ID: 918126030

View in Genome Browser
Species Human (GRCh38)
Location 1:181584773-181584795
Sequence TATAATGTGGAGGAGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 299}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918126030_918126035 10 Left 918126030 1:181584773-181584795 CCTACCACCTCCTCCACATTATA 0: 1
1: 0
2: 2
3: 27
4: 299
Right 918126035 1:181584806-181584828 TCAAAACTAATTTGACAAATAGG 0: 1
1: 0
2: 3
3: 38
4: 486
918126030_918126036 13 Left 918126030 1:181584773-181584795 CCTACCACCTCCTCCACATTATA 0: 1
1: 0
2: 2
3: 27
4: 299
Right 918126036 1:181584809-181584831 AAACTAATTTGACAAATAGGTGG 0: 1
1: 0
2: 0
3: 60
4: 303
918126030_918126037 17 Left 918126030 1:181584773-181584795 CCTACCACCTCCTCCACATTATA 0: 1
1: 0
2: 2
3: 27
4: 299
Right 918126037 1:181584813-181584835 TAATTTGACAAATAGGTGGCAGG 0: 1
1: 0
2: 0
3: 20
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918126030 Original CRISPR TATAATGTGGAGGAGGTGGT AGG (reversed) Intronic
900040661 1:460590-460612 GATATTGTGGAGGAGGAGCTGGG - Intergenic
900062091 1:695561-695583 GATATTGTGGAGGAGGAGCTGGG - Intergenic
902353620 1:15879190-15879212 AATTATCTGGAGGTGGTGGTGGG + Intronic
902756738 1:18553807-18553829 TATCATGTCGAGGAGATGGATGG - Intergenic
904661475 1:32088620-32088642 TGTAGGGTGGAGGAGGTGGGAGG + Intronic
905675959 1:39825257-39825279 GATAGTGAGGAGGGGGTGGTTGG + Intergenic
906151911 1:43592475-43592497 TCTAGTGTGTAGGAGGAGGTTGG - Exonic
907618632 1:55952323-55952345 TATAATTTGAAGGCGGTTGTAGG + Intergenic
908384173 1:63625174-63625196 AAGAATGTGGAAGAAGTGGTAGG + Intronic
909237429 1:73171487-73171509 TAGATTGTGGAGTATGTGGTAGG + Intergenic
909846713 1:80402913-80402935 TTTAATGTGTAGGAGATGTTTGG - Intergenic
910647141 1:89525547-89525569 TATAATTTGGTGGTGGTGTTGGG + Intronic
911729322 1:101276554-101276576 GAGAAGGTGGAGGAGGTGGAAGG - Intergenic
911991270 1:104699679-104699701 CAAAAGGTGGAGGAGGTGGAAGG - Intergenic
913413516 1:118578923-118578945 CATAATGTGGAGGAGGTAGAGGG + Intergenic
915313323 1:155015357-155015379 TATGAGGAGGAGGAGGTGGCGGG + Exonic
915323715 1:155070012-155070034 TATAAGGAGGAGGAGGAGGTGGG + Intergenic
915492305 1:156257809-156257831 AAGAATGTGGAGGAGGGGATTGG + Intronic
918126030 1:181584773-181584795 TATAATGTGGAGGAGGTGGTAGG - Intronic
918182023 1:182092240-182092262 TCCAATGTGGAGGTGGTGTTGGG - Intergenic
920046789 1:203138270-203138292 TGGAATGTTGAGCAGGTGGTTGG + Intronic
923290760 1:232543403-232543425 GAAAAGGTGGAGGAGGTGGAAGG - Intronic
923339795 1:232997606-232997628 TGCACTGGGGAGGAGGTGGTTGG - Intronic
923809417 1:237296217-237296239 TATGATGTGGAAGAGATAGTTGG + Intronic
1062991161 10:1820419-1820441 TATAATTTGGAGGAGGTGATGGG - Intergenic
1063288481 10:4715332-4715354 AAAAATGTGTAGGAGGTGGATGG - Intergenic
1064002297 10:11673741-11673763 TAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1064017847 10:11786588-11786610 TAGAAGGTGTAGGAGATGGTGGG + Intergenic
1065488596 10:26258535-26258557 GATAGTGGGGAGGGGGTGGTAGG - Intronic
1065717646 10:28588195-28588217 TATAGGGAGGAGTAGGTGGTAGG + Intronic
1065719493 10:28612654-28612676 TATAACTTGAAAGAGGTGGTTGG + Intronic
1072714434 10:97740608-97740630 TAAAAATTGGAGGATGTGGTAGG + Intronic
1073576843 10:104633181-104633203 TCTAATGAGGTGGAGGTAGTTGG - Intergenic
1074251907 10:111759399-111759421 TATAATGTGGAGCCAGTGGAGGG - Intergenic
1074405477 10:113177163-113177185 TATAAGGTGGAGGGGGCGGAGGG - Intergenic
1075325839 10:121531617-121531639 TATGGGGAGGAGGAGGTGGTAGG - Intronic
1076245972 10:128948171-128948193 TACAATGTGGAGGTGATGGCAGG - Intergenic
1076966934 11:96813-96835 GATATTGTGGAGGAGGAGCTGGG - Intergenic
1077580358 11:3413548-3413570 TATAAAATGGAGGTGGTGGGAGG - Intergenic
1078591093 11:12641147-12641169 GATGATGTGGAGGTGGTGGGGGG - Intergenic
1079085373 11:17441092-17441114 TTTTAGTTGGAGGAGGTGGTCGG + Intronic
1081833146 11:46131518-46131540 TATAATGTTGATGAGATGGGAGG + Intergenic
1084863743 11:72039621-72039643 TATCAGGTGGAGAAGGGGGTGGG - Intronic
1085871887 11:80359822-80359844 TAGGAGGTGGAGGAGGTGGAAGG + Intergenic
1086338968 11:85827559-85827581 TAGAATATGGAGGAGTTGGCAGG - Intergenic
1086872870 11:92060516-92060538 GAGAATGGGGAGGTGGTGGTAGG - Intergenic
1087257353 11:95971278-95971300 TATATAGTAGAGCAGGTGGTTGG - Intergenic
1087595263 11:100245497-100245519 TATAATGAGGAGGAGGCAGAGGG + Intronic
1087958931 11:104324154-104324176 TAGAAGGTGGAGAAGGTAGTAGG + Intergenic
1089042193 11:115462613-115462635 TTTGATGTGGAGGAGGAGGAGGG + Intronic
1089149038 11:116350704-116350726 TAGAATGTTGAGGATGTGGGAGG - Intergenic
1089166354 11:116480141-116480163 TAGAAATTAGAGGAGGTGGTAGG - Intergenic
1089209063 11:116788556-116788578 TATGATGGGGATGAGGAGGTAGG - Intergenic
1089320166 11:117620456-117620478 TATTAAGTGGAGCAGTTGGTTGG - Intronic
1089579452 11:119472293-119472315 TAGGCTGTGGAGGGGGTGGTGGG + Intergenic
1090357382 11:126149116-126149138 TACAATTTGGTGGTGGTGGTGGG - Intergenic
1090501562 11:127266150-127266172 TCTAAAGTGGAGGATGTGATAGG + Intergenic
1091590540 12:1840429-1840451 TATTATGTGGAAGAGGGGGGTGG + Intronic
1092276824 12:7067754-7067776 TGGAAAATGGAGGAGGTGGTAGG + Exonic
1092407951 12:8233969-8233991 TATAAAATGGAGGTGGTGGGAGG - Intergenic
1093393196 12:18648967-18648989 TATGATATAGAGGAGGTGATGGG - Intergenic
1095236187 12:39799000-39799022 GATAATGGGGAGAAGATGGTAGG - Intronic
1095368626 12:41439475-41439497 TATAATATGGAGAGCGTGGTAGG + Intronic
1095854170 12:46842380-46842402 CATAGTGTGGAGGAGGAGGAGGG + Intergenic
1096881029 12:54670817-54670839 TGAAATGTGGAAGAGATGGTAGG - Intergenic
1097177497 12:57151868-57151890 AATAATGTGGTGCAGGGGGTTGG + Intronic
1097614653 12:61869616-61869638 TACACTGTGGAGGAGGTTCTTGG - Intronic
1098033866 12:66282339-66282361 TAGGATGTTGAGGAGGTGATGGG - Intergenic
1098174109 12:67773086-67773108 GACAATGTGGAGAAGGTGGGGGG - Intergenic
1098545522 12:71707242-71707264 AATAATGAGGAGGGGGTGGAAGG - Intergenic
1098815336 12:75153929-75153951 GAAAAGGTGGAGGAGGTGGAAGG + Intronic
1098835091 12:75414749-75414771 TACACTGGGGAGGAGGGGGTTGG + Intronic
1099410685 12:82322921-82322943 AATAATGTGAAGGAGGTGCCGGG - Intronic
1100563309 12:95770492-95770514 TTTTATTTGGAGGTGGTGGTGGG + Intronic
1100636098 12:96436036-96436058 GAAAATGTTGAGGAGGTGCTGGG - Intergenic
1107747293 13:43524098-43524120 GATGATGTGAAGAAGGTGGTTGG - Intronic
1108235523 13:48399945-48399967 TATAATATGGATGGTGTGGTGGG - Intronic
1109712168 13:66176232-66176254 TAGAATGTGAAGGAAGTTGTGGG - Intergenic
1110722622 13:78781471-78781493 TATAATCTGGAGTAGGTTGTTGG + Intergenic
1111859972 13:93690715-93690737 AAAAATGGGGTGGAGGTGGTGGG - Intronic
1112144130 13:96679176-96679198 TATAATCTTCAGGTGGTGGTTGG + Intronic
1112928801 13:104710722-104710744 TAAAATGTGGGGCAGGTGGGAGG + Intergenic
1113372851 13:109738494-109738516 TGGAATGTGGAGGAAGTGGCAGG - Intergenic
1114639616 14:24210646-24210668 GATGATGTGGATGAGGTGATTGG - Exonic
1115131140 14:30053384-30053406 TAGATTATGGAGGAGGTGGTGGG - Intronic
1115686985 14:35806340-35806362 TAAAATGGGGGGGAGGGGGTAGG + Intronic
1116520124 14:45836196-45836218 GAAGATGTGGAGGAGGTGGAAGG + Intergenic
1117156597 14:52948128-52948150 TAAAAGGTGGAGATGGTGGTAGG - Intronic
1118285977 14:64473259-64473281 TTTGAGGTGGAGGAGGTGGCAGG - Exonic
1119067085 14:71539790-71539812 TATAATGTGCAGGAAGAGTTGGG + Intronic
1119129531 14:72158575-72158597 CATAATTTGGGGGAGATGGTGGG - Intronic
1123779991 15:23616709-23616731 TTTAAAGAGGAAGAGGTGGTAGG - Intronic
1125014008 15:34913006-34913028 TAAAAAATGGAGGAGGTGATAGG - Intronic
1128328641 15:66741484-66741506 TAAAATGAGGAGGAGGTGGGTGG + Intronic
1129312482 15:74722412-74722434 AATAATTTCGGGGAGGTGGTTGG - Exonic
1130032508 15:80328628-80328650 TATAATGTTGAGGTGGTGGGAGG - Intergenic
1130034283 15:80343065-80343087 TATGATGTTGAGGTGGTGGGTGG + Intergenic
1131073908 15:89483032-89483054 CAGAATGGGGATGAGGTGGTGGG - Intronic
1131434212 15:92410298-92410320 TTTAATGTAGAGCAGGTGGTAGG - Intronic
1132441241 15:101867022-101867044 GATATTGTGGAGGAGGAGCTGGG + Intergenic
1134202573 16:12211043-12211065 TAAAAAGTGAGGGAGGTGGTGGG - Intronic
1134242874 16:12518644-12518666 TTAAATGTGCAGGAGGGGGTAGG - Intronic
1135643283 16:24139927-24139949 TATAATGGGGAGAAGATGCTTGG - Intronic
1135862308 16:26067744-26067766 TGTCATGGGGAGGAGCTGGTGGG + Intronic
1136125980 16:28180886-28180908 TATAATGAGGAGGCCCTGGTAGG - Intronic
1139877375 16:70157061-70157083 TATTAGGAGGAGGAGGTGGAAGG - Exonic
1141556035 16:84837255-84837277 TATAATGGAGGGGAGGTAGTTGG + Intronic
1141894718 16:86951961-86951983 CGTAATGTGGAGCAGGTGGGTGG + Intergenic
1142346556 16:89557788-89557810 TCTAATGCAGAGGAGCTGGTGGG + Intergenic
1142423419 16:89987411-89987433 GAGGAGGTGGAGGAGGTGGTGGG + Intergenic
1143194405 17:5064546-5064568 TAAAATTTGGAGGAGGAGGCTGG - Intergenic
1144405736 17:14951064-14951086 TATAAAATGAAGGAGGTGGTGGG - Intergenic
1145845419 17:28034342-28034364 TATAATGTGCAGGAAGTGGGAGG - Intergenic
1146023589 17:29299946-29299968 TAAAATATGGAGGATGAGGTAGG + Intergenic
1146508135 17:33423035-33423057 TGTAGTGGGGAGGTGGTGGTGGG + Intronic
1146513089 17:33467474-33467496 TATGATGGGAAGGAGGAGGTAGG + Intronic
1148351972 17:46947564-46947586 TGTAATGTGATGGGGGTGGTGGG + Intronic
1149288890 17:55196348-55196370 TATAATTTGGTGGAGCTGGCTGG - Intergenic
1149442604 17:56687511-56687533 TTTTATTTGTAGGAGGTGGTGGG - Intergenic
1151265694 17:72953370-72953392 AATAATGTGAAGGAGGTGAGGGG + Intronic
1154005512 18:10524215-10524237 GAGAATGTGGAGGAGGTTATAGG + Intergenic
1156487893 18:37478213-37478235 TAGACTGTGAAGGAGGCGGTGGG - Intronic
1156680674 18:39585013-39585035 TATAGGGTGGAGGAGATGATTGG - Intergenic
1156755187 18:40514790-40514812 AATTATGTGGGCGAGGTGGTGGG + Intergenic
1157368321 18:47086774-47086796 TATACTGTGCAGGATTTGGTAGG + Intronic
1157539262 18:48488072-48488094 ATTGTTGTGGAGGAGGTGGTGGG - Intergenic
1159282603 18:66306293-66306315 TGTAATGTGAGGGAGCTGGTGGG - Intergenic
1160643737 19:166436-166458 GATATTGTGGAGGAGGAGCTGGG - Intergenic
1161003725 19:1924309-1924331 AATGAAGGGGAGGAGGTGGTGGG - Exonic
1161151661 19:2713269-2713291 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151673 19:2713313-2713335 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151707 19:2713445-2713467 TTAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151762 19:2713665-2713687 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151787 19:2713753-2713775 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151812 19:2713841-2713863 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151836 19:2713929-2713951 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151848 19:2713973-2713995 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151874 19:2714061-2714083 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151911 19:2714193-2714215 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161151950 19:2714325-2714347 TGAAGGGTGGAGGAGGTGGTGGG - Intergenic
1161509588 19:4663110-4663132 TAGAATGAGGATGAGGTGGGTGG - Intronic
1162558144 19:11400307-11400329 CAATATGTGGATGAGGTGGTGGG + Intronic
1164141485 19:22470286-22470308 TTTAATGTGGAACAGGTGGGAGG + Intronic
1164647584 19:29871024-29871046 TTTAAGGTGGATGAGGTTGTGGG - Intergenic
1164738549 19:30560040-30560062 GATGATGAGGAGGAGGTGGATGG - Intronic
1165714514 19:38035772-38035794 GATAATGAGGAGGAGGAGGATGG + Intronic
1166584052 19:43929706-43929728 TGTTATGTGGAGGACCTGGTGGG - Intronic
926867515 2:17375945-17375967 TATATTTTGGAGGAGGAGGAAGG - Intergenic
926912917 2:17868108-17868130 TAGAATGTGGATGAGGTGACTGG - Intergenic
926999971 2:18784317-18784339 TATGAGGTGGAGGAGGTGCTTGG + Intergenic
928072185 2:28227914-28227936 AATAATCTGGAGGGGGTGGGAGG - Intronic
928959773 2:36912148-36912170 GATAATCTGAAGAAGGTGGTAGG - Intronic
930151634 2:48066154-48066176 TCTGCTGTGGAGGAGGTGGGTGG + Intergenic
932387669 2:71352178-71352200 TATAAAGAGGAGGAGGGGGCCGG + Intronic
932498980 2:72164367-72164389 TATAATCTGGTGGTAGTGGTGGG + Intergenic
932954999 2:76341334-76341356 AAAAAGGTGGAGGAGGTGGAAGG + Intergenic
937749333 2:125455999-125456021 TAGAATGTGGCAGAGGTGATAGG - Intergenic
941230381 2:162904490-162904512 TATAAAGTGGCATAGGTGGTGGG + Intergenic
942418442 2:175782826-175782848 TAAAATGTGCAGGAGGAGGCCGG - Intergenic
944548537 2:200822857-200822879 CATAATGTGGCAGAGGTGGTGGG + Intronic
944551127 2:200845514-200845536 TATAATGTGGAACACCTGGTTGG - Intergenic
946029982 2:216695820-216695842 GAGAATGGGGAGGAGGTGGAGGG + Intergenic
946364687 2:219241657-219241679 AATAATGTCGAGGAGGTGACTGG + Intronic
947522787 2:230861524-230861546 TATCAAGTGGAGGAGGACGTGGG + Intergenic
948951687 2:241256484-241256506 CATAATGTGGTGGGGGTGGAGGG - Intronic
1169419204 20:5445799-5445821 TAGAATGTGGAGGAAGTGATGGG - Intergenic
1169724182 20:8711597-8711619 TCTATTGTGGAGGAAGTGGGTGG + Intronic
1170100122 20:12689710-12689732 TAGAATGTGGTGGAAGTGATTGG - Intergenic
1170510173 20:17068270-17068292 TAAAATATGGAGGAGGAGGCAGG + Intergenic
1170709998 20:18781895-18781917 CAAAAAGTGGAGGAGGTGCTAGG + Intergenic
1171780422 20:29411725-29411747 CATAACGGGGTGGAGGTGGTAGG - Intergenic
1173045329 20:39504271-39504293 ATTAATGTGGAGGAGGAGATTGG - Intergenic
1173259760 20:41423214-41423236 TATACTTTGGAGAAAGTGGTTGG + Intronic
1173727333 20:45307003-45307025 TATAGTGGGGAGGGGGTGGGGGG - Intronic
1174116458 20:48229808-48229830 TACAGTGTGGAGGAGGGGCTGGG - Intergenic
1174435265 20:50502025-50502047 TAGAGTGTGGAGGATGTTGTAGG + Intergenic
1174883673 20:54307998-54308020 AAAAATGTTGAGGATGTGGTGGG + Intergenic
1174906517 20:54557650-54557672 TATAAAGGGCAGGAGGTGCTTGG - Intronic
1175100379 20:56575055-56575077 AAAAAGGTGGAGGGGGTGGTCGG - Intergenic
1176231090 20:64033286-64033308 AAGACTGTGGAGAAGGTGGTAGG + Intronic
1176291923 21:5050373-5050395 AATAATTTGGAGAAGGTTGTGGG - Intergenic
1177140570 21:17353372-17353394 TATGCTCTGGTGGAGGTGGTGGG - Intergenic
1179297778 21:40078863-40078885 TCTAGTGTGAAGGAGGTGATGGG + Exonic
1179865334 21:44213268-44213290 AATAATTTGGAGAAGGTTGTGGG + Intergenic
1182697743 22:32207889-32207911 TAGCATGTGGAGGAGGGAGTGGG + Intergenic
1182923253 22:34099404-34099426 TAGAATGTGGAGGTGGGGGTAGG - Intergenic
950058558 3:10049544-10049566 TATAATTGGTGGGAGGTGGTGGG + Intronic
950074506 3:10177714-10177736 TCCAGTGTGGAGGCGGTGGTTGG + Intronic
950300320 3:11871467-11871489 TATAATTGGTGGGAGGTGGTGGG + Intergenic
950420148 3:12893638-12893660 TTTACTGTGGAGGTGGGGGTGGG + Intergenic
952427746 3:33192741-33192763 TAGAAGGTGGAGGTTGTGGTGGG + Intronic
953182384 3:40608139-40608161 GTTAATGAGGAGGAGGTGGTTGG + Intergenic
955390842 3:58521218-58521240 TGTGGTGTGGTGGAGGTGGTGGG + Intronic
955515226 3:59719897-59719919 CATAATGAGGTGGTGGTGGTGGG - Intergenic
957053228 3:75426145-75426167 TATAAAATGGAGGTGGTGGGAGG - Intergenic
957084657 3:75668786-75668808 CATAACGGGGTGGAGGTGGTAGG + Intergenic
958959937 3:100499875-100499897 TATAAAGTGTAGGGGTTGGTTGG - Intronic
959398395 3:105869169-105869191 TGTACTGTGGAGGACGTGGACGG - Intronic
959839119 3:110953491-110953513 TATACTGTTGATGAGATGGTAGG + Intergenic
960355299 3:116645196-116645218 CATAATGTGGCAGAGGTGGTGGG - Intronic
960444890 3:117735832-117735854 CAAAATGGGGAGGAGGTAGTAGG - Intergenic
960559101 3:119062895-119062917 GCTAAAGTGGAGGATGTGGTGGG - Intronic
961301598 3:125925399-125925421 TATAAAATGGAGGTGGTGGGAGG + Intergenic
961886869 3:130102456-130102478 TATAAAATGGAGGTGGTGGGAGG - Intronic
961917293 3:130390538-130390560 TACAATGTGGAGGAGGGTTTGGG + Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962890179 3:139665045-139665067 TTTATTGTGGAGGAGGGTGTGGG - Intronic
963677171 3:148327088-148327110 TTTACTGTGGATGAGGTGGGGGG - Intergenic
966020316 3:175201855-175201877 GAAAATTTGGAGGAGGTAGTGGG + Intronic
966509631 3:180747482-180747504 TATTATGTGTAGTAAGTGGTAGG - Intronic
967167781 3:186798597-186798619 TGGAAGGTGAAGGAGGTGGTAGG - Intronic
967915422 3:194574745-194574767 TAAAAAGTGAAGGAGCTGGTTGG - Intergenic
968154454 3:196368000-196368022 TATAATTAGGAGGTGGTGATGGG - Intronic
968214616 3:196878229-196878251 TGTACTGTGGAGGTGGAGGTGGG + Intronic
968996034 4:3946461-3946483 TATAAAATGGAGGTGGTGGGAGG - Intergenic
969757952 4:9162238-9162260 TATAAAATGGAGGTGGTGGGAGG + Intergenic
971011842 4:22446568-22446590 TATGATGGTGAGGAGCTGGTTGG + Intronic
971732576 4:30404835-30404857 TATAAAGTGGAGGGGGAGGCAGG - Intergenic
973854357 4:54995909-54995931 TATATTATGGAGGTGGCGGTTGG - Intergenic
974177449 4:58342747-58342769 TAGAATCTGGAGGAGATGGGTGG + Intergenic
975294225 4:72713480-72713502 AATAAGGTGGAGGAGGTGGTAGG + Intergenic
976231338 4:82846509-82846531 GAAAAGGTGGAGGAGGTGGAAGG - Intronic
976752283 4:88461493-88461515 GATATTGTGCAGGATGTGGTGGG - Intronic
977113243 4:92987431-92987453 TATAATGTTGTGGGGGTGGGAGG + Intronic
978514134 4:109553337-109553359 GATAATGAGGAGGAGGAGGAAGG - Intergenic
979987027 4:127327858-127327880 CATAAGGTGGAGGAGGGGATTGG - Intergenic
980093071 4:128462375-128462397 AATGATGTGCAGGAGGTGGGTGG + Intergenic
982247585 4:153369304-153369326 TAAAATGTGGCTGAGGTGATGGG - Intronic
985446317 4:190022787-190022809 CATAACGCGGTGGAGGTGGTAGG - Intergenic
986009050 5:3695450-3695472 CATAAAGTGGGGGAGGTGGAGGG - Intergenic
986433754 5:7707752-7707774 TATAAAGTGGAGGAGGGAGATGG + Exonic
987592562 5:19949738-19949760 TATAATTTGAAGCAGGTGGTAGG - Intronic
987855280 5:23412744-23412766 CAGAATGTGGTGGAGGTGTTTGG - Intergenic
988379255 5:30479858-30479880 TATAGTGTGGAGGAGGGTGATGG - Intergenic
988780477 5:34516727-34516749 TATAATCTGGATGAGATGGAGGG - Intergenic
990676865 5:58196499-58196521 TGACATGTGGAGGAGGTGATGGG + Intergenic
991459979 5:66847670-66847692 TATTAGCTGGAGGTGGTGGTGGG + Intronic
991960548 5:72039707-72039729 TATAGAGTGGAGGAGCTGGATGG - Intergenic
992062951 5:73074894-73074916 TGTTGGGTGGAGGAGGTGGTGGG + Intronic
992386724 5:76291689-76291711 TATAATTTGGTGGAAGGGGTCGG + Intronic
992645580 5:78808229-78808251 TAATATGGGGAGGAGGGGGTGGG - Intronic
993879697 5:93347987-93348009 TACAATGTGCAGCAGGTGGACGG - Intergenic
997798611 5:136837260-136837282 TACTATGTGGTGGAGGTGGATGG - Intergenic
998812163 5:145977188-145977210 TAGCATGTGCAGGAGGTAGTCGG - Intronic
1000778984 5:165456134-165456156 TATAAGGGGGAGGAGGTTGGAGG - Intergenic
1000810119 5:165851040-165851062 TTTTATGTGGAAGAGGTGGAAGG - Intergenic
1001290406 5:170453642-170453664 TGGAATATGGCGGAGGTGGTGGG + Intronic
1001429207 5:171646197-171646219 TATAATGTGGAGGAGAGGGGAGG + Intergenic
1001825211 5:174739349-174739371 TATAATGTGGACGTGGCTGTAGG - Intergenic
1002071726 5:176682545-176682567 TATAAGGAGGTGGAGGTGGTGGG - Intergenic
1002733185 5:181358345-181358367 GATATTGTGGAGGAGGAGCTGGG + Intergenic
1002751354 6:115763-115785 GATATTGTGGAGGAGGAGCTGGG - Intergenic
1003532201 6:6947074-6947096 GAAAAGGTGGAGGAGGTGGAAGG - Intergenic
1003556772 6:7146776-7146798 TTTGGTGGGGAGGAGGTGGTGGG + Intronic
1004274021 6:14220172-14220194 TATGATGATGGGGAGGTGGTGGG - Intergenic
1004466442 6:15889640-15889662 TGGAATGTGGAGAGGGTGGTGGG + Intergenic
1005429550 6:25741014-25741036 TGAAAGGTGGAGGAGGTGGTAGG + Intergenic
1007511939 6:42380653-42380675 TATAAGGTGGGGCAGGCGGTGGG - Intronic
1007694838 6:43725480-43725502 GATACTGTGGAGGAGGGGTTGGG + Intergenic
1009619139 6:66049997-66050019 TAGAATGTGGAAGAATTGGTGGG + Intergenic
1010167055 6:72927935-72927957 TGTAATGTGCAGAAGGTGTTAGG - Intronic
1010333826 6:74657356-74657378 TGGAATGTGGAGATGGTGGTAGG + Intergenic
1013270075 6:108537260-108537282 TCTAGTGTGGAGGTGGTGGGTGG + Intergenic
1013408349 6:109862248-109862270 TGTAATATGGAGGAGCAGGTTGG - Intergenic
1013834211 6:114313637-114313659 TTTATTGGGGAGGAGGTGGTGGG + Intronic
1013949103 6:115757974-115757996 TATCATGGTGAGGAGATGGTGGG + Intergenic
1014511571 6:122328926-122328948 TATAATGTGAAAGAGGTAGGGGG - Intergenic
1014767161 6:125420242-125420264 TATAATGTGGAGGGTGATGTAGG + Intergenic
1015885318 6:137911731-137911753 TCTAATGTGGAGGCTGTGCTGGG - Intergenic
1016310267 6:142726714-142726736 AAGAATGTGGAGGGGGTGGTGGG + Intergenic
1017904163 6:158744657-158744679 TATAGTGTGGAGGAGCTAGTTGG + Intronic
1019237435 6:170630666-170630688 GATATTGTGGAGGAGGAGCTGGG + Intergenic
1019295763 7:273259-273281 TACAATGTGGTCGACGTGGTTGG - Intergenic
1019563716 7:1669875-1669897 TAAAAGGTGGAGGGGGTGGGTGG - Intergenic
1021077700 7:16325124-16325146 TATAATCTGGATGAACTGGTTGG + Intronic
1021608478 7:22433284-22433306 CATTATGTGGAGGGGGTGGAAGG - Intronic
1021608512 7:22433463-22433485 CATTATGTGGAGGGGGTGGAAGG - Intronic
1021683015 7:23153851-23153873 TCTAATATGTAGGAGGTGCTAGG + Intronic
1023745139 7:43316190-43316212 TAAACTGAGGAGCAGGTGGTAGG + Intronic
1024523114 7:50324983-50325005 TATTATGGGGTGGAGGTGGGAGG - Intronic
1026510946 7:71027067-71027089 TGGAATGTGCAGGACGTGGTTGG - Intergenic
1029838761 7:103340333-103340355 TTTAAAATGGATGAGGTGGTGGG + Intronic
1030093259 7:105876347-105876369 TAAAAGGAGGAGGAGGTGGTGGG + Intronic
1030620238 7:111781638-111781660 AAAAATGTGGAGGAGGCAGTGGG + Intronic
1031122607 7:117738740-117738762 TCTGATGTGCAGCAGGTGGTGGG + Intronic
1032405119 7:131650267-131650289 GACCATGTGGAGGAGGTGGAAGG - Intergenic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1035510332 8:175945-175967 GATATTGTGGAGGAGGAGCTGGG - Intergenic
1035924032 8:3708309-3708331 GATAACGTGGGGAAGGTGGTGGG + Intronic
1036428847 8:8670931-8670953 CATAATGTGGTGGTCGTGGTGGG - Intergenic
1037794089 8:21976973-21976995 TATAATGTTGGGGAGGTTGTTGG + Intronic
1038230647 8:25696286-25696308 TTTGGGGTGGAGGAGGTGGTGGG + Intergenic
1038900842 8:31841994-31842016 TAGAATGGGGAGGAGGAGGAGGG - Intronic
1042831216 8:73030907-73030929 CTTCATGTGGAGGAGGTGATTGG + Intronic
1043161523 8:76853086-76853108 CAGAAGGTGGAGGAGGTGGGGGG - Exonic
1043503916 8:80884367-80884389 GTTTATATGGAGGAGGTGGTGGG - Intergenic
1044507413 8:93038220-93038242 TATTATGTGGAGGTCCTGGTAGG + Intergenic
1045985875 8:108249216-108249238 CATAATTTGGTGGAGATGGTTGG + Intronic
1046105746 8:109664267-109664289 TATTATGTGGGGGAGGGTGTAGG + Intronic
1046499431 8:115056726-115056748 TGTAATGTGGAAAAAGTGGTTGG - Intergenic
1046758483 8:117995813-117995835 AAAAATGTGAAGGAGGTGGTTGG - Intronic
1047527876 8:125649162-125649184 TGTGATGAGGAGGAGGTGGTTGG + Intergenic
1050624641 9:7489793-7489815 TGTAATATGGATGAGGTGGAAGG - Intergenic
1052615400 9:30833011-30833033 TATAATGAAAATGAGGTGGTAGG - Intergenic
1053418405 9:37961307-37961329 TTTCATGTGGAGAAGGTGCTTGG + Intronic
1053449140 9:38178987-38179009 TGGAATGAGGAGGAGGTGGAAGG - Intergenic
1055877765 9:80963765-80963787 TAGATTGTGGTGGAGGGGGTTGG - Intergenic
1058758940 9:108110703-108110725 TATAATGTGGAGAATGGGTTTGG - Intergenic
1060903278 9:127280890-127280912 GATAAGGTGGAGGATGTGATGGG + Intronic
1061496974 9:130980697-130980719 TCTAATGAGGAGCAGGTGGATGG - Intergenic
1061706898 9:132460243-132460265 CATAAAGTGGAGGAGGTGGGAGG - Intronic
1062757590 9:138310667-138310689 GATATTGTGGAGGAGGAGCTGGG + Intergenic
1202629276 M:3317-3339 TACAATGAGGAGTAGGAGGTTGG - Intergenic
1187101427 X:16196895-16196917 TACAATGTTGAGGAGAAGGTGGG - Intergenic
1187306311 X:18098523-18098545 TATATTGGGGAGGAGGTGAGGGG - Intergenic
1188388730 X:29593195-29593217 GATAAAGTGGAGGAGGAGGGAGG - Intronic
1189084733 X:38010242-38010264 GCAAATGTGGAAGAGGTGGTAGG + Intronic
1189368766 X:40411192-40411214 TATAATGTGGAGGAATTGTGGGG + Intergenic
1190993514 X:55579630-55579652 AAAAATGTAGGGGAGGTGGTGGG - Intergenic
1193241631 X:79177062-79177084 TATAATCTGGAGCAGGAGATTGG - Intergenic
1193570632 X:83137509-83137531 TATATTGTGGAGTAGATTGTGGG - Intergenic
1195289442 X:103417595-103417617 TATAAACTGGGGGTGGTGGTGGG + Intergenic
1195302983 X:103550155-103550177 AATAAGATCGAGGAGGTGGTTGG - Intergenic
1196964172 X:121037762-121037784 GAAAAGGTGGAGGAGGTGGAAGG - Intergenic
1197020526 X:121682347-121682369 GATAAGCAGGAGGAGGTGGTGGG + Intergenic
1197222107 X:123924244-123924266 TAAAATATGGAGCAGGTGGAGGG - Intergenic
1198427989 X:136538897-136538919 TAAAATGGGCAGGAGGGGGTGGG + Intronic
1199502813 X:148527746-148527768 TAGAATGAGGATGAGGTGGCGGG - Intronic
1199665200 X:150090944-150090966 GAGAATGTGGAGAAGGTGGATGG + Intergenic