ID: 918125646

View in Genome Browser
Species Human (GRCh38)
Location 1:181580995-181581017
Sequence TAGGAAATTACATCCTATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918125643_918125646 30 Left 918125643 1:181580942-181580964 CCTCTTTTGTCTGGCCTGTTGCT 0: 1
1: 0
2: 1
3: 23
4: 246
Right 918125646 1:181580995-181581017 TAGGAAATTACATCCTATGTTGG 0: 1
1: 0
2: 0
3: 18
4: 149
918125644_918125646 16 Left 918125644 1:181580956-181580978 CCTGTTGCTACGTACAAGTACAC 0: 1
1: 0
2: 0
3: 9
4: 33
Right 918125646 1:181580995-181581017 TAGGAAATTACATCCTATGTTGG 0: 1
1: 0
2: 0
3: 18
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918125646 Original CRISPR TAGGAAATTACATCCTATGT TGG Intronic
900691788 1:3985161-3985183 TATGAGCTTACATCCTATGAAGG - Intergenic
908339503 1:63162025-63162047 TAGGAAATCAGATCTCATGTTGG - Intergenic
908376488 1:63547397-63547419 TAGTAAATGACATGGTATGTAGG + Intronic
908863165 1:68513550-68513572 TAGGAAATTACAACCTACTTCGG + Intergenic
910206776 1:84756027-84756049 TAGGAAATAAAATGCTATGGGGG - Intergenic
912375795 1:109209002-109209024 TAGGGAATTGCATTTTATGTGGG - Intergenic
914452471 1:147804911-147804933 TTGGAACTTACATTCTAAGTGGG + Intergenic
918125646 1:181580995-181581017 TAGGAAATTACATCCTATGTTGG + Intronic
920162404 1:204009340-204009362 CAGGAATTTACATCCTAGTTGGG + Intergenic
921627507 1:217393946-217393968 TAGGAATTTTCATCCTCTCTGGG + Intergenic
922284000 1:224152434-224152456 TAAGAAATTAAATCCTGTATGGG - Intronic
923077888 1:230625948-230625970 CATGAAATTACATTCCATGTGGG - Intergenic
923933424 1:238730222-238730244 TAAGAAATTAAATCCCAGGTTGG - Intergenic
1066510843 10:36094103-36094125 TGGGAAATTACATGATATGCTGG + Intergenic
1068802955 10:61162657-61162679 TAGTAAATTCCATCCTGTGGAGG - Intergenic
1069898296 10:71692440-71692462 TAGGAAATTAGATCCAATTAAGG - Intronic
1070348302 10:75566911-75566933 TAGTAAATGACATCCCATGGGGG + Intronic
1070461479 10:76674690-76674712 TAGGAACTTACATTCTCTCTAGG + Intergenic
1070941277 10:80350325-80350347 TAGGCAATTACATCGTAAGTGGG - Intronic
1078853483 11:15186592-15186614 TGGGAAAATACCTCCTAAGTGGG - Intronic
1079686085 11:23361651-23361673 AAGTAAATTATATCCTATATTGG - Intergenic
1081096880 11:38947230-38947252 TTGTATATTACATCCTTTGTTGG - Intergenic
1081549582 11:44098845-44098867 TTGGAAATTCCTTCCTATTTAGG + Intronic
1087235280 11:95711217-95711239 TCTGAAATTACATCATTTGTGGG + Intergenic
1087403472 11:97697882-97697904 TAGAAAATAACATTCTCTGTCGG - Intergenic
1087825073 11:102755665-102755687 CAGGAAATAACATCTTATGGAGG - Intergenic
1088943726 11:114487535-114487557 TAGGACTTCCCATCCTATGTTGG + Intergenic
1089154388 11:116389708-116389730 GATGAGATTACATTCTATGTGGG - Intergenic
1090729267 11:129555593-129555615 TAGGAAAGTCTATCCTATGTCGG + Intergenic
1091035638 11:132230648-132230670 TAGGAATATACATCCTATCACGG - Intronic
1095587796 12:43867351-43867373 TAATAATTTACATCCTATTTAGG - Intronic
1096385287 12:51191256-51191278 TGGGAACTTCCATTCTATGTTGG - Intronic
1096763748 12:53865928-53865950 TAGGAAGACACATCCTAGGTTGG - Intergenic
1097685892 12:62690622-62690644 TATGTACTTACATCATATGTTGG + Intronic
1098660310 12:73085132-73085154 TAGGAAATTACATGCCATGGTGG - Intergenic
1101449699 12:104764828-104764850 CAGGTAATTACTTCCTATGCAGG + Intergenic
1101538085 12:105638929-105638951 TAGGAAATACCATACTTTGTGGG - Intergenic
1101676030 12:106917120-106917142 TAGGAAATAATCTCCTATTTAGG - Intergenic
1103270941 12:119673239-119673261 AAGAAAAATACATGCTATGTAGG + Intronic
1104623634 12:130336875-130336897 GAGGAAATTAACTCCTATGGAGG + Intergenic
1105984574 13:25552919-25552941 CAGGAAATTACATCAAATGGTGG - Intronic
1106583996 13:31041669-31041691 AAGGAAACAACATCCAATGTAGG + Intergenic
1107790086 13:43993224-43993246 TTGGATATTAGATCCTTTGTTGG - Intergenic
1108381977 13:49863210-49863232 TAGTCAATTACATGTTATGTGGG - Intergenic
1108476991 13:50830051-50830073 TAGGATATTACATCATTTCTGGG - Intronic
1109889814 13:68596415-68596437 TAGAAGTTTACATCTTATGTAGG + Intergenic
1110285562 13:73746300-73746322 TTAGATATTACATCATATGTTGG - Intronic
1111171921 13:84538378-84538400 TAGGATATCACATCCTATAAAGG + Intergenic
1113831886 13:113302157-113302179 TAAGAAATTACATCTTAGGCTGG - Intronic
1114420006 14:22574035-22574057 TAGGAGATCTCATCCTATTTGGG - Intronic
1115889994 14:38015913-38015935 TAGGAAATTCCATCCTTTAAAGG - Intronic
1120612132 14:86655056-86655078 AAGGAAGTTACAACCTGTGTTGG - Intergenic
1122100809 14:99408379-99408401 CAGAAAAGTACATCCGATGTTGG - Intronic
1126209705 15:46086967-46086989 TAGGATATTACATCCTATTGTGG + Intergenic
1126770132 15:52047987-52048009 TTGGAAATGAAATCTTATGTGGG + Intronic
1129993136 15:79982045-79982067 TAGAAAAGTACATCCCATGGAGG - Intergenic
1130175362 15:81563270-81563292 TTGGATATTACATCCCATTTTGG - Intergenic
1134808948 16:17150754-17150776 TATAAAATTACATGCTATATAGG + Intronic
1135204647 16:20473056-20473078 TATGAAGATACACCCTATGTTGG + Intronic
1135214243 16:20550756-20550778 TATGAAGATACACCCTATGTTGG - Intronic
1138982740 16:62290108-62290130 TAGGAAATTAAATCCTCAGGAGG + Intergenic
1140078200 16:71721702-71721724 TAGGAAGTTACAGCTAATGTCGG - Intronic
1154178672 18:12109521-12109543 AAGGAAGCTACATGCTATGTTGG + Intronic
1158366356 18:56741547-56741569 TAGAAAATTACACTATATGTGGG + Intronic
1158680517 18:59562495-59562517 TAGGAAATCAGTTCCCATGTGGG - Intronic
1159086630 18:63799829-63799851 TAGGAAAAAACATCCTACATGGG - Intronic
1160271584 18:77390383-77390405 TAGCAATTTACATCCCCTGTAGG - Intergenic
1164709849 19:30347922-30347944 TAGGAGAAGACATCCTAAGTAGG - Intronic
1165640342 19:37379757-37379779 TATGAAATTACTTCATATGCTGG - Intronic
1165924091 19:39316401-39316423 TAAGAAATTACAGCCTAGCTAGG - Intergenic
925853461 2:8106912-8106934 ATGGAAATGTCATCCTATGTGGG - Intergenic
927204628 2:20599301-20599323 CAGGGAAGTACATCCCATGTTGG + Intronic
927663668 2:25014419-25014441 TAGGAAATGACCTCCTCTGTGGG + Intergenic
927739734 2:25557812-25557834 TAGATAATTACATCATCTGTAGG - Intronic
928057200 2:28069252-28069274 TAGGAAATTATACAATATGTTGG + Intronic
930228282 2:48816867-48816889 TATGTAATTACACCCTATGTAGG + Intergenic
935404245 2:102691457-102691479 TAGAATATAACATCCAATGTTGG + Intronic
936560467 2:113534533-113534555 AAGGAAGTAACATCCTATGTTGG + Intergenic
937119763 2:119433074-119433096 TAGGAGCTTACAGCCCATGTAGG + Intronic
941876211 2:170436112-170436134 ATGGAATTTATATCCTATGTGGG - Intronic
942394746 2:175535417-175535439 TATGAAATAACACCCCATGTGGG - Intergenic
942744268 2:179213762-179213784 CAGGAGATTCCATCCTTTGTGGG - Intronic
943123974 2:183773212-183773234 GAGCAAATTACATCTTACGTGGG - Intergenic
943376246 2:187080579-187080601 GAGGAAATTACACCCTATAATGG + Intergenic
945643819 2:212464529-212464551 TAGGAAATTAAATTCTTTATTGG - Intronic
946885542 2:224218884-224218906 TAGGAAAATACATCATATTTTGG + Intergenic
1170814421 20:19700664-19700686 TAGCAAAGATCATCCTATGTAGG + Intronic
1177389863 21:20454055-20454077 AAGGAAATTACATCATATAAGGG + Intergenic
1180605361 22:17054986-17055008 GAGGAAATTATATGATATGTGGG + Intergenic
1182495208 22:30702113-30702135 TTGGAAATTTCATCTAATGTGGG - Intronic
1183435839 22:37794535-37794557 TAGGAAAACCCATCCCATGTGGG - Intergenic
954051439 3:47981982-47982004 TCAAAAATTACAACCTATGTTGG + Intronic
954366389 3:50148520-50148542 AAGTAAATTATATCGTATGTTGG + Intergenic
958843655 3:99239391-99239413 AAGGAAATTAAATCATATGTTGG - Intergenic
963229773 3:142897623-142897645 TAGGAAAATAAAGCTTATGTTGG - Intergenic
965707638 3:171525051-171525073 GAGGAAATTACATCTCATGATGG - Intergenic
965964401 3:174469152-174469174 AAGGAAATTATATCCTATGAAGG - Intronic
966557205 3:181276099-181276121 TAATAAATTACATCATATATTGG + Intergenic
966829683 3:183996500-183996522 TAGTAAGTTACTTCCTATATTGG + Intronic
967613807 3:191540580-191540602 TAGGAAGTTACAGCCTATAGAGG + Intergenic
971599331 4:28572124-28572146 TAGGAAATTGTGTGCTATGTTGG + Intergenic
972967409 4:44528319-44528341 TAGTAAAATACATCTTTTGTAGG + Intergenic
973834448 4:54795339-54795361 GTGGAAATTACATCCTACTTAGG + Intergenic
974043138 4:56875186-56875208 TAGGGAATTAAATCATCTGTGGG + Intergenic
974870370 4:67636145-67636167 TACTAAATGACATCATATGTTGG + Intronic
975704132 4:77095063-77095085 TAGAAAATTACATTTTATCTTGG - Intergenic
976005708 4:80427655-80427677 GTGGCAATTACCTCCTATGTAGG - Intronic
978054176 4:104242457-104242479 TAGGAAATTTCAGCAAATGTTGG - Intergenic
981079568 4:140625231-140625253 AAGGAAATTAAAATCTATGTTGG + Intronic
981764362 4:148230835-148230857 TAGGAAATCACATGGTCTGTTGG - Intronic
981912364 4:149996446-149996468 TAGGAAATTAAATCCCATTTTGG + Intergenic
983441059 4:167785350-167785372 AAGCAAACTACATTCTATGTTGG + Intergenic
984046754 4:174810170-174810192 TGGTAAATTACATGCTATTTTGG + Intronic
989184379 5:38609274-38609296 TAGGGAGTTCCATCCTATGAAGG + Intergenic
989279417 5:39623471-39623493 TAGCAAATCACATGCTATCTGGG - Intergenic
990193949 5:53291960-53291982 AAGGAAGTTAAATCGTATGTAGG + Intergenic
992682747 5:79169046-79169068 CAGAAAATTAAATCCTATGTTGG - Intronic
996169811 5:120275504-120275526 TAAGAACTTACATCCCTTGTTGG - Intergenic
996369382 5:122737161-122737183 TAGGAAACTCCATTCTATTTTGG - Intergenic
998228130 5:140342441-140342463 CAGGAAATTGCATCCTATAGGGG + Intronic
1000133144 5:158319448-158319470 TAGTAAATTATATTATATGTTGG + Intergenic
1000176777 5:158763828-158763850 TAAGCAAATACATCCTGTGTTGG + Intronic
1001044481 5:168361364-168361386 TAGGAAATTACCTTCCAAGTAGG + Intronic
1003075308 6:2978865-2978887 TAGGAACTTATGTCCTCTGTTGG - Intergenic
1003996590 6:11547589-11547611 TAAGAAGTTAAATCCTATGAAGG - Intronic
1005647405 6:27854108-27854130 TAGGAAATTAGTTGCCATGTTGG + Intronic
1010944951 6:81962895-81962917 TGGGTAATTACATACTCTGTTGG - Intergenic
1011001592 6:82594761-82594783 AACGAAATTACATGCTATCTGGG - Intergenic
1016045639 6:139477713-139477735 TAAGAAAAGACATCCTAGGTAGG + Intergenic
1017214261 6:151891908-151891930 TAGGTAATTAAATCTTAAGTAGG - Intronic
1018660107 6:166078028-166078050 TAGTAAATTAAATTCTATTTGGG + Intergenic
1018778791 6:167043944-167043966 TACCTAATTCCATCCTATGTGGG - Exonic
1019783557 7:2959111-2959133 TGGGAAATTACAGCGTGTGTGGG - Intronic
1021162136 7:17287632-17287654 TATAAAATTACATCATATGATGG - Intergenic
1022375806 7:29809868-29809890 AAGGAATGTTCATCCTATGTGGG + Intronic
1027713117 7:81632643-81632665 TAGGTAATGAAATGCTATGTGGG - Intergenic
1027731901 7:81885028-81885050 CAGGAAATTACTACCTGTGTGGG + Intergenic
1027732455 7:81892227-81892249 TAGGAAATTTCATTTTATGTTGG - Intergenic
1028824406 7:95253493-95253515 TTATAAATTACATCCTATTTAGG - Intronic
1030594203 7:111517284-111517306 TAGGAAATTACAGAATATGAAGG - Intronic
1031009852 7:116514486-116514508 GAGGAAAAGAAATCCTATGTGGG + Intergenic
1031283144 7:119831227-119831249 TAGGAAATTAAATCTTTTATAGG - Intergenic
1032709345 7:134448623-134448645 TAGGAAGTTACAGCTTATCTGGG - Intronic
1032958893 7:137006801-137006823 TAGGAAATTACAGCATACGGCGG - Intronic
1033056592 7:138060452-138060474 AAGGAAATTACACGTTATGTAGG + Intronic
1033166694 7:139044977-139044999 TAGGAGATCAGATCATATGTGGG - Exonic
1033209713 7:139451887-139451909 AATCAAAATACATCCTATGTGGG - Intergenic
1033585034 7:142768207-142768229 TAGTAAGTTACATGCTATATAGG + Intergenic
1038807471 8:30808454-30808476 TAGGAAGTTACATCGTATGATGG - Intronic
1039252030 8:35676777-35676799 AAGGAAATTAAATCCAGTGTAGG + Intronic
1042329250 8:67560696-67560718 TGGGTATTTGCATCCTATGTGGG + Intronic
1043032511 8:75154958-75154980 TAGAAAAATGCATCTTATGTAGG - Intergenic
1046788440 8:118293560-118293582 TAGGAAATTATATCTTCTTTAGG + Intronic
1049031919 8:140044306-140044328 TAGGATATGACATCCTACTTAGG + Intronic
1049892215 9:80812-80834 AAGGAAGTAACATCCTATGTTGG - Intergenic
1052952203 9:34221665-34221687 TAGTAAATTACTTCCTTTGATGG - Intronic
1053733635 9:41081900-41081922 AAGGAAGTAACATCCTATGTTGG - Intergenic
1054694780 9:68349659-68349681 AAGGAAGTAACATCCTATGTTGG + Intronic
1054912685 9:70468343-70468365 AAGGAAATTAGATCCCAAGTTGG - Intergenic
1057270417 9:93647251-93647273 GAGGAAATTAGCTCCTACGTGGG - Intronic
1057517026 9:95730306-95730328 TAGAAAATTACATCATGGGTTGG - Intergenic
1185967258 X:4620989-4621011 TAGGAAAATATCTCCTAAGTGGG - Intergenic
1186709213 X:12175019-12175041 TAGAAGCTTACATCCTATTTGGG - Intronic
1187129737 X:16490872-16490894 AAGGGAATTACAACCTATGGGGG - Intergenic
1193107318 X:77690953-77690975 TTGGGAATAACTTCCTATGTGGG + Intronic
1196569353 X:117247664-117247686 TACTCAATTACATCCTGTGTGGG + Intergenic
1199120987 X:144053834-144053856 TAGGAGATTATGTCCTCTGTAGG + Intergenic
1199879511 X:151962106-151962128 TAGACAATTCCATCCTACGTGGG - Intronic