ID: 918126308

View in Genome Browser
Species Human (GRCh38)
Location 1:181587195-181587217
Sequence GGTCATCAGCAGAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 416}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918126302_918126308 14 Left 918126302 1:181587158-181587180 CCTATTGCTTCTATTTTCTCAAT 0: 1
1: 8
2: 9
3: 79
4: 678
Right 918126308 1:181587195-181587217 GGTCATCAGCAGAGGGTGGAAGG 0: 1
1: 0
2: 2
3: 33
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918126308 Original CRISPR GGTCATCAGCAGAGGGTGGA AGG Intronic
900320875 1:2082996-2083018 GGACATGAGGAGAGGGAGGACGG - Intronic
900597589 1:3489576-3489598 GAGCATCAGCAGTGGGGGGAGGG - Intergenic
900614935 1:3561227-3561249 GCTCCTCAGCTGAGCGTGGAGGG - Intronic
900988854 1:6088771-6088793 GGGCAGCAGCAGGGGGTGGGGGG - Intronic
901399748 1:9007580-9007602 GCTCATCAGGTGAGGCTGGAGGG - Intronic
901490609 1:9594598-9594620 GGTCAGGAGAAGGGGGTGGAGGG + Intronic
901722033 1:11206758-11206780 GGCGATCAGCAGTGGGTGGATGG - Intronic
901746914 1:11379950-11379972 AGACATCAGAAGAGGATGGATGG + Intergenic
904279659 1:29409841-29409863 GGTGGTCACCAGAGGGTGGCCGG + Intergenic
905857124 1:41321512-41321534 GGTCAGCAGCCCAGGGTGGGGGG + Intergenic
905878467 1:41448417-41448439 GGCCATCAGCACAGGCTGTATGG + Intergenic
906296401 1:44651538-44651560 GGTTCTCAGCAGAGGCTGGGTGG - Exonic
906838575 1:49110734-49110756 GGGCAGCAGCTGATGGTGGATGG - Intronic
907834781 1:58098491-58098513 GAGCATCAGCAGAGGGTTGGAGG - Intronic
908487763 1:64611754-64611776 GGTAACCAGCAGAGATTGGAGGG - Intronic
911093383 1:94035812-94035834 AGTTTACAGCAGAGGGTGGAGGG - Intronic
914325505 1:146611540-146611562 AGGCACCAGCAGATGGTGGAAGG + Intergenic
914355515 1:146881258-146881280 AGTCAGCAGCTGAGGGTGGGAGG - Intergenic
914858080 1:151366482-151366504 GCTCAGCATCAGAGGTTGGAAGG + Intronic
915106385 1:153537251-153537273 GGTCAGCAGCAAAGGGTGGAGGG + Exonic
915107331 1:153542617-153542639 GGTCAGGTGCAGAGGCTGGAGGG - Intergenic
916259372 1:162825536-162825558 GGTCGTTGCCAGAGGGTGGAGGG + Intronic
916433820 1:164758503-164758525 GGTCCCCAGCAGAGGATGGGTGG + Intronic
916689394 1:167176125-167176147 GGTCTTCAGCATATGGTGGAAGG + Intergenic
917791651 1:178502987-178503009 GGTCATCTGCATAGTGTGGATGG - Intergenic
918065239 1:181096231-181096253 AGTCCTCAAGAGAGGGTGGAGGG - Intergenic
918126308 1:181587195-181587217 GGTCATCAGCAGAGGGTGGAAGG + Intronic
921184063 1:212655302-212655324 TGTCTTCATTAGAGGGTGGAAGG - Intergenic
921743689 1:218713969-218713991 GGCCATCAGCAGACGGGAGAGGG - Intergenic
922595887 1:226812576-226812598 GGTGATCAGAGAAGGGTGGATGG - Intergenic
1066762300 10:38767066-38767088 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1067309839 10:45102452-45102474 GGTCCTCATAAGAGGGAGGAAGG - Intergenic
1069594807 10:69663749-69663771 GGTCGAGGGCAGAGGGTGGAGGG - Intergenic
1069634908 10:69919130-69919152 GGTCATGGGCAGAGGTGGGAGGG + Intronic
1069994810 10:72335707-72335729 GGTCATGAGCAGAGGAGGGAGGG - Exonic
1070992563 10:80745368-80745390 CGTCCTCATCAAAGGGTGGAAGG + Intergenic
1073127760 10:101162518-101162540 GGTCAACAACAGAGTGAGGACGG - Intergenic
1073701633 10:105934255-105934277 GGTAATAGGCAGAGTGTGGAGGG + Intergenic
1075981796 10:126746708-126746730 GGTCTACAGCAGAAGATGGATGG + Intergenic
1076019751 10:127062885-127062907 GGTCATCAAAAGAGGGAAGAAGG - Intronic
1076560693 10:131361446-131361468 GGTGATCAGCAGAGTATGGAAGG - Intergenic
1076837624 10:133029050-133029072 GGGCATCTGCAGAGGGTCCAAGG + Intergenic
1077404237 11:2375759-2375781 TGTCCTCAGCAGGGGGTGGTAGG - Intergenic
1078003862 11:7517926-7517948 GGTCCTCCGCAGAGGGGGCACGG + Intronic
1078096045 11:8297984-8298006 GGTCCCCAGCTGAGGGTGGACGG + Intergenic
1079005134 11:16786222-16786244 GGACATCAGCAGAGAGGTGAGGG - Intronic
1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG + Intergenic
1082988072 11:59184980-59185002 GGTCATGGGCAGAGAGAGGAGGG - Intronic
1084155141 11:67309071-67309093 GGTCTGCAGCAGTGGGTGGCAGG - Intronic
1085012493 11:73150968-73150990 GGTCTTGAGCAGTGGGTGCATGG - Intergenic
1085269832 11:75263667-75263689 AGTCATCAGCAAAGGATGGTAGG + Intergenic
1085460083 11:76688331-76688353 GGTGAGCAGCAGAAGGTGGCAGG + Intergenic
1085850668 11:80115802-80115824 GTACATGGGCAGAGGGTGGATGG + Intergenic
1086719564 11:90103335-90103357 GGTAATCGTCAGAGGGTGAAAGG + Intergenic
1089014432 11:115154847-115154869 GGGCCTCCTCAGAGGGTGGATGG + Intergenic
1089133497 11:116231004-116231026 AGTCCTTAGCTGAGGGTGGAGGG - Intergenic
1089637956 11:119828475-119828497 AGGCATCAGGAGAGGGTGGCTGG + Intergenic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1091873061 12:3911294-3911316 GGGAGTCAGCACAGGGTGGAGGG + Intergenic
1092654818 12:10673622-10673644 GGCCATCAGGAGAGGGGGAAGGG - Intronic
1094498550 12:31004405-31004427 CGACATCAGCAGTGGGTGGGTGG - Intergenic
1097254052 12:57658824-57658846 AGTCATCAGCAAAGAGTGCAAGG - Intergenic
1097650547 12:62292553-62292575 TGTCTGCAGCAGTGGGTGGAGGG + Intronic
1098100205 12:67007141-67007163 GGTGATGGGCAGAGGGTAGAGGG + Intergenic
1098502215 12:71206382-71206404 AGCCATCAGCAAAGAGTGGAAGG - Intronic
1099343639 12:81470912-81470934 GGTTACCAGCAGATGGGGGAAGG - Intronic
1099716372 12:86298059-86298081 GGTGAACAGAAGAGGGTGTAGGG + Intronic
1101873728 12:108585062-108585084 GGTCATTAGCGGAGGGAGGAAGG + Intergenic
1102465338 12:113127780-113127802 GGACATGGGCAGAGGGAGGAGGG - Intronic
1102646383 12:114406579-114406601 GGTGATGAGTAGGGGGTGGAGGG - Intronic
1103452904 12:121042037-121042059 GATCAAGAGCAGAGAGTGGAAGG + Intergenic
1103560085 12:121789036-121789058 GCCCATCTGCAGAGGCTGGATGG - Intronic
1103941417 12:124503315-124503337 GGTGCTCAGCAGGGGGTGGCTGG + Intronic
1104634213 12:130427571-130427593 GGCCATCAGCAAGGGGTCGACGG - Intronic
1104685572 12:130782151-130782173 GGGCAGCAGCAGAGGGTCGCTGG - Intergenic
1104780478 12:131416702-131416724 GGGCCTCAGTAGAGGGGGGAAGG + Intergenic
1104978388 12:132562134-132562156 GGTCACCGGCAGTGGCTGGACGG + Intronic
1105242419 13:18620114-18620136 GACCCTCAGCAGAAGGTGGAGGG + Intergenic
1105823308 13:24099125-24099147 GGTCATCCTCAGAGGGTGATGGG + Intronic
1106538067 13:30665446-30665468 GATCATCAGCTGAGGGTGTGAGG + Intergenic
1107015476 13:35705310-35705332 GGGCATGAGTAGAGGGAGGAAGG + Intergenic
1107323669 13:39216326-39216348 GCTCATCAGGAGTGGGTGGCAGG + Intergenic
1108185902 13:47888222-47888244 GGTCATCAGGTGAGAGTTGATGG - Intergenic
1108426482 13:50306927-50306949 GGGGATTAGCAGAGGGAGGAAGG - Intronic
1111584140 13:90262257-90262279 GGTAATAGGCAGAGGCTGGAAGG - Intergenic
1113574608 13:111385734-111385756 GCTCCTCAACAGAGGGAGGAGGG + Intergenic
1114237290 14:20834229-20834251 GGTCCTCTGCAGAGGGGGCATGG + Intergenic
1114558040 14:23572940-23572962 GATTAACAGCAGAGGGTGAAAGG - Intronic
1114646782 14:24260415-24260437 GGTCTGGAGCAGAGGGTAGATGG - Intronic
1114963046 14:27919239-27919261 GGGAGTCAGCAGAGGGTGGTGGG + Intergenic
1115183606 14:30658205-30658227 AGTCAGTAGCAGAGGGTGAAAGG - Intronic
1117123033 14:52589464-52589486 TATCATCTGAAGAGGGTGGATGG + Intronic
1118331026 14:64816160-64816182 AGCCTTCAGTAGAGGGTGGAGGG - Intronic
1118941895 14:70346463-70346485 GGTCCTCTGCAGAGGGGGCATGG - Intronic
1119592540 14:75903424-75903446 GGGCATGAGCAGGGAGTGGAAGG + Intronic
1119850114 14:77861096-77861118 GCTAATCGGCAGGGGGTGGAGGG - Intronic
1119936536 14:78597277-78597299 AGTCATCAGTACAGTGTGGAGGG - Intronic
1121080418 14:91103416-91103438 GGTCATCGGCAGAGCTGGGATGG - Intronic
1122504909 14:102226324-102226346 GGTGCTCAGCAGAGGGTTGAGGG + Intronic
1122865688 14:104603044-104603066 GGACAGCGGCAGAGGGTGGTGGG + Intronic
1122871535 14:104641080-104641102 GGTCAGGAGCAGAGGGTGCTGGG + Intergenic
1202933634 14_KI270725v1_random:63319-63341 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1123488880 15:20764478-20764500 GACCCTCAGCAGAAGGTGGAGGG - Intergenic
1123545379 15:21333565-21333587 GACCCTCAGCAGAAGGTGGAGGG - Intergenic
1123895878 15:24829429-24829451 GGGCATGAGAAGAGGGTGGTGGG + Intronic
1123971489 15:25511856-25511878 GGTCATCCTCACATGGTGGAAGG - Intergenic
1124529894 15:30496559-30496581 GCTCAATAGTAGAGGGTGGAGGG + Intergenic
1124768765 15:32511129-32511151 GCTCAATAGTAGAGGGTGGAGGG - Intergenic
1126600726 15:50424585-50424607 GGTAACCAGCAGCTGGTGGAAGG - Exonic
1128062900 15:64746562-64746584 GGACAGCTGCAGAGTGTGGATGG + Intronic
1130058375 15:80550216-80550238 GGTCACCTACAGAGGGTGAATGG + Intronic
1130573389 15:85069315-85069337 GGTCCTGAGGAGAGGCTGGATGG - Intronic
1131145140 15:90006083-90006105 GGTCTGCAGCAGAGGGAGGCTGG + Intronic
1131151195 15:90048421-90048443 TGGCATCAGCACAGGGAGGAGGG + Intronic
1131525820 15:93151658-93151680 GGTGGTTAGCAGAGGCTGGAAGG - Intergenic
1202953724 15_KI270727v1_random:60836-60858 GACCCTCAGCAGAAGGTGGAGGG - Intergenic
1133095291 16:3440952-3440974 TGTCAGCACAAGAGGGTGGAGGG + Intronic
1133305318 16:4804663-4804685 GCTCATCACCTGAGGTTGGAGGG + Exonic
1133384117 16:5354961-5354983 TGTGATCAGCAGAGGTTGGAAGG + Intergenic
1134006660 16:10822616-10822638 GGTCATCAGCAGAGGGGTCTCGG + Intergenic
1134165712 16:11927681-11927703 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134495022 16:14726128-14726150 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134495045 16:14726256-14726278 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134500406 16:14765248-14765270 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134500429 16:14765376-14765398 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134526946 16:14951860-14951882 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134526969 16:14951988-14952010 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134545469 16:15104560-15104582 TATCATCCGCTGAGGGTGGAAGG + Intronic
1134580151 16:15363674-15363696 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134580185 16:15363871-15363893 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134714512 16:16350268-16350290 TATCATCCGCTGAGGGTGGAAGG - Intergenic
1134714534 16:16350394-16350416 TATCATCCGCTGAGGGTGGAAGG - Intergenic
1134714556 16:16350522-16350544 TATCATCCGCTGAGGGTGGAAGG - Intergenic
1134722387 16:16393632-16393654 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134722409 16:16393758-16393780 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134722431 16:16393886-16393908 TATCATCCGCTGAGGGTGGAAGG - Exonic
1134944996 16:18317983-18318005 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134945018 16:18318111-18318133 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134945040 16:18318237-18318259 TATCATCCGCTGAGGGTGGAAGG + Exonic
1134952260 16:18358136-18358158 TATCATCCGCTGAGGGTGGAAGG + Intergenic
1134952282 16:18358264-18358286 TATCATCCGCTGAGGGTGGAAGG + Intergenic
1134952304 16:18358390-18358412 TATCATCCGCTGAGGGTGGAAGG + Intergenic
1135310926 16:21404063-21404085 GATCATCCGCTGAGGGTGGAAGG + Intronic
1135310977 16:21404354-21404376 TATCATCTGCTGAGGGTGGAAGG + Intronic
1135311051 16:21404786-21404808 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311075 16:21404924-21404946 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311084 16:21404981-21405003 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311094 16:21405038-21405060 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135311104 16:21405095-21405117 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135363876 16:21836500-21836522 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364002 16:21837237-21837259 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364026 16:21837375-21837397 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364036 16:21837432-21837454 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364046 16:21837489-21837511 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135364056 16:21837546-21837568 TATCATCCGCTGAGGGTGGAAGG + Exonic
1135447786 16:22533802-22533824 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447796 16:22533859-22533881 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447806 16:22533916-22533938 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447815 16:22533973-22533995 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447839 16:22534111-22534133 TATCATCCGCTGAGGGTGGAAGG - Exonic
1135447911 16:22534546-22534568 TATCATCTGCTGAGGGTGGAAGG - Exonic
1135447939 16:22534710-22534732 GATCATCCGCTGAGGGTGGAAGG - Exonic
1136257543 16:29052248-29052270 TATCATCCGCTGAGGGTGGAAGG - Exonic
1136307775 16:29383896-29383918 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136307800 16:29384034-29384056 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136307810 16:29384091-29384113 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321131 16:29485093-29485115 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321170 16:29485326-29485348 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321195 16:29485464-29485486 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321205 16:29485521-29485543 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321214 16:29485578-29485600 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136321224 16:29485635-29485657 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435746 16:30224685-30224707 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435851 16:30225296-30225318 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435876 16:30225434-30225456 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435885 16:30225491-30225513 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435894 16:30225548-30225570 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136435904 16:30225605-30225627 TATCATCCGCTGAGGGTGGAAGG + Exonic
1136607913 16:31348889-31348911 GGTCATGAGCAAAGGGAAGAGGG - Intergenic
1137984832 16:53099053-53099075 GGTGAGCAGCTGAGGGTGGGAGG + Intronic
1139531297 16:67543956-67543978 GGGCAGCAGCAGAGGAAGGAGGG - Intronic
1139590168 16:67928937-67928959 GGGAAGCAGCACAGGGTGGACGG - Exonic
1139978504 16:70834185-70834207 AGTCAGCAGCTGAGGGTGGGAGG + Intronic
1140008057 16:71099407-71099429 AGGCACCAGCAGATGGTGGAAGG - Intronic
1140220608 16:73040966-73040988 TGGCCTCAGCAGAGGGTGTAAGG + Intronic
1140364881 16:74373664-74373686 GGTGATGAGCAGGAGGTGGAGGG - Intergenic
1140430176 16:74896151-74896173 GGTCTTCTGGATAGGGTGGAAGG + Intronic
1141097130 16:81170864-81170886 GGTGATCAGCATAGGTTGAAGGG - Intergenic
1141222836 16:82087800-82087822 GTTCCACAGCAGAAGGTGGAAGG + Intronic
1141407108 16:83804379-83804401 GGTCATCCTCTGAGGGTGAAGGG + Intergenic
1141608366 16:85168470-85168492 GGTCACCAGCAGAGGTAGAAAGG - Intergenic
1142323717 16:89400894-89400916 GGGTGTCTGCAGAGGGTGGAGGG - Intronic
1142564017 17:827825-827847 GGGCAGCAGCAGAGGGAAGAGGG + Intronic
1142637942 17:1269536-1269558 AGTCAGCAGCAGAGGGTGACGGG - Intergenic
1143912710 17:10265154-10265176 GGACTTCAGCAGAGGCTGAATGG + Intergenic
1145246583 17:21273633-21273655 AGTCATAGGCAGAGGCTGGATGG + Intergenic
1147190255 17:38734245-38734267 GGGCCTCAGCTGGGGGTGGAGGG + Exonic
1147383841 17:40070656-40070678 GGTGATCAGGAGTGGGTGGTGGG + Intronic
1147420387 17:40319529-40319551 GGTAAGCAGCAGGGGGTGGGGGG - Intronic
1147911344 17:43858040-43858062 AGTAAACAGCAGAGGGAGGAGGG - Intronic
1147983955 17:44293632-44293654 GGTCAGCAACATAAGGTGGAAGG - Intergenic
1148728859 17:49818114-49818136 GGTCCTCAGCAGTGGGATGAAGG + Intronic
1148835453 17:50463535-50463557 GGCCATCAGCAGAGAGAGGTGGG + Exonic
1149133159 17:53332555-53332577 GGTAATCAGAGGAGGGTTGAAGG + Intergenic
1149142363 17:53447773-53447795 GGTCATCGGCAGAAGGTGAAGGG + Intergenic
1150791822 17:68205557-68205579 GGTCGGCAGAAGCGGGTGGAGGG - Intergenic
1151784426 17:76268472-76268494 AGTCATCCCCAGAGGGTGGGGGG + Intronic
1152258593 17:79254570-79254592 GGTCACCAGCTGAGGGTTCAAGG - Intronic
1152962135 18:86384-86406 CTTCATCAGGTGAGGGTGGAGGG - Intergenic
1153363054 18:4220460-4220482 GGAAATCAGAAGAGGGTGGATGG + Intronic
1154446530 18:14439764-14439786 GACCCTCAGCAGAAGGTGGAGGG - Intergenic
1155792919 18:29997005-29997027 GGTAACGAGCAGAGGTTGGAAGG + Intergenic
1155884224 18:31187591-31187613 GTTCTGCAGCAGAGGATGGAGGG - Intergenic
1156863935 18:41868019-41868041 GGCCATCAGCTGAGGGTGACAGG - Intergenic
1157710891 18:49848974-49848996 GCTCCTGAGCTGAGGGTGGAAGG + Intronic
1158174484 18:54638854-54638876 GATAATCAGCAGTGGCTGGATGG - Intergenic
1158491181 18:57910988-57911010 GGTCACCAGCAGAGGGCAGAGGG + Intergenic
1158870603 18:61683873-61683895 GGTCATGGGCAGGGGTTGGAGGG + Intergenic
1159700644 18:71622377-71622399 GGTCATGGCCAGAGGGTGGAAGG - Intergenic
1159853823 18:73560217-73560239 GGACATCACGAGAAGGTGGAAGG - Intergenic
1160585647 18:79911933-79911955 GGACAGCAGCAGAGAGGGGACGG + Intronic
1160884014 19:1336430-1336452 GGTCACCAGCAGCGGCAGGAGGG + Intergenic
1160919209 19:1512052-1512074 GGTCATGAGGAGGGTGTGGATGG - Intronic
1162044406 19:7988971-7988993 GGTCATCAGCTGAGGGTGAAGGG + Intronic
1162089358 19:8268899-8268921 GGGCATCAGCTGAGTGTGGTCGG - Intronic
1162330879 19:10028745-10028767 GGGAATCAGCAAAGGGTGGTTGG + Intergenic
1163811825 19:19437597-19437619 GGTCATCAGTAGAAAGGGGAGGG - Intronic
1164912769 19:32026105-32026127 TGTCGTCACCACAGGGTGGAGGG + Intergenic
1165180986 19:33968933-33968955 GGTGATTACCAGAGGCTGGAGGG - Intergenic
1165361123 19:35337698-35337720 GGGAATCCTCAGAGGGTGGAGGG - Intronic
1166583899 19:43928356-43928378 GGTCTCCATCAGAGGGTGGAGGG + Intronic
1166835361 19:45664314-45664336 GGTCTGCACCAGAGGCTGGAAGG - Intergenic
1167035899 19:46994805-46994827 GTTCATCCGCAGTGGGTGGGAGG - Intronic
925023297 2:588312-588334 GACCCTCAGCAGAAGGTGGAGGG + Intergenic
925053476 2:835559-835581 GGTTATGGGCAGAGGGAGGAAGG + Intergenic
925741596 2:7009778-7009800 GGTCCTCAGCACAGGCTGGAGGG - Intronic
925852736 2:8098731-8098753 GCTCATCTGCAAAGAGTGGATGG + Intergenic
926132034 2:10309392-10309414 GGGCATCAGCAGAAAGTAGAAGG + Intronic
926718725 2:15943078-15943100 GCTCCCCAGGAGAGGGTGGAAGG - Intronic
928440477 2:31287958-31287980 GGTGAGCAGCAGGGGCTGGAAGG + Intergenic
929879920 2:45826694-45826716 GGTGATCAGAACAGGGTGGGTGG - Intronic
929917883 2:46151355-46151377 GGTGATGAGCAGAGGTGGGAGGG - Intronic
929924536 2:46197471-46197493 TGTCCTGAGCAGAGGATGGAGGG - Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
932861441 2:75297010-75297032 GGTCCTCATAAGAGGGAGGAAGG - Intergenic
932925987 2:75975133-75975155 AATCATCAGCAGAGGGAAGAGGG + Intergenic
933169809 2:79112676-79112698 GGTAATGAGCAGAGGCTGGATGG - Intergenic
934325613 2:92011681-92011703 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
934463968 2:94242311-94242333 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
935977761 2:108595950-108595972 GGTTATCTGTGGAGGGTGGAAGG + Intronic
936025360 2:109027528-109027550 TATCATAAACAGAGGGTGGATGG - Intergenic
936092898 2:109512327-109512349 GGGCATCAGAAGAAGGAGGAAGG - Intergenic
936135376 2:109888479-109888501 GGTTATCTGTGGAGGGTGGAAGG + Intergenic
936209321 2:110483006-110483028 GGTTATCTGTGGAGGGTGGAAGG - Intergenic
936428508 2:112438245-112438267 GGTTATCTGTGGAGGGTGGAAGG - Intergenic
936975842 2:118221586-118221608 GGTCAGCACTAGAGTGTGGAGGG - Intergenic
937955906 2:127421716-127421738 GGTGCTCAGCAGTGGCTGGAGGG - Intronic
938418921 2:131127880-131127902 GGGCCTCAGCAGAGGCTGGACGG + Intronic
938483430 2:131680469-131680491 GACCCTCAGCAGAAGGTGGAGGG + Intergenic
938722502 2:134079010-134079032 GGTCAGCAGGGGAGGGTGGAGGG + Intergenic
938770710 2:134498675-134498697 GGTCAGCAGCACAGAGTGAAGGG + Intronic
939843863 2:147220515-147220537 AGCCATCAGCAGAGAGTGCAAGG + Intergenic
942233515 2:173881878-173881900 GCTCATCAGCTTAGGGTGGGGGG - Intergenic
943713831 2:191128015-191128037 GATCATCAACAGAAGGTGGATGG - Intronic
945186954 2:207148909-207148931 GGGAATCAGGTGAGGGTGGAGGG - Intronic
947082597 2:226415408-226415430 GATGAACAGCAGTGGGTGGAAGG - Intergenic
947564978 2:231187968-231187990 AGCCATCAGGAGAGGGAGGAGGG + Intergenic
948452177 2:238082545-238082567 GGGCATCTGCAGAGGGTGTGGGG + Intronic
948602764 2:239116686-239116708 GCTCTTCAGCAGAGGCAGGATGG - Intronic
1169383431 20:5127684-5127706 CGTCATCAGCAGGTGTTGGAGGG + Intronic
1169914028 20:10670264-10670286 GGGTATCAGCAAAGGGTGCAGGG - Intronic
1170044633 20:12072253-12072275 GGTCAGAGGCAGAGGCTGGAGGG + Intergenic
1170609008 20:17896164-17896186 GGACAGAAGCAAAGGGTGGAAGG - Intergenic
1170792187 20:19517392-19517414 AGTCATCAGCTGGAGGTGGAGGG + Intronic
1170948127 20:20910095-20910117 GGTCATCAGCATAGGGAGCATGG - Intergenic
1171192096 20:23165995-23166017 GCTCACCATCAGTGGGTGGAGGG + Intergenic
1174971323 20:55278952-55278974 GGTACTCTGCTGAGGGTGGAGGG - Intergenic
1175110603 20:56645386-56645408 GGTCACCAGAAGTGTGTGGAAGG + Intergenic
1175391339 20:58629321-58629343 TGTCATCTGCAGAGGCTGGCTGG - Intergenic
1175613985 20:60376965-60376987 GTTTATCAGCAGAGGGAAGAAGG + Intergenic
1175928909 20:62484431-62484453 GGTCCTCTGGAGAGGGTGGCTGG + Intergenic
1176268594 20:64223639-64223661 GATCTTCAGGAGAGGCTGGAGGG - Intronic
1176449452 21:6850079-6850101 GACCCTCAGCAGAAGGTGGAGGG + Intergenic
1176595034 21:8685475-8685497 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1176688790 21:9880087-9880109 GGTGATGAGCAGAGGGTGTCAGG + Intergenic
1176827622 21:13715103-13715125 GACCCTCAGCAGAAGGTGGAGGG + Intergenic
1177292177 21:19127953-19127975 GCTCTTCAGAAGAGGGAGGAGGG + Intergenic
1177406257 21:20672573-20672595 GGTAATGGGCAGAGGTTGGAAGG + Intergenic
1179667553 21:42923123-42923145 GGTCCTCTGCAGAGGGGGCACGG + Intergenic
1180277887 22:10662633-10662655 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1180585121 22:16881466-16881488 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1180600086 22:17009798-17009820 TGCCATCAGCAGAGGGTCTATGG - Intergenic
1181766077 22:25092972-25092994 GGTCACCAGCTGAGTATGGATGG + Intronic
1182086500 22:27564733-27564755 GGTCAGGACCAGAGGGTGGCAGG + Intergenic
1182445367 22:30386773-30386795 GGCCATGAGCAGAGGGAGGTAGG + Intronic
1183614995 22:38938625-38938647 GGTCATCTGCTGCCGGTGGAGGG + Intergenic
1183745820 22:39691122-39691144 GGTCATCAGCAGGAGGGGAATGG + Intergenic
1183829120 22:40408725-40408747 GGTCACCAGCAGTGGGAGGGCGG + Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184806279 22:46796724-46796746 GGGCAGCAGCAGAGGGCGGGAGG + Intronic
1184899267 22:47434182-47434204 AGTCAACAGCAGAAGCTGGAAGG + Intergenic
1184918033 22:47586654-47586676 GGAGATCAGCTGAGGGTGGGTGG - Intergenic
950605882 3:14079627-14079649 AGTCATCAGCAAAGAGTGCAAGG + Intronic
951981790 3:28575252-28575274 GGTCGGCAACAGAGGGTCGATGG - Intergenic
953179987 3:40585966-40585988 GGTCTTCAGCAGCTGGGGGAGGG + Intergenic
954326392 3:49866527-49866549 GTTCCTCTGCAGAGAGTGGAGGG - Intronic
954957434 3:54534082-54534104 GGTCACCAGAAGAGCGTGCAAGG - Intronic
955864918 3:63372258-63372280 GGTGAGAAGCAGGGGGTGGAAGG - Intronic
960570221 3:119178305-119178327 GGTCAGCAACAGAGAGTGGGGGG + Intronic
961066362 3:123880585-123880607 GGAGAGGAGCAGAGGGTGGAAGG + Intronic
962444883 3:135455387-135455409 GGTCATGATAAGAGGGAGGAAGG - Intergenic
962919402 3:139936534-139936556 GGCAATCATCAGAGGGCGGAGGG + Intronic
963087416 3:141451107-141451129 GGACTTCAGCAGAGAGTGGAAGG + Intergenic
965831086 3:172790066-172790088 GGTCAGCAGCAGAGAGGCGAGGG - Intronic
965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG + Intronic
966480564 3:180403936-180403958 AGTTATCTGCAGAGGGTGGTAGG - Intergenic
966888374 3:184389014-184389036 GGTCAGCAGCTGTGAGTGGAGGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967256914 3:187602541-187602563 GGTCATCAACAGAGTCTGGGAGG + Intergenic
968107414 3:196011760-196011782 GGGCATCAGCAGAAGGTCTATGG + Intergenic
968992586 4:3924729-3924751 GGACATCAGCAGATGCTGGCAGG + Intergenic
969112734 4:4853767-4853789 GGTAACCAGCCGAGGGTGGAGGG - Intergenic
969485002 4:7467291-7467313 GGACAGCAGCAGAGAGTGGAAGG + Intronic
970873715 4:20845491-20845513 GGGAGTCAGCAGAGGGTGGTGGG - Intronic
971351041 4:25856178-25856200 GGAATTCAGCAGAGGGTCGAGGG - Intronic
972373599 4:38449521-38449543 GGGGCCCAGCAGAGGGTGGAGGG - Intergenic
972771644 4:42202964-42202986 GGAAATCTGCAGAGGATGGATGG + Intergenic
975717150 4:77216154-77216176 GGTCCACAGCAGGTGGTGGAAGG + Intronic
976300047 4:83508367-83508389 GGTCCTCTGCAGAGGGGGCACGG + Intronic
976453432 4:85218604-85218626 GGTCATGAGAAGAGGTTGGTTGG + Intergenic
976890811 4:90045242-90045264 AGTCATCAGCAGGGGTTGGTAGG - Intergenic
977904973 4:102466873-102466895 GGTAATGAGCAGAGTCTGGAAGG + Intergenic
978310154 4:107378731-107378753 GGAATTCAGCAGAGGGTGGTTGG - Intergenic
980352175 4:131697901-131697923 GGTGATGAGCAGAGGGTGTCAGG + Intergenic
984838090 4:184040758-184040780 GGTCATGAGCAAAAGGTGGCTGG - Intergenic
986967377 5:13290630-13290652 GGTCCCCTTCAGAGGGTGGAGGG - Intergenic
987153067 5:15060753-15060775 TGTCTTCAGCACAGGCTGGATGG - Intergenic
987501286 5:18712673-18712695 GGTGCTTAGCAGAGGCTGGAAGG - Intergenic
988205314 5:28126391-28126413 AGACATCAGCAGATGCTGGAAGG + Intergenic
989049174 5:37301931-37301953 TATCTTCAGCAGAGGGTGGAAGG - Intronic
989585813 5:43073171-43073193 GGTCCTCTGCAGAGGGGGCATGG + Intronic
990856574 5:60274009-60274031 GGGCATCAGGAGATGGTGAAAGG + Intronic
990974958 5:61551835-61551857 GGTTAGCAGCAGATAGTGGAAGG + Intergenic
990993519 5:61708207-61708229 GGTCAGCAGCAGATGGGGGCAGG + Intronic
993183724 5:84588831-84588853 GGTTATAAGCAGGAGGTGGAAGG + Intergenic
993623189 5:90192265-90192287 GGGCATGAGAAAAGGGTGGAAGG - Intergenic
996854296 5:127987703-127987725 GGACACCAGGAGAGGGTGGGTGG + Intergenic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
998679686 5:144453129-144453151 GGTCCTGGGCAGAGGGTGAAGGG + Intronic
999343213 5:150791415-150791437 GGTGGTCACCAGAGGCTGGAAGG - Intronic
1000113600 5:158132965-158132987 GGTCAACGTCAGAGGGTAGAGGG + Intergenic
1001097407 5:168786467-168786489 GGTCATCTCCAGATGGTGCAGGG + Intronic
1001462024 5:171924624-171924646 TGGCACCGGCAGAGGGTGGAGGG - Intronic
1001934844 5:175696628-175696650 GGTCAGCAGCAGGAAGTGGATGG + Intergenic
1002474160 5:179454465-179454487 GGCCATGAGCAGAGGAGGGAAGG - Intergenic
1004407932 6:15351870-15351892 TGTCATCAGCAGAGGGAAGCGGG - Intronic
1004902348 6:20206039-20206061 GGTCAGCAGTGGAGGGAGGAAGG - Intronic
1007062684 6:38956106-38956128 GGACCTCAGCTGAGGGTGGTTGG - Intronic
1007272160 6:40646174-40646196 GGGCATGAGCAGGGGGTGGTGGG - Intergenic
1007727558 6:43925723-43925745 GGTGATGAGCTGAGTGTGGAGGG - Intergenic
1009484003 6:64197224-64197246 TCTCAACAGCAGAGGGTAGATGG - Intronic
1011842368 6:91517409-91517431 GGCCATGAGCAGAGTGAGGAGGG + Intergenic
1013413638 6:109905080-109905102 GGTCATTAGCAGGGAGGGGAGGG - Intergenic
1013789644 6:113822501-113822523 GGTCATCAGAAGAGTATGAAGGG + Intergenic
1015309667 6:131752673-131752695 GGTCGTAAACACAGGGTGGATGG - Intergenic
1017848798 6:158284436-158284458 GCTCTTCAGCAGCGGGTAGAGGG - Intronic
1018136569 6:160783824-160783846 GGTCCCCATCAGAGGGTGCAGGG - Intergenic
1019190429 6:170247644-170247666 GGGCAGCAGCAGAGGCAGGAGGG + Intergenic
1019778115 7:2924360-2924382 TGTCATCTGCAGAGGGACGAGGG + Exonic
1019805537 7:3121305-3121327 GGTTACCAGGAGCGGGTGGAGGG + Intergenic
1021558106 7:21942142-21942164 GATCATCAGCTGAGGATAGAGGG - Intronic
1021750474 7:23794556-23794578 CGTCATGGGCAGAGGTTGGAGGG + Intronic
1022003246 7:26245427-26245449 GGTCCTCCGCAGAGGGGGCATGG - Intergenic
1022388591 7:29924440-29924462 AGACAGCAGCAGAGGCTGGAGGG - Intronic
1022526722 7:31042893-31042915 GGTGATAAGCAGGGGCTGGAGGG - Intergenic
1022557374 7:31311919-31311941 GGTCACGAGCAGAGAGTGGTGGG - Intergenic
1023048244 7:36229908-36229930 GGACATCAGGAGCGGGAGGATGG - Intronic
1023483696 7:40661862-40661884 GGTCATCAGGAGAGAGGGTATGG - Intronic
1024141533 7:46467414-46467436 GGTCACCAGCACAGGCAGGACGG + Intergenic
1025212220 7:57026270-57026292 GGTGAGCTGCAGAGGGAGGATGG + Intergenic
1025659734 7:63550558-63550580 GGTGAGCTGCAGAGGGAGGATGG - Intergenic
1026498405 7:70922658-70922680 GGGCACCAGCTGAGGGAGGATGG - Intergenic
1027492334 7:78844624-78844646 GGTTTCCAGGAGAGGGTGGAGGG + Intronic
1028227870 7:88270239-88270261 GGTAATCAGTGTAGGGTGGATGG + Intergenic
1029467558 7:100735935-100735957 GGTCATGAACTGAGGTTGGAGGG - Intronic
1029675399 7:102065036-102065058 GGTGAGCTGCAGAGGGAGGATGG + Intronic
1029803769 7:102976026-102976048 GGTCCTCCGCAGAGGGGGCATGG - Intronic
1030760906 7:113349878-113349900 GGTCCCCAGCAAAGGGTGAAGGG - Intergenic
1033975427 7:147094716-147094738 GGCCATGGGCAGAGGCTGGAAGG - Intronic
1034066546 7:148142313-148142335 GGTCATGAGAAGAGGCAGGAAGG - Intronic
1035028017 7:155838837-155838859 GGTCATAAGCTTAGCGTGGAGGG - Intergenic
1035224990 7:157428028-157428050 CGTCCCCAGCAGAGGGAGGAGGG + Intergenic
1035274339 7:157738362-157738384 GTTCATCAGCAGAGGAGCGAAGG + Intronic
1035418364 7:158707452-158707474 GGGCGCCAGCAGAGGGTGGGAGG + Intergenic
1035671636 8:1422627-1422649 GGTTATCAGCAAAGGCTGGAGGG + Intergenic
1039387372 8:37148017-37148039 GATCATCAGCAGAGCGGGGACGG + Intergenic
1040437009 8:47400248-47400270 AGTCCTCAACAGAAGGTGGAGGG + Intronic
1043558640 8:81464196-81464218 GGTCATTATCAGATGGTGGAGGG + Intergenic
1045345180 8:101287657-101287679 GGCCTTGAGCAGAGGGTGGGGGG - Intergenic
1047210169 8:122834368-122834390 GGTCCTCCGCAGAGGGGGCACGG + Intronic
1047817064 8:128476418-128476440 GGTCATCACTAGAGAGAGGATGG + Intergenic
1048607316 8:135982899-135982921 GATAAACAGCAGAGGGTGGGAGG + Intergenic
1049212938 8:141395043-141395065 GAGCCTGAGCAGAGGGTGGAGGG + Intronic
1050119074 9:2289377-2289399 GGGCATCAGCAGAGGGAAGCAGG + Intergenic
1050206345 9:3200333-3200355 GGTCATGCTCAGAGGGTGGAAGG - Intergenic
1050480795 9:6085176-6085198 TGTCCTCATCAAAGGGTGGAAGG + Intergenic
1051328703 9:16000510-16000532 GGTCATCAGCAGACTGAGGTGGG + Intronic
1052967167 9:34348891-34348913 GGTCATCTTGAGAGGGTGGGTGG - Intergenic
1053320857 9:37097810-37097832 CAGAATCAGCAGAGGGTGGAGGG + Intergenic
1053694059 9:40619109-40619131 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1053780535 9:41601813-41601835 GGTGATGAGCAGAGGGTGTCAGG - Intergenic
1053941049 9:43249528-43249550 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054168478 9:61811970-61811992 GGTGATGAGCAGAGGGTGTCAGG - Intergenic
1054270776 9:63021018-63021040 GGTAATCTTCAGAGGGTGAAAGG - Intergenic
1054305304 9:63418333-63418355 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054404051 9:64742322-64742344 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054437672 9:65227822-65227844 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1054492731 9:65794145-65794167 GGTAATCTTCAGAGGGTGAAAGG - Intergenic
1054669051 9:67768848-67768870 GGTGATGAGCAGAGGGTGTCAGG + Intergenic
1056679798 9:88706924-88706946 GGACATCTGCAGAGGGTGTGCGG + Intergenic
1057067800 9:92072010-92072032 GGGAGTCAGCAGAGGGTGGTGGG - Intronic
1057217553 9:93237809-93237831 GGTCCTCAGCAAAGGCTGGAGGG + Intronic
1058630975 9:106986208-106986230 GTTCCTCAGCAGTGGGCGGAAGG + Intronic
1060057902 9:120431571-120431593 CATCATCATCAGAGGGTGGTGGG + Intronic
1060604326 9:124900287-124900309 GGCCAGCAGCAGGGGGTGGAGGG - Intronic
1060681408 9:125568280-125568302 AGTCATCAGCAAAGAGTGCAAGG - Intronic
1061012965 9:127966162-127966184 GGGCATGGGCACAGGGTGGAGGG + Intronic
1061226182 9:129282317-129282339 GGTCAAGAGGAGGGGGTGGACGG + Intergenic
1061338036 9:129955570-129955592 GGTCATTAGCAGGGTGTGGTGGG + Intronic
1061622702 9:131822139-131822161 GGTCATCATCTGTGGATGGAGGG + Intergenic
1061873557 9:133533075-133533097 GGTCACCAGAAGAGAGAGGAAGG + Intronic
1062119971 9:134829238-134829260 GGGCAGCAGCAGGGGCTGGAGGG + Intronic
1062736005 9:138137733-138137755 CTTCATCAGGTGAGGGTGGAGGG + Intergenic
1203519735 Un_GL000213v1:34438-34460 GACCCTCAGCAGAAGGTGGAGGG - Intergenic
1187359613 X:18612773-18612795 TGTCATAAGCAGTGGATGGAGGG + Intronic
1188090508 X:25958880-25958902 TGTCATCACCAGAGGTTGTAAGG - Intergenic
1189017192 X:37296557-37296579 GGTAATGAGCAGAAGTTGGAAGG - Intergenic
1189964291 X:46355669-46355691 GGTTATCAGTAGTGAGTGGAAGG - Intergenic
1190304734 X:49075539-49075561 GCTCACCAGTAGAGGGTGGCAGG + Exonic
1192190291 X:68987140-68987162 GGGCAGCAGCAGAGGCAGGATGG - Intergenic
1192282577 X:69701320-69701342 GGTCCTCCGCAGAGGGGGCATGG + Intronic
1193615334 X:83680938-83680960 GGTCCTCATGAGAGGGTGGCTGG + Intergenic
1194619875 X:96157956-96157978 GGTCATCACAAAAGGCTGGAAGG + Intergenic
1195105083 X:101595911-101595933 GGTCAACAGCAGAGAGCTGATGG - Intergenic
1195582003 X:106515442-106515464 GGTCTTCAGCTGAGAGTGGTAGG - Intergenic
1195690738 X:107622515-107622537 GGTCATAATCAGATGGTGGCTGG - Intergenic
1196456197 X:115893152-115893174 TTTCCTCAGCAAAGGGTGGAGGG - Intergenic
1196456372 X:115894266-115894288 TCTCCTCAGCAAAGGGTGGAGGG - Intergenic
1197773598 X:130106205-130106227 GGTCAGCAGCAGCTGGAGGAGGG - Intronic
1198182142 X:134220503-134220525 AGTCATCAGCAAAGAGTGCAAGG + Intergenic
1201191830 Y:11450662-11450684 GGTAATCTTCAGAGGGTGAAAGG + Intergenic
1201958140 Y:19648532-19648554 GGACACCAGAAGAGGATGGATGG - Intergenic