAGGCTAGTGGG - Intronic
992751726 5:79868605-79868627 TACTTTATCCTAAGAGCAGTGGG + Intergenic
995046424 5:107653613-107653635 TATTTTAACTAGAGGGAAGAGGG + Intronic
997786436 5:136718056-136718078 TACTTTATCCTGAGGGATGTGGG + Intergenic
997864870 5:137452462-137452484 TTCTTTTACCAGGTGGCAGTAGG - Intronic
998992681 5:147835599-147835621 TCCTTGAATCAGAGGGGAGTAGG - Intergenic
1000407992 5:160908933-160908955 TACCTAAAGCAGAGGGCGGTGGG - Intergenic
1000970660 5:167710714-167710736 GACATTAACCTGAGGGCATTGGG + Intronic
1001571015 5:172730579-172730601 GACTTTATCCAGAAGGCAATAGG - Intergenic
1002025692 5:176394989-176395011 GACTTGATCCAGAAGGCAGTGGG - Intronic
1002784047 6:387992-388014 TACTTATACCAGAGAGGAGTTGG - Intergenic
1003995452 6:11536633-11536655 TTCTTTATCCAGATGGCAGAGGG + Intergenic
1006852057 6:37105631-37105653 TACTGTAACCAGATTGCAGGTGG + Intergenic
1006890852 6:37426879-37426901 CACTTCAACCAGAGGGCAAGAGG + Intergenic
1007700517 6:43763607-43763629 TACTTTAGCCAGATGATAGTGGG + Intergenic
1007970641 6:46048734-46048756 TAGTTTAACCAGTGAGAAGTTGG + Intronic
1011035729 6:82972250-82972272 TTCTTTCACAAGAGGGCACTTGG + Intronic
1011193641 6:84762321-84762343 GCATTCAACCAGAGGGCAGTTGG + Intronic
1011401655 6:86969376-86969398 AACTTTATCAGGAGGGCAGTTGG - Intronic
1012939249 6:105400310-105400332 CACTTTATCCTGAAGGCAGTGGG - Intronic
1013372787 6:109484373-109484395 GACTTTATCCAGAGGGCATGTGG - Intergenic
1014980367 6:127938989-127939011 TGCTTTAACCAGGAGGCTGTGGG - Intergenic
1017999728 6:159568498-159568520 TACTATAACCAGAAGGGAGAAGG + Intergenic
1018091069 6:160347694-160347716 AACTTTCCCCAGAGGGCAGCCGG - Intergenic
1022270827 7:28806185-28806207 GACTTGAAACAGAGGGCAATTGG - Intronic
1024751062 7:52466247-52466269 AACAGTAACCATAGGGCAGTGGG + Intergenic
1025008884 7:55379292-55379314 TACTTTAATCAGCAGGCAGAAGG + Intronic
1029012304 7:97274493-97274515 TATTTTTAGTAGAGGGCAGTGGG + Intergenic
1031432343 7:121687487-121687509 TACTTTAACAAGAGGAAAGAAGG - Intergenic
1031480270 7:122269668-122269690 TACTTTAAACCAAGGGCAGGGGG + Intergenic
1035081566 7:156220492-156220514 CACCCAAACCAGAGGGCAGTAGG - Intergenic
1037082050 8:14799457-14799479 TTCTTTCACCAGAGGTCACTGGG - Intronic
1039591390 8:38752835-38752857 TCCTTCAAGCAGAGGGCAGGAGG - Intronic
1040641976 8:49345718-49345740 TGCTTGAACCAGAGGGAAGGAGG + Intergenic
1045054624 8:98358422-98358444 TGCTTTATCCTGAGGGCAATGGG + Intergenic
1046090442 8:109497402-109497424 TTTTTTAGGCAGAGGGCAGTGGG - Intronic
1046556562 8:115780152-115780174 TAAATCAACCAGAGGGCTGTAGG - Intronic
1051009013 9:12387258-12387280 CAGTTTGACCAGAGGCCAGTGGG - Intergenic
1052853782 9:33394422-33394444 TAATGAATCCAGAGGGCAGTGGG - Intronic
1055197911 9:73619419-73619441 TCCAGTACCCAGAGGGCAGTAGG - Intergenic
1056139998 9:83667023-83667045 TACTTTTCCCAGAGGACTGTTGG - Intronic
1056226697 9:84502672-84502694 TTTTTTGGCCAGAGGGCAGTTGG - Intergenic
1056837608 9:89969887-89969909 TCCAGTAACCACAGGGCAGTAGG + Intergenic
1057193347 9:93099628-93099650 TTCTTTAACGAGAGGGCTGCAGG + Intronic
1057695754 9:97321987-97322009 GGCTTTATCCTGAGGGCAGTGGG + Intronic
1059457615 9:114409555-114409577 CACTTAAGCCTGAGGGCAGTGGG + Intronic
1059659904 9:116390482-116390504 AACTTTATCCAGAGGCCAGTGGG + Intronic
1061255376 9:129452078-129452100 GACTTTATCCAGAGGGCAGCGGG + Intergenic
1062021364 9:134320931-134320953 GACTTTATCCCAAGGGCAGTGGG + Intronic
1185931726 X:4211193-4211215 TTCTTTACCCAGAGGGCTGGAGG + Intergenic
1186087838 X:6010441-6010463 TACTTAATGCAGAAGGCAGTAGG - Intronic
1187356142 X:18573745-18573767 TACTTTAGCCAGAAAGCTGTTGG - Intronic
1187724330 X:22186880-22186902 TATTTTAAAGAGAGGGGAGTTGG + Intronic
1187788698 X:22923299-22923321 TGTTTTAACCAGAAGGCAGAAGG - Intergenic
1189993208 X:46613832-46613854 CACTCTACCCAGAGGGCAGGTGG + Intronic
1190738054 X:53268689-53268711 AACTTTATCCAGGAGGCAGTGGG - Intronic
1193192766 X:78592386-78592408 TACTTTCTTCACAGGGCAGTAGG + Intergenic
1194964960 X:100277775-100277797 TACTTTTAGCAGATGGAAGTGGG - Intergenic
1195255686 X:103087588-103087610 TACTTTTACCAGAGGAAAGATGG + Intronic
1197291375 X:124662522-124662544 TAATTTGACAAAAGGGCAGTTGG - Intronic
1198376395 X:136044326-136044348 GACTTTATCCTGAGGGCAGTGGG + Intronic