ID: 918127528

View in Genome Browser
Species Human (GRCh38)
Location 1:181597435-181597457
Sequence CAGGACAAAACACACTTCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918127522_918127528 22 Left 918127522 1:181597390-181597412 CCATGTATATTTTTTGTGTTTCG 0: 1
1: 0
2: 1
3: 36
4: 468
Right 918127528 1:181597435-181597457 CAGGACAAAACACACTTCGTTGG 0: 1
1: 0
2: 1
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918127528 Original CRISPR CAGGACAAAACACACTTCGT TGG Intronic
904384547 1:30132758-30132780 CAGGAGAAAAGACACACCGTTGG + Intergenic
916024662 1:160823331-160823353 CAGGACAAAACAATCTCCTTCGG + Intronic
918127528 1:181597435-181597457 CAGGACAAAACACACTTCGTTGG + Intronic
921924108 1:220697633-220697655 CAGGACAAAGCACTCTTAGTTGG - Exonic
922295990 1:224250261-224250283 CTGGACAAAACACTGTTTGTGGG - Exonic
922372139 1:224922305-224922327 CAGGAAAAAACAAACTTGGAAGG + Intronic
1068808699 10:61229941-61229963 GAAGACAAAAGACACTTGGTTGG - Intergenic
1073059751 10:100726351-100726373 CAACACAAAAAACACTTCTTGGG + Intergenic
1073147763 10:101291887-101291909 CAGGACAGGACAGTCTTCGTAGG - Intergenic
1073201613 10:101740278-101740300 CAGGAGAAACCACACATCCTGGG + Intergenic
1074708028 10:116152729-116152751 CAAAACAAAAGACACTTCCTTGG - Intronic
1077767680 11:5178611-5178633 CAGGACATACCACACATCCTGGG + Intronic
1081178016 11:39952991-39953013 CAGGACTGAACACATTTGGTGGG - Intergenic
1085158653 11:74320649-74320671 CAGGACAATACATACTTCATAGG - Intergenic
1090737116 11:129619615-129619637 CAGAAAAAAACAAACTTCATGGG + Intergenic
1091255224 11:134178247-134178269 CGGCACAGAACAGACTTCGTGGG + Intronic
1096033793 12:48445376-48445398 CAGAGCAAAACACACTGCTTTGG - Intergenic
1098323064 12:69269534-69269556 CAAGACAAAACAGTCTTCATGGG + Exonic
1099800271 12:87448647-87448669 TATGACAACACACACTTTGTGGG - Intergenic
1101431460 12:104631047-104631069 CAGCAAAACGCACACTTCGTGGG - Intronic
1101436407 12:104668421-104668443 CAACACAGAACACACTGCGTTGG + Intronic
1104623175 12:130333479-130333501 CAGAACAGAACCCACTTCCTGGG + Intergenic
1105514866 13:21080096-21080118 CAGGACAAATGACAGTTCGAGGG + Intergenic
1107291231 13:38856397-38856419 CAGAACAAAACACATTTAGGTGG - Intronic
1111600164 13:90462567-90462589 CAGGAAAGAACGCACTTCTTGGG - Intergenic
1112556929 13:100477741-100477763 CAGGAGAACACACGCTTCATAGG - Intronic
1122542081 14:102504322-102504344 CAGAACAAAACTCACTTTTTTGG - Exonic
1125144699 15:36453371-36453393 CAGGACACCACACACTTTGGAGG + Intergenic
1128236223 15:66069202-66069224 CAGGACCAAACAGACTTGGACGG - Intronic
1135098074 16:19580994-19581016 CAGGAGAAAACACAATTCTATGG - Intronic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1156031727 18:32721063-32721085 CTGTAGAAAACACACTTTGTTGG - Intronic
1156522192 18:37731341-37731363 CTGGGCAAAACACACATCATCGG - Intergenic
1157131351 18:45010150-45010172 CATGTCAAAACAAGCTTCGTGGG - Intronic
1157929807 18:51809154-51809176 AAGGACAAAAAATACTTCATTGG + Intergenic
1162830648 19:13282286-13282308 CAGCAGAAAACACACTTTTTTGG + Intronic
1163618941 19:18346378-18346400 CAGAACAAAACACCCATCTTTGG - Intronic
1166143550 19:40819123-40819145 CTGGACAAACCACACTTTCTGGG + Intronic
1168053118 19:53845033-53845055 GATGACAATACACACCTCGTGGG - Intergenic
926779747 2:16459229-16459251 CAGCACAAAATACACAGCGTTGG - Intergenic
930118516 2:47740661-47740683 CAGTCCAAAATACACTTCTTTGG + Intronic
930211833 2:48647576-48647598 CAGGAAAAAAAAAACTTTGTGGG - Intronic
933350921 2:81151214-81151236 AAGGATAAAACTCACTTCCTTGG - Intergenic
938036592 2:128039815-128039837 CAGGACAAAGCACTATTAGTTGG - Intergenic
941138735 2:161749595-161749617 CAGGATAAATCCCACTTGGTTGG + Intronic
944290587 2:197999896-197999918 CAAGATAAAACACATTCCGTAGG + Intronic
944400731 2:199323268-199323290 CAGGAGAAAACACACGTGGGGGG - Intronic
946223659 2:218250288-218250310 CAGGAAAAAGAACACTTAGTGGG - Intronic
947466499 2:230353221-230353243 CAAAACAAAACACACTGTGTTGG - Intronic
1172796107 20:37539150-37539172 CAGGACAAACCACACTTCTCTGG + Intergenic
1172941994 20:38660349-38660371 CAGGAGGAAACCCACTTCATGGG - Intergenic
1174906552 20:54557858-54557880 CAGAACATAACACACTTGCTTGG + Intronic
1178251222 21:31004951-31004973 CAGGGCAAAACACATCTCTTTGG + Intergenic
1182483017 22:30621978-30622000 CAAAACAAAACAAACTCCGTGGG - Intronic
952041992 3:29271937-29271959 CAGGACAAAATTCACTCCATGGG + Intergenic
953863810 3:46566407-46566429 TGAGACAAAACAGACTTCGTAGG + Exonic
955515097 3:59718561-59718583 CAGGTCAAAACACATTGCCTCGG - Intergenic
957594088 3:82238306-82238328 TAGGACAAAATACAGTTCCTGGG - Intergenic
961303297 3:125936279-125936301 CAAGGCAAAACACAATTCCTAGG - Intronic
962324676 3:134423247-134423269 CAACACAAAACACCCTCCGTAGG - Intergenic
968828005 4:2913808-2913830 CAGGAGAAACCACAATTCTTTGG - Intronic
973918967 4:55665471-55665493 CAGGACCAAAATCACTTCCTTGG + Intergenic
974963915 4:68736542-68736564 CAGGAGAAAACCCAGTTCCTGGG - Intergenic
984824513 4:183912608-183912630 AAGTACAAAACAAACGTCGTGGG - Intronic
986683785 5:10258078-10258100 CACCACAAAACAAACTTCATTGG - Intronic
988551365 5:32203835-32203857 CAGGATACAACCCACTTCATTGG + Intergenic
988861649 5:35287278-35287300 CAGAACTAAACAAACTTCATAGG - Intergenic
991360829 5:65818404-65818426 AAGGAAAAAACACACTGGGTAGG - Intronic
997704249 5:135931677-135931699 AAGGACAAAACATAATTTGTTGG - Intronic
1003246557 6:4386890-4386912 CAGGACAAAGCACTCTTAGTTGG - Intergenic
1004822281 6:19380616-19380638 CAGAACAGAACACACTTTATGGG - Intergenic
1005026594 6:21468262-21468284 CAGGATGAAAGACACTTGGTGGG - Intergenic
1007420862 6:41718825-41718847 CAGGCCCAAACACAATCCGTTGG + Intronic
1008362259 6:50634135-50634157 CAGGACAAAACCCACTTAAAGGG - Intergenic
1012845570 6:104383269-104383291 CAGGACAAAAAATTCTTGGTTGG - Intergenic
1014505964 6:122256696-122256718 CGGGACAAAACACACTTTGTTGG - Intergenic
1022375755 7:29809484-29809506 CATGACAAAACAAACTTCGAGGG + Intronic
1023396729 7:39758478-39758500 CAGGACAAAGCACTCTTAGTTGG - Intergenic
1025044711 7:55682974-55682996 CAAAACAAAACACAGATCGTAGG - Intergenic
1031573953 7:123393238-123393260 CAGAACAAAAGTCACTTGGTGGG - Intergenic
1033490799 7:141841594-141841616 CAGGACAAAAAACACCAAGTTGG - Intergenic
1034004105 7:147450018-147450040 CAGGACAGGACACCCTTGGTTGG - Intronic
1035870521 8:3132592-3132614 CACCCCAAAACACACTTCTTTGG + Intronic
1037208673 8:16357878-16357900 CAAGACAAAACAAACTAGGTAGG - Intronic
1040657325 8:49526695-49526717 CAGGACAACGCACACTTAGAAGG - Intergenic
1040873758 8:52128614-52128636 CATTACAAAACACACTTTGTAGG - Intronic
1042061562 8:64823825-64823847 CAGGTCAAAAGACACTTGGTTGG + Intergenic
1042676770 8:71330022-71330044 CAGCAAAAAACACACTGTGTGGG + Intronic
1050025220 9:1327220-1327242 CAGGAAAAAAAACACTGAGTAGG - Intergenic
1051120034 9:13742699-13742721 CAGGACAAAAAAAAATTAGTTGG - Intergenic
1056494649 9:87144048-87144070 CAGGATAAAAGACAGTCCGTAGG + Intergenic
1186066267 X:5768699-5768721 CAGGACAGCAGACACTTCTTTGG + Intergenic
1192417958 X:71001302-71001324 CAGGATAAAACACAACTCCTTGG + Intergenic
1198403638 X:136291154-136291176 CAGGGCAAAACACACACCATGGG - Intergenic