ID: 918127566

View in Genome Browser
Species Human (GRCh38)
Location 1:181597776-181597798
Sequence CATTTTATGCAGATGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 984
Summary {0: 1, 1: 0, 2: 14, 3: 204, 4: 765}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918127562_918127566 15 Left 918127562 1:181597738-181597760 CCTCACAATCATGGCGGAAGGCA 0: 301
1: 3369
2: 4139
3: 4827
4: 3774
Right 918127566 1:181597776-181597798 CATTTTATGCAGATGGCAGCAGG 0: 1
1: 0
2: 14
3: 204
4: 765

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918127566 Original CRISPR CATTTTATGCAGATGGCAGC AGG Intronic
900340335 1:2185621-2185643 CACCTTAAGCAGATGGCAGCTGG + Intronic
900824834 1:4918168-4918190 CATCTTATGTAGATGGTGGCAGG + Intergenic
900889240 1:5437603-5437625 CATCTTACGTGGATGGCAGCAGG + Intergenic
901124530 1:6919754-6919776 CACCTTATGCGGATGGCAGCAGG + Intronic
901128652 1:6948252-6948274 CCATATATGAAGATGGCAGCTGG - Intronic
901750934 1:11407911-11407933 CATTTTTCGTGGATGGCAGCAGG - Intergenic
902154883 1:14477249-14477271 CATCTTACGTGGATGGCAGCAGG - Intergenic
902982187 1:20132427-20132449 CATCTTACGTGGATGGCAGCAGG + Intergenic
903691440 1:25176744-25176766 CATCTTATGTGGATGGCAGCAGG - Intergenic
903747286 1:25596313-25596335 CACTTTATGAACAAGGCAGCAGG + Intergenic
903968492 1:27104023-27104045 AATTTTTTGAAGATGGAAGCAGG + Intronic
904564632 1:31421273-31421295 CTTTTTCCACAGATGGCAGCAGG - Intronic
905341231 1:37279066-37279088 CATTTTCTGCAGCTGGGAGTTGG - Intergenic
908442769 1:64171268-64171290 CATCTTACGTGGATGGCAGCAGG + Intronic
909058283 1:70848117-70848139 CATTTTACATGGATGGCAGCAGG + Intergenic
909179043 1:72397301-72397323 CATCTTACACGGATGGCAGCAGG - Intergenic
909182911 1:72448493-72448515 CATCTTACGTGGATGGCAGCAGG + Intergenic
909241808 1:73222761-73222783 CATCTTATATGGATGGCAGCAGG + Intergenic
909257349 1:73440069-73440091 CATCTTATGTGGATGGCAGCAGG - Intergenic
909469783 1:76014015-76014037 CATCTTACGTGGATGGCAGCAGG + Intergenic
909600725 1:77458587-77458609 CGTCTTATGTGGATGGCAGCAGG + Intronic
909602798 1:77478459-77478481 CATCTTATGTGGATGGCAGCAGG - Intronic
909702500 1:78542901-78542923 CATATTATGTGGATGACAGCAGG - Intergenic
909752412 1:79179230-79179252 CATTTTACATGGATGGCAGCAGG + Intergenic
910166738 1:84336449-84336471 CATCTTATGTGGATGGCAGCAGG + Intronic
910167008 1:84338371-84338393 CATCTTATGTGGATGGCAGCAGG + Intronic
910256258 1:85250041-85250063 CATCTTATGTGGAGGGCAGCAGG + Intronic
910513027 1:88026861-88026883 CATCTTATGTGGATGCCAGCAGG + Intergenic
911134825 1:94428664-94428686 CATCTTATGTGGATGGCGGCAGG - Intronic
911175315 1:94812014-94812036 TATTTTATCCAGAGGGCATCAGG + Intergenic
911331292 1:96528688-96528710 CATCTTATGTGGATGGCAGCAGG - Intergenic
911351320 1:96759934-96759956 CATCTTACGTAGATGGCAACAGG + Intronic
911815971 1:102351559-102351581 CATTTTATGTTGATGGCAGCAGG - Intergenic
911904452 1:103548911-103548933 CATTTTATATGGCTGGCAGCAGG + Intronic
912182567 1:107236771-107236793 CATCTTACGGGGATGGCAGCAGG - Intronic
912182832 1:107238695-107238717 CATCTTACGTGGATGGCAGCAGG - Intronic
912207326 1:107523122-107523144 GCTTTTATGCAGATGGCATGAGG - Intergenic
912370313 1:109168711-109168733 CATTATATGCAGATCACAACTGG + Intronic
912579286 1:110705620-110705642 CATCTTATGTGGATGGCAGCAGG + Intergenic
912675417 1:111675888-111675910 CATCTTACGTGGATGGCAGCAGG + Intronic
913254058 1:116938422-116938444 CATCTTATGTGGATGGCGGCAGG + Intronic
913396225 1:118375577-118375599 CATCTTATGTGGATGGCAGCAGG + Intergenic
913402965 1:118456195-118456217 CATCTTATGTGGATGGCATCAGG + Intergenic
915068665 1:153247046-153247068 CCTTTTATGCCGCTGGCAGTGGG - Intergenic
915696894 1:157752351-157752373 CATCTTATGTGGATGGCGGCAGG - Intronic
915752252 1:158222657-158222679 CATCTTATGTGGATGGCAGCAGG - Intergenic
915804466 1:158829872-158829894 CATCTTACGTAGATGGCAGCAGG + Intergenic
915885804 1:159719342-159719364 CATTTTCTTCACAAGGCAGCAGG - Intergenic
916036147 1:160924174-160924196 CATCTTGTGTGGATGGCAGCAGG - Intergenic
916424151 1:164664755-164664777 TATCTTATGTGGATGGCAGCAGG + Intronic
916466476 1:165078851-165078873 CATCTTATGTGGATGGCAACAGG - Intergenic
916851199 1:168705925-168705947 CATCTTATGTGGATGGCAGCAGG - Intronic
916882429 1:169032887-169032909 ATTTCTATGCAGATGCCAGCAGG - Intergenic
917023595 1:170616189-170616211 CATCTTACGTAGATGGCAGCAGG - Intergenic
917572118 1:176278403-176278425 TATGTTGTGCGGATGGCAGCAGG - Intergenic
917681954 1:177376418-177376440 CATCTTATATGGATGGCAGCAGG + Intergenic
917690113 1:177460103-177460125 CATCTTACGTGGATGGCAGCAGG - Intergenic
917743000 1:177979779-177979801 CATCTTATGTGGATGGCAGCAGG + Intronic
918028023 1:180772723-180772745 CATCTTACGCGGATGCCAGCAGG - Intronic
918056873 1:181029506-181029528 CATCTTATGTGGATGGCAGCAGG - Intergenic
918127566 1:181597776-181597798 CATTTTATGCAGATGGCAGCAGG + Intronic
918202191 1:182277993-182278015 CATCTTACACGGATGGCAGCAGG + Intergenic
918394142 1:184096741-184096763 CATCTTATATGGATGGCAGCAGG + Intergenic
918871113 1:189976619-189976641 CATTTTACGTGGATGGCAGCAGG + Intergenic
918886490 1:190200812-190200834 CATCTTATGTGGATGGCGGCAGG - Intronic
918955742 1:191204851-191204873 CATCTTATGCATATGGCAGCAGG - Intergenic
918969802 1:191398730-191398752 CATTTTACATGGATGGCAGCAGG - Intergenic
919065885 1:192692693-192692715 CATTTTACATGGATGGCAGCAGG + Intergenic
919138340 1:193538751-193538773 CATTTTACGTGGATGGCAGCAGG + Intergenic
919163587 1:193863527-193863549 CATCTTATGTGAATGGCAGCAGG - Intergenic
919179682 1:194064226-194064248 CATCTTATGTGGATGGCAGCAGG + Intergenic
919449660 1:197755761-197755783 CATCTTCTGTGGATGGCAGCAGG + Intronic
919536603 1:198796081-198796103 CATTTTCTTCACAAGGCAGCAGG + Intergenic
920069362 1:203291115-203291137 TATTTTATGGAGAAGGAAGCTGG - Intergenic
921019027 1:211219716-211219738 CATTTAATGCAGATGGTCACAGG + Intergenic
921474671 1:215591993-215592015 CATCTTATGTGGATGGCAGCAGG + Intronic
921594502 1:217039463-217039485 CATCTTATGTGGATGGCAGCAGG + Intronic
921610266 1:217205599-217205621 CATTTTATGTGGATGGTGGCAGG - Intergenic
923259385 1:232252835-232252857 CATCTCAAGCAGATGGCAGCAGG - Intergenic
923724738 1:236496250-236496272 CACTTGAGGCAGACGGCAGCAGG - Intergenic
923977907 1:239285495-239285517 CATCTTACACAGATGGCAGCAGG + Intergenic
924000735 1:239549035-239549057 CATTTTACATGGATGGCAGCAGG + Intronic
924062432 1:240188874-240188896 CATCTTATGTGGATGGCAGAAGG + Intronic
1063833476 10:9984188-9984210 CATCTTATATGGATGGCAGCAGG - Intergenic
1063904944 10:10771679-10771701 CTTCTTATGTGGATGGCAGCAGG - Intergenic
1064301443 10:14126602-14126624 TATTCTATGCAGATGGGAGAAGG - Intronic
1064403246 10:15038602-15038624 CATCTTACACGGATGGCAGCAGG - Intronic
1064524515 10:16240138-16240160 CATCTTACATAGATGGCAGCAGG - Intergenic
1065446360 10:25805672-25805694 CATCTTATGTGGTTGGCAGCAGG - Intergenic
1065597437 10:27328548-27328570 CATTTAATCCAGATGGGAGATGG - Intergenic
1065671798 10:28127533-28127555 CATTTTACATGGATGGCAGCAGG + Intronic
1066273444 10:33845516-33845538 CATCTTATGTGGATGGCAGCAGG + Intergenic
1066636952 10:37512501-37512523 CATCTTATATGGATGGCAGCAGG - Intergenic
1067206241 10:44216253-44216275 CATCTTACACGGATGGCAGCAGG - Intergenic
1067285036 10:44901782-44901804 CATCTTATGTGCATGGCAGCAGG + Intergenic
1067895746 10:50177268-50177290 CATCTTATGTGGATGGCAGCAGG - Intergenic
1067953239 10:50764710-50764732 CATCTTATGTGGATGGCAGCAGG + Intronic
1068184346 10:53565169-53565191 TATTTTACACGGATGGCAGCAGG - Intergenic
1068264407 10:54627487-54627509 CATCTTATGTGGATGGCAGCAGG - Intronic
1068286978 10:54950480-54950502 CATCTTACGTGGATGGCAGCAGG - Intronic
1068559403 10:58496485-58496507 CATCTTATGTGGATGGCAGCAGG - Intergenic
1068611587 10:59066282-59066304 CATCTTACGTGGATGGCAGCAGG - Intergenic
1068745405 10:60524541-60524563 CATCTTACATAGATGGCAGCAGG - Intronic
1068756221 10:60657104-60657126 CATCTTATGTTGATGGCAGCAGG + Intronic
1069189424 10:65468005-65468027 CATCTTACGTGGATGGCAGCGGG - Intergenic
1069545081 10:69321806-69321828 CAATTTATGCAGATGCCGTCTGG - Intronic
1069545153 10:69322401-69322423 CAATTTATGCAGATGCCGTCTGG - Intronic
1070375834 10:75830519-75830541 TATCTTATGTGGATGGCAGCAGG + Intronic
1070978864 10:80628382-80628404 CATCTTACGTGGATGGCAGCAGG - Intronic
1071367260 10:84911825-84911847 CATCTTATGTGGATGGCAGCAGG - Intergenic
1071549924 10:86559021-86559043 CATCTTACACAGATGGCAGCAGG + Intergenic
1072963267 10:99950195-99950217 CATCTTACGTGGATGGCAGCTGG - Intronic
1073447923 10:103592166-103592188 CATTTTATAGAAATGGAAGCTGG - Exonic
1073548094 10:104370420-104370442 CATCTTATGTGGATGGCAGCAGG + Intronic
1073645636 10:105299772-105299794 CATCTTATTTGGATGGCAGCAGG + Intergenic
1073822986 10:107286450-107286472 GATCTTATGGAGATGGTAGCGGG - Intergenic
1073840018 10:107487825-107487847 TATTTTAAGCAGATGTGAGCTGG - Intergenic
1073993873 10:109294063-109294085 CATGTTATGTGGATGGTAGCAGG - Intergenic
1074237817 10:111603685-111603707 TATCTTATGTGGATGGCAGCAGG - Intergenic
1074249399 10:111729518-111729540 CATTTGATGAAGATGGAAGTAGG + Intergenic
1074960042 10:118436067-118436089 CATATTACGTGGATGGCAGCAGG - Intergenic
1075385591 10:122053239-122053261 CATCTTATGTGGATAGCAGCAGG + Intronic
1075565347 10:123499533-123499555 CGTATTACACAGATGGCAGCAGG - Intergenic
1075571114 10:123546491-123546513 CATCTTACGTGGATGGCAGCAGG - Intergenic
1075840666 10:125499712-125499734 CATCTTATGTGGATGACAGCAGG + Intergenic
1075851764 10:125594109-125594131 AATATAATCCAGATGGCAGCTGG - Intronic
1077843436 11:5999279-5999301 CCTATTATTCAGAGGGCAGCAGG + Intergenic
1079182077 11:18202554-18202576 CATCTTACGTGGATGGCAGCAGG + Intronic
1079655112 11:22976920-22976942 CATCTTATGTAAATGGCAGCAGG - Intergenic
1079698436 11:23513686-23513708 CATCTTACGAGGATGGCAGCAGG + Intergenic
1079789769 11:24722377-24722399 CATCTTACACGGATGGCAGCAGG + Intronic
1079838785 11:25367881-25367903 CATCTTTTGTGGATGGCAGCAGG + Intergenic
1079962319 11:26940116-26940138 CATCTTATGTAGATGGTGGCAGG + Intergenic
1079962550 11:26941994-26942016 CATCTTATGTGGATGGCAGCAGG + Intergenic
1080183162 11:29447392-29447414 CATCTTATATGGATGGCAGCAGG - Intergenic
1080272576 11:30466556-30466578 CCTTTGATGCAGAGGGGAGCAGG + Intronic
1080796624 11:35569776-35569798 CATCTTACATAGATGGCAGCAGG + Intergenic
1080796715 11:35570943-35570965 CATCTTACCTAGATGGCAGCAGG + Intergenic
1081015060 11:37866919-37866941 CATATCATACAGATGGCAGATGG + Intergenic
1081138585 11:39470088-39470110 CATCTTACGTGGATGGCAGCAGG - Intergenic
1084252673 11:67912557-67912579 CATCTTATAGGGATGGCAGCAGG + Intergenic
1084880548 11:72168409-72168431 CATCTTATGTGGATGGCACCAGG - Intergenic
1084880872 11:72170667-72170689 CATCTTATGTGGATGACAGCAGG - Intergenic
1085941688 11:81213200-81213222 CATCTTACGTGGATGGCAGCAGG + Intergenic
1086259361 11:84919470-84919492 GAATTTATGCAGTAGGCAGCAGG + Intronic
1086416285 11:86591718-86591740 CATTTTATGTGGATGGCAACAGG + Intronic
1086529616 11:87769363-87769385 CATCTTATGTGGAGGGCAGCAGG - Intergenic
1086811025 11:91310433-91310455 CCTTTTAGGCCGATGGTAGCTGG - Intergenic
1087255678 11:95949725-95949747 CATCTTATGTGGATGGCAGCAGG + Intergenic
1087516692 11:99173002-99173024 CATCTTATGTGGATGGCAGCAGG + Intronic
1087838228 11:102896081-102896103 CATCTTACGTGGATGGCAGCAGG - Intergenic
1087924189 11:103900423-103900445 CATCTTATGTGGATGGCAGCAGG - Intergenic
1088206157 11:107395247-107395269 CATCTTACGTGGATGGCAGCAGG - Intronic
1089564359 11:119363285-119363307 CCATTTATGCAGCGGGCAGCGGG - Intronic
1089573452 11:119424634-119424656 CATTTTATGAAAAATGCAGCTGG + Intronic
1090087959 11:123667725-123667747 CGTCTTACACAGATGGCAGCAGG - Intergenic
1090360455 11:126168847-126168869 CATCTTATGTGGATGGCGGCAGG + Intergenic
1091867899 12:3858149-3858171 CATTTTTTGCATATGTCAGGAGG - Intronic
1091982588 12:4878557-4878579 CATTTTATGTGGATAGCGGCAGG + Intergenic
1093206933 12:16262845-16262867 CATCTTATATAGATGGCAGCAGG - Intronic
1093211345 12:16312904-16312926 CATCTTACGTGGATGGCAGCAGG - Intergenic
1093353244 12:18129152-18129174 CATCTTATGTGGATGGCAGCAGG - Intronic
1093478939 12:19584637-19584659 CATCTTACGTGGATGGCAGCAGG - Intronic
1093692932 12:22127675-22127697 CATCTTATGTGGATGGCAGCAGG + Intronic
1094212748 12:27909780-27909802 CATTTTAAGAAGATGGCATTTGG + Intergenic
1095119153 12:38393886-38393908 CATCTTATATGGATGGCAGCAGG - Intergenic
1097400567 12:59123853-59123875 CATCTTATGTGGATGGCAGCAGG + Intergenic
1097854390 12:64447037-64447059 CATCTTACGTGGATGGCAGCAGG + Intronic
1097900869 12:64872804-64872826 CATCTTACGTGGATGGCAGCAGG + Intronic
1098140094 12:67442470-67442492 CATTTTGGGGAGAGGGCAGCGGG + Intergenic
1098163754 12:67672588-67672610 CATCTTATGTGGATGGCAGCAGG + Intergenic
1098636346 12:72788813-72788835 CATCTTATGTGGATGGCAGCAGG - Intergenic
1098687021 12:73434594-73434616 CATCTTATGCTGATGGTGGCAGG + Intergenic
1099466864 12:82999597-82999619 CATTTTACATAGATGTCAGCAGG + Intronic
1099937703 12:89147621-89147643 CATCTTATGTGGATGGCAGCAGG - Intergenic
1100067347 12:90665103-90665125 CATCTTATGTGGGTGGCAGCAGG - Intergenic
1100577330 12:95905526-95905548 TATTTTATGTTGATTGCAGCTGG + Intronic
1100872078 12:98920490-98920512 CATCTTATGTGGATAGCAGCAGG + Intronic
1100972108 12:100081057-100081079 CATCTTATGTGGATGGCAGCAGG - Intronic
1101257824 12:102997308-102997330 CATCTTACATAGATGGCAGCAGG + Intergenic
1101262574 12:103047834-103047856 CAGTTTGTTCACATGGCAGCAGG + Intergenic
1101521316 12:105484906-105484928 CGTCTTATGTGGATGGCAGCAGG - Intergenic
1101576815 12:106005007-106005029 CATTTTACATGGATGGCAGCAGG - Intergenic
1101642342 12:106596307-106596329 CATCTTACGTGGATGGCAGCAGG - Intronic
1101886541 12:108668337-108668359 CATTTTGTACAGATTGCATCTGG - Intronic
1102449845 12:113033233-113033255 CATCTTACGTGGATGGCAGCAGG - Intergenic
1103188522 12:118981377-118981399 TTTGTTATGCAGATGGCGGCAGG + Intergenic
1103239788 12:119403608-119403630 GATTTTATGCAGAGGGCACAGGG - Intronic
1103837298 12:123832824-123832846 CATTTTACAGAGATGGCAACTGG - Intronic
1104176734 12:126340494-126340516 CATCTTATGTGGATGGCAGAAGG + Intergenic
1104227481 12:126849914-126849936 TATCTTATGTGGATGGCAGCAGG + Intergenic
1105609569 13:21956155-21956177 CATCTTACGTGGATGGCAGCAGG + Intergenic
1105627023 13:22122495-22122517 GATTCTATGCAGCTAGCAGCTGG - Intergenic
1106158848 13:27182962-27182984 CCCTTTATTCAGAAGGCAGCAGG - Intergenic
1106382505 13:29253805-29253827 CATCTTACGTGGATGGCAGCAGG + Intronic
1107050127 13:36038145-36038167 CATTTTATGAACAAGGAAGCTGG + Intronic
1107055655 13:36100725-36100747 TATTTAATTCAGCTGGCAGCTGG - Intronic
1108109700 13:47055620-47055642 CATCTTACGTGGATGGCAGCAGG + Intergenic
1108609533 13:52070567-52070589 CATTTTACATGGATGGCAGCAGG - Intronic
1108778457 13:53796893-53796915 CATCTTACGTGGATGGCAGCAGG + Intergenic
1108872747 13:55006415-55006437 CATCTTATGTGGATGGCAGCAGG + Intergenic
1108985801 13:56585582-56585604 CATCTTATGTGGATGGCAGCAGG + Intergenic
1109285606 13:60404989-60405011 CATCTTATGTGAATGGCAGCAGG - Intronic
1109294542 13:60513737-60513759 CATCTTATGTGGATGGCAGCAGG - Intronic
1109314991 13:60739972-60739994 CATCTTATGTGGACGGCAGCAGG - Intergenic
1109811970 13:67525185-67525207 CATCTTACGTGGATGGCAGCAGG - Intergenic
1109871957 13:68343775-68343797 CATCTTACGTGGATGGCAGCAGG + Intergenic
1110340638 13:74385894-74385916 CATCTTATGTGGATGGCAGGAGG + Intergenic
1110395790 13:75028366-75028388 CATCTTACGTGGATGGCAGCAGG - Intergenic
1110649280 13:77924872-77924894 CATCTTAGGTGGATGGCAGCAGG - Intergenic
1110693055 13:78454708-78454730 CATTTCATGCAGAAGGAAGTTGG + Intergenic
1110707983 13:78616918-78616940 CACTTTCTGCAGATGGCAAAGGG - Exonic
1110806261 13:79757609-79757631 CATCTTATATAGATGGCAGCAGG + Intergenic
1111029239 13:82574433-82574455 CATCTTACGTGGATGGCAGCAGG + Intergenic
1111054621 13:82932617-82932639 CATCTCATGTGGATGGCAGCAGG - Intergenic
1111218937 13:85179695-85179717 CATCTTATGTGGATGGCAGCAGG + Intergenic
1111325948 13:86695927-86695949 CATCTTATGTGGATGGCAGAAGG + Intergenic
1111769864 13:92583923-92583945 CATCTTACGTGGATGGCAGCAGG - Intronic
1111819442 13:93194991-93195013 CATCTTATGTAGATGGAGGCAGG - Intergenic
1111986457 13:95071090-95071112 CATCTTATATGGATGGCAGCAGG - Intronic
1112052968 13:95662445-95662467 CATCTTATGTGGATGGCGGCAGG - Intergenic
1112545078 13:100360121-100360143 CATCTTAAGTGGATGGCAGCAGG + Intronic
1112860415 13:103823876-103823898 CATTTTATGTAGATGGCGGCAGG + Intergenic
1112885196 13:104162086-104162108 CATCTTACGTGGATGGCAGCAGG + Intergenic
1113068474 13:106394866-106394888 CATCTTATGTGAATGGCAGCAGG + Intergenic
1113247657 13:108416441-108416463 CATCTTACATAGATGGCAGCAGG + Intergenic
1113782980 13:112987077-112987099 CCTTTTACACAGATGGCACCCGG + Intronic
1114225392 14:20733292-20733314 CATCTTATGTGGATGACAGCAGG - Intronic
1114687429 14:24547494-24547516 CATCTTATGTGGGTGGCAGCAGG + Intergenic
1115002444 14:28439289-28439311 CATCTTATGTGGATGGTAGCAGG - Intergenic
1115773384 14:36689159-36689181 CATCTTACGTGGATGGCAGCAGG + Intronic
1115840423 14:37463163-37463185 CATCTTATGTGGATGTCAGCAGG + Intronic
1115929639 14:38477026-38477048 CATCTTATGTGGATGGCAGCAGG - Intergenic
1116263699 14:42661772-42661794 CATTTTCTTTACATGGCAGCAGG - Intergenic
1116387276 14:44347343-44347365 CATCTTATGTGGATAGCAGCAGG - Intergenic
1116761970 14:49026095-49026117 CGTCTTATGTGGATGGCAGCAGG - Intergenic
1118070759 14:62244726-62244748 CATCTTACGTGGATGGCAGCAGG - Intergenic
1118139182 14:63061155-63061177 CATTTTACATGGATGGCAGCAGG - Intronic
1118239466 14:64042660-64042682 CATCTTAGGTGGATGGCAGCAGG - Intronic
1118496206 14:66310238-66310260 CATCTTATATGGATGGCAGCAGG + Intergenic
1118513550 14:66503100-66503122 CATCTTACGTGGATGGCAGCAGG - Intergenic
1118539594 14:66807117-66807139 CATCTTACGTAGATGGCAGCAGG + Intronic
1118833368 14:69456651-69456673 CATTTTACCCAGATGTCAACTGG + Intronic
1119775489 14:77245629-77245651 CATGTTACGTGGATGGCAGCAGG + Intronic
1119783414 14:77294664-77294686 CATTTTATGTGGATGGCGGCAGG - Intronic
1119864239 14:77959864-77959886 CATTTTACATGGATGGCAGCAGG - Intergenic
1119911917 14:78357228-78357250 CATCTTATGTGGATGGCAGCAGG + Intronic
1120026439 14:79590306-79590328 CATTTTACATGGATGGCAGCAGG - Intronic
1120047250 14:79821331-79821353 CATGTTATGCAGCTGGCCCCTGG - Intronic
1120206103 14:81589257-81589279 CATCTTATGTGAATGGCAGCAGG - Intergenic
1120573307 14:86148740-86148762 CATCTCATGCAGAAGGCAGAAGG + Intergenic
1120575259 14:86174087-86174109 CATCTTGTGTGGATGGCAGCAGG - Intergenic
1120621802 14:86774314-86774336 CATCTTATGTGGATGGCAGCAGG - Intergenic
1120692199 14:87605323-87605345 CATCTTATATGGATGGCAGCAGG + Intergenic
1120705289 14:87739438-87739460 CATCTTATGTGTATGGCAGCAGG - Intergenic
1121576321 14:94991141-94991163 CATCATATGTGGATGGCAGCAGG + Intergenic
1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG + Intergenic
1121991197 14:98559405-98559427 CATCTTTTGTGGATGGCAGCAGG + Intergenic
1122026436 14:98880866-98880888 CATCTTACGTGGATGGCAGCAGG - Intergenic
1122072390 14:99213097-99213119 AGTTTTAAGCAGATGGCAGTAGG - Intronic
1122371856 14:101233431-101233453 CCTCTTATGCTGATGGCAACGGG + Intergenic
1202905762 14_GL000194v1_random:71741-71763 CAACATATTCAGATGGCAGCGGG - Intergenic
1123707722 15:22962351-22962373 CAGTTTATGCAGAAGAAAGCAGG - Intronic
1123796290 15:23774421-23774443 CATCTTATGTGGATGGCAGCAGG - Intergenic
1124104114 15:26721403-26721425 CTTGTTATGCAGATTTCAGCGGG - Intronic
1124733147 15:32217100-32217122 CATTTTATTAATATGGCACCAGG + Intergenic
1125050006 15:35285466-35285488 CATCTTATGTGGATGGCAGCAGG - Intronic
1126266021 15:46755224-46755246 CATCTTAAGTGGATGGCAGCAGG + Intergenic
1126942226 15:53779792-53779814 CATCTTACATAGATGGCAGCAGG - Intergenic
1127647963 15:60976321-60976343 CATATTATGCAGATGGGGGATGG - Intronic
1128391895 15:67187905-67187927 CATTTTAGGCAGATGGCTTTAGG + Intronic
1129093826 15:73182060-73182082 CATCTTATATGGATGGCAGCAGG + Intronic
1129155217 15:73713441-73713463 GATTCTATGCAGGTGGAAGCAGG - Exonic
1129620006 15:77135755-77135777 CATCGTATGTGGATGGCAGCAGG - Intronic
1129620337 15:77138032-77138054 CATCTTATGTGAATGGCAGCAGG - Intronic
1130824648 15:87531903-87531925 TATCTTATGTGGATGGCAGCAGG + Intergenic
1131260169 15:90883989-90884011 AATTTTATTCAAATGGAAGCTGG + Intronic
1131970033 15:97882481-97882503 CATCTTACGTGGATGGCAGCAGG - Intergenic
1132876871 16:2143896-2143918 CATTTCATGGAGAGGGGAGCAGG + Intronic
1132942878 16:2516976-2516998 CCTTTTCTACAGAGGGCAGCAGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134569113 16:15276389-15276411 CATCTGATGTGGATGGCAGCAGG + Intergenic
1134733264 16:16479656-16479678 CATCTGATGTGGATGGCAGCAGG - Intergenic
1134934174 16:18232317-18232339 CATCTGATGTGGATGGCAGCAGG + Intergenic
1135032034 16:19046148-19046170 CCTTTTGTGCTGATGGCAGAAGG - Intronic
1137465479 16:48704851-48704873 CATTCTTGGGAGATGGCAGCTGG + Intergenic
1137526572 16:49241602-49241624 CATCTTACGTGGATGGCAGCAGG + Intergenic
1138805463 16:60084696-60084718 CATCCTATGCAAATGGCGGCAGG + Intergenic
1138895377 16:61198278-61198300 CATCTTATGTGGATGGCAGCAGG + Intergenic
1138918092 16:61492582-61492604 CATTTTATGCATATGAAATCTGG + Intergenic
1139061150 16:63253588-63253610 CATCTTACACGGATGGCAGCAGG + Intergenic
1140183066 16:72739644-72739666 CATTTTTGGCAGATGAAAGCAGG + Intergenic
1140302542 16:73772322-73772344 CATCTTACGTGGATGGCAGCAGG + Intergenic
1141410968 16:83832908-83832930 CATCTTACGTGGATGGCAGCAGG + Intergenic
1142023939 16:87802218-87802240 CAGTGTGTGCAGATGGCAGATGG - Intergenic
1142110798 16:88330029-88330051 CATTTCATGTGGATGGCATCAGG - Intergenic
1142802050 17:2352405-2352427 CCTGTCGTGCAGATGGCAGCTGG + Intronic
1143302577 17:5921954-5921976 CATTTGAGGCAGAGGGCTGCTGG + Intronic
1144286600 17:13781137-13781159 CATCTTACGTGGATGGCAGCTGG + Intergenic
1144352387 17:14409785-14409807 CATCTTATGAGGATGGCAGCAGG + Intergenic
1146682145 17:34816100-34816122 CATTTTAAGCAGAGGGCTGGGGG - Intergenic
1146956914 17:36941263-36941285 CACTTTGTGCAGAAGGCAGAGGG - Intronic
1147209879 17:38866751-38866773 CATTTTGTGGAGATGGGGGCAGG - Intergenic
1147871047 17:43587859-43587881 CATCTTACACAGATGACAGCAGG + Intergenic
1148767843 17:50049582-50049604 CGTTGTATGCTGAGGGCAGCAGG + Intergenic
1148770911 17:50065638-50065660 CATCTTACGCTGATGGCAGCAGG + Intronic
1148807110 17:50269455-50269477 GACTTTATTCAGGTGGCAGCAGG + Intergenic
1149081862 17:52667420-52667442 CACCTTCTTCAGATGGCAGCAGG + Intergenic
1149112953 17:53056044-53056066 CATCTTATGTGGATGGCAGCAGG - Intergenic
1149233951 17:54569533-54569555 CATCTTACGTGGATGGCAGCAGG + Intergenic
1149308529 17:55372271-55372293 CATCTTACACAGATGGCAGCAGG - Intergenic
1149555509 17:57570801-57570823 CATGGTATGCAGAAGGCTGCTGG + Intronic
1150291095 17:63982806-63982828 CATCTTACGTGGATGGCAGCAGG - Intergenic
1150310445 17:64124572-64124594 CATCTTACGTTGATGGCAGCAGG - Intronic
1150863658 17:68827048-68827070 CATCTTATGTGGATGGCAGCTGG - Intergenic
1151058414 17:71060980-71061002 CACTTTCTTCACATGGCAGCAGG - Intergenic
1151105970 17:71617790-71617812 CATCTTACATAGATGGCAGCAGG - Intergenic
1151135977 17:71946035-71946057 CATCTTATATCGATGGCAGCAGG - Intergenic
1151501129 17:74489740-74489762 CATCTTGTGTGGATGGCAGCAGG + Intergenic
1151873514 17:76852585-76852607 CATCTTACGTGGATGGCAGCAGG + Intergenic
1152010049 17:77707412-77707434 CATCTTATGTGGATGGCAGCAGG - Intergenic
1153214629 18:2808514-2808536 CATCTTACACCGATGGCAGCAGG + Intergenic
1153214950 18:2810784-2810806 CGTCTTACACAGATGGCAGCAGG + Intergenic
1153530990 18:6045528-6045550 CATCTTATGTGGATGGCAGCAGG + Intronic
1153692942 18:7611776-7611798 CATCTTACGTGGATGGCAGCAGG - Intronic
1154040068 18:10846235-10846257 CATCTTACACAGATGGCAGCAGG + Intronic
1154049637 18:10942017-10942039 CATCTTACGTGGATGGCAGCAGG - Intronic
1154505210 18:15031520-15031542 CATCTTACGTGGATGGCAGCAGG + Intergenic
1155172514 18:23277344-23277366 CATCTTACATAGATGGCAGCAGG - Intronic
1155769185 18:29674706-29674728 CATCTTACACAGATGGCAGCAGG - Intergenic
1155773172 18:29725666-29725688 CATTTTACATGGATGGCAGCAGG + Intergenic
1156467711 18:37358327-37358349 CATCTTTTGCGGATGGCAGCAGG - Intronic
1156813939 18:41286161-41286183 CATCTTACATAGATGGCAGCAGG + Intergenic
1158107274 18:53899880-53899902 CATTTTCTTCACAAGGCAGCAGG - Intergenic
1158298643 18:56027857-56027879 CATCTTAAGTGGATGGCAGCAGG + Intergenic
1158483900 18:57847484-57847506 CATCTTATGTGGATGGCAGCAGG + Intergenic
1159433485 18:68385260-68385282 CATCTTAAGTGGATGGCAGCAGG - Intergenic
1159508188 18:69361995-69362017 CATCTTATGTGGATGTCAGCAGG - Intergenic
1159718990 18:71861588-71861610 CATCTTACGTGGATGGCAGCAGG + Intergenic
1159765095 18:72479890-72479912 CATCTTAGGTGGATGGCAGCAGG - Intergenic
1160071215 18:75629697-75629719 CATCTTACGTGGATGGCAGCAGG + Intergenic
1160188258 18:76693022-76693044 CATCTTATATGGATGGCAGCAGG + Intergenic
1160468184 18:79100808-79100830 CATCTTATGTGGGTGGCAGCAGG + Intronic
1161137131 19:2626436-2626458 CATTTTATCCCGAGGGCAGGAGG - Intronic
1161785599 19:6323482-6323504 CATCTTACGTGGATGGCAGCAGG - Intronic
1162453855 19:10770681-10770703 CATCTTATACGGATGGCAGCTGG + Intronic
1162498309 19:11035688-11035710 CGTTCTCAGCAGATGGCAGCTGG + Intronic
1163706457 19:18816846-18816868 GATTACATGCAGATGCCAGCCGG + Intergenic
1164620269 19:29691363-29691385 CATTTTATGTGGATGGCAGCAGG + Intergenic
1165280604 19:34794058-34794080 CATCTCATGTGGATGGCAGCAGG + Intergenic
1165424319 19:35737619-35737641 CACTTCCTGCAGGTGGCAGCAGG - Exonic
1166263740 19:41663263-41663285 CATCTTATGTGGATGGCAGCAGG + Intronic
1166263834 19:41663967-41663989 CATCTTATGTGGATGGCAGCAGG + Intronic
1166323274 19:42032985-42033007 CATTGTATGCATAGGCCAGCAGG - Intronic
925187718 2:1860600-1860622 CATTTTATGCAGCTTGTTGCAGG + Intronic
925250191 2:2427555-2427577 CATCTTATGTGGATGGTAGCAGG + Intergenic
925596164 2:5557709-5557731 GATCTTACACAGATGGCAGCAGG + Intergenic
925638164 2:5961908-5961930 CATCTTATGTGGATGGCGGCAGG - Intergenic
925736741 2:6970352-6970374 CATTGTACGTGGATGGCAGCAGG - Intronic
926377783 2:12250973-12250995 CATCTTTTGTGGATGGCAGCAGG - Intergenic
926496489 2:13594818-13594840 CATCTTATATGGATGGCAGCAGG + Intergenic
926607928 2:14915908-14915930 CATCTTATGTAGATGGCAGTAGG - Intergenic
926705494 2:15834590-15834612 CATCTTACGTGGATGGCAGCAGG + Intergenic
926713907 2:15908715-15908737 CATCTTAGGTGGATGGCAGCAGG - Intergenic
926729555 2:16025937-16025959 CATCTTACGTGGATGGCAGCAGG + Intergenic
927255829 2:21040145-21040167 CATCTTATGTAGATGGTGGCTGG - Intronic
928665665 2:33548402-33548424 CATCTGTTGGAGATGGCAGCAGG + Intronic
928804232 2:35131641-35131663 CTTCTTATGTAGATGGCGGCAGG + Intergenic
928876709 2:36048679-36048701 CATCTTACGTGGATGGCAGCAGG + Intergenic
929047737 2:37806365-37806387 CATCTTATGTGGATGACAGCAGG - Intergenic
929387031 2:41421353-41421375 CATCTTCTTCACATGGCAGCAGG - Intergenic
929603182 2:43217717-43217739 CATGTTATGCAGATGGAAGTCGG - Intergenic
929702813 2:44179162-44179184 CATCTTACATAGATGGCAGCAGG - Intronic
929999888 2:46854150-46854172 CATCTTATGTGGATTGCAGCAGG - Intronic
930833041 2:55765733-55765755 CATCTTATGTGGATGGCAGCAGG + Intergenic
931154559 2:59614013-59614035 CATCTTATGTGGATGGCAGCAGG + Intergenic
931226277 2:60334647-60334669 TATTTTATACAGGTGGCAACTGG + Intergenic
931330600 2:61277926-61277948 CATCTTATGTGGATGGCGGCAGG - Intronic
931439164 2:62275506-62275528 CATCTTACGTAGATGGCGGCAGG - Intergenic
931709136 2:64972677-64972699 CCTTGTAAGCTGATGGCAGCAGG + Intergenic
931861131 2:66355790-66355812 CATCTTACGTGGATGGCAGCAGG + Intergenic
932095904 2:68848154-68848176 CATTGTTTGCAGACTGCAGCAGG + Intergenic
932885090 2:75542127-75542149 CATCTTACGTGGATGGCAGCAGG - Intronic
933031543 2:77334530-77334552 CATCTTATGTGGATGGCAGCAGG - Intronic
933510356 2:83233435-83233457 CAATTTATGCATGTGCCAGCAGG + Intergenic
933520117 2:83360994-83361016 CATCTTACCCAGATGGCGGCAGG - Intergenic
933915135 2:86983323-86983345 CAATTCATGCAAATGGCAGTTGG + Intronic
934007859 2:87786577-87786599 CAATTCATGCAAATGGCAGTTGG - Intronic
934502124 2:94869916-94869938 CAGTTTCCCCAGATGGCAGCAGG - Intergenic
934960298 2:98667105-98667127 CATCTTATGTGGATGGCAGCAGG - Intronic
934960641 2:98669362-98669384 CATCTTACGTGGATGGCAGCAGG - Intronic
935019165 2:99213770-99213792 CATTTTATGTGGATGGTGGCAGG - Intronic
935094178 2:99928028-99928050 CATCTTATGTGGATGGCAGCAGG - Intronic
935099778 2:99982348-99982370 CATCTTACGTGGATGGCAGCAGG - Intronic
935239949 2:101169592-101169614 CATCTTACGTGGATGGCAGCAGG - Intronic
935240228 2:101171534-101171556 CATTTTATGTGGATGACAACAGG - Intronic
935445490 2:103151931-103151953 CATCTTACACGGATGGCAGCAGG - Intergenic
935771498 2:106427495-106427517 CAATTCATGCAAATGGCAGTTGG - Intronic
935908576 2:107868452-107868474 CAATTCATGCAAATGGCAGTTGG + Intronic
935923514 2:108041514-108041536 CATCTTACGTGGATGGCAGCAGG - Intergenic
935994975 2:108760669-108760691 CAATTCATGCAAATGGCAGTTGG + Intronic
936130362 2:109833576-109833598 CAATTCATGCAAATGGCAGTTGG + Intronic
936214335 2:110537909-110537931 CAATTCATGCAAATGGCAGTTGG - Intronic
936289671 2:111211856-111211878 CATCTTATGTGGATGGCAACAGG - Intergenic
936423471 2:112392472-112392494 CAATTCATGCAAATGGCAGTTGG - Intronic
936443298 2:112574994-112575016 CATTTTAAGCAGATTGTGGCCGG + Exonic
936800718 2:116261613-116261635 CATCTTACACGGATGGCAGCAGG - Intergenic
937751181 2:125477574-125477596 CATCTTATGTGGATGGCAGCAGG - Intergenic
938504400 2:131861779-131861801 CATCTTACGTGGATGGCAGCAGG + Intergenic
938566072 2:132520321-132520343 GGTGTTATGCAGATGGCAGATGG - Intronic
938694267 2:133821227-133821249 CATTTTATGCAGATGAGATGTGG - Intergenic
939182179 2:138816445-138816467 CATGTTACGTGGATGGCAGCAGG - Intergenic
939972227 2:148675536-148675558 CATTTTATACAGATAGAAGAGGG - Intronic
940344554 2:152615977-152615999 CTTTTTAAGCGGATGCCAGCTGG - Intronic
940450177 2:153827133-153827155 CATCTTATGTGGAAGGCAGCAGG + Intergenic
940450498 2:153829401-153829423 CATCTTACATAGATGGCAGCAGG + Intergenic
940479108 2:154205671-154205693 CATCTTATGCAGATGCTGGCAGG + Intronic
940552290 2:155174943-155174965 CATCTTATGTGGATGGCAGCAGG + Intergenic
940785710 2:157979384-157979406 CATCTTACACGGATGGCAGCAGG - Intronic
941123600 2:161560645-161560667 CATTTTACGTGGAGGGCAGCAGG - Intronic
941123885 2:161562588-161562610 CATCTTATGTGGATGGCAGCAGG - Intronic
941142930 2:161807043-161807065 CATCTTATGTGAATGGCAGCAGG + Intronic
941320027 2:164042365-164042387 CATCTTATGTGGATTGCAGCAGG + Intergenic
941881237 2:170482470-170482492 CATTTTACGTGGATGGCGGCAGG - Intronic
942601494 2:177644906-177644928 CATTTTACATGGATGGCAGCAGG - Intronic
943145967 2:184045149-184045171 CATCTTATGTGGATGGCGGCAGG + Intergenic
943166307 2:184330540-184330562 CATCTTATATGGATGGCAGCAGG + Intergenic
943176511 2:184481698-184481720 CATCTTATGTGGATGGAAGCCGG - Intergenic
943776896 2:191775301-191775323 CATCTTCTGTGGATGGCAGCAGG - Intergenic
944701062 2:202246566-202246588 CATCTTATGTGGATGGCGGCAGG - Intergenic
944877984 2:203982330-203982352 CATCTTATGTGGATGGCAGCAGG + Intergenic
945114088 2:206393851-206393873 CATCTTACATAGATGGCAGCAGG - Intergenic
945644220 2:212468488-212468510 TATTTTATGTGGATGGCGGCAGG - Intronic
945729780 2:213519495-213519517 CATCTTATGTGGATGGCGGCAGG - Intronic
946519323 2:220448283-220448305 CACCTTATGTGGATGGCAGCAGG - Intergenic
947028928 2:225770582-225770604 CATCTTATGTGCATGGCAGCAGG - Intergenic
947054238 2:226083370-226083392 CATCTTACATAGATGGCAGCAGG + Intergenic
947116572 2:226777730-226777752 CATCTTATGTGGATGGAAGCAGG - Intronic
947243936 2:228026096-228026118 CATCTCATGTGGATGGCAGCAGG - Intronic
947248437 2:228076107-228076129 CATCTTATGTGGATGGCAGCAGG - Intronic
947248706 2:228078023-228078045 CACCTTATGTGGATGGCAGCAGG - Intronic
947886378 2:233575478-233575500 CATGTTATGTGGATGGCAGCAGG + Intergenic
948306474 2:236951634-236951656 CGTCTTATGTGGATGGCAGCAGG - Intergenic
948448361 2:238051543-238051565 CATCTTATGTGGATGGCAGCAGG - Intronic
948851353 2:240708591-240708613 CATCTTACGTGGATGGCAGCAGG + Intergenic
948934404 2:241153298-241153320 CATTTGAGGCATATGGCCGCGGG - Intronic
1169419614 20:5449317-5449339 CATTCTATTCAGATGTCAGAAGG - Intergenic
1169609990 20:7367781-7367803 AATTTGATGCAGGAGGCAGCTGG + Intergenic
1169619173 20:7485876-7485898 CGTCTTATGTGGATGGCAGCAGG + Intergenic
1170291322 20:14772458-14772480 CATGTTATGTGGATGGCAGCAGG + Intronic
1170710732 20:18788067-18788089 CATCTTATGTGGATGGCAGCAGG + Intergenic
1173460550 20:43239859-43239881 CATCTTACGTGGATGGCAGCAGG + Intergenic
1173961955 20:47080755-47080777 CATCTTACGTGGATGGCAGCAGG + Intronic
1174865906 20:54135471-54135493 CATCTTATGTGGATGGCAGCAGG + Intergenic
1174920252 20:54694472-54694494 CATCTTATATGGATGGCAGCAGG + Intergenic
1175315159 20:58042001-58042023 CATCTTACGTGGATGGCAGCAGG - Intergenic
1175616561 20:60404905-60404927 ATTTTTAAGCATATGGCAGCAGG - Intergenic
1175663898 20:60842037-60842059 CATCTTACACGGATGGCAGCAGG + Intergenic
1176267669 20:64219099-64219121 CATTTTGTGCAGAGAGCAGGTGG - Intronic
1176623884 21:9075249-9075271 CAGTTTCCCCAGATGGCAGCAGG + Intergenic
1176696135 21:9979454-9979476 CATCTTATGTGGGTGGCAGCAGG - Intergenic
1176792637 21:13337552-13337574 CATCTTACGTGGATGGCAGCAGG - Intergenic
1176919522 21:14670307-14670329 CATCTTATGTGGATGGCAGCAGG - Intergenic
1177177295 21:17713867-17713889 TATCTTATGTGGATGGCAGCAGG + Intergenic
1177333580 21:19694347-19694369 CATCTTATGTGGATGGCAGCAGG - Intergenic
1177387784 21:20429688-20429710 CATCTTACAGAGATGGCAGCAGG - Intergenic
1177699355 21:24615904-24615926 CATCTTATATGGATGGCAGCAGG - Intergenic
1177749726 21:25264855-25264877 CATCTTACGTGGATGGCAGCAGG - Intergenic
1177836714 21:26192894-26192916 CATCTTATGTGGATGGCAGCAGG + Intergenic
1177839144 21:26217272-26217294 CATCTTATGTGGATGGCAGCAGG - Intergenic
1177839425 21:26219210-26219232 CATCTTATGTGGATGGCAGCAGG - Intergenic
1177992038 21:28048456-28048478 CATCTTACGTGGATGGCAGCAGG - Intergenic
1178006437 21:28225943-28225965 CATCTTACGTGGATGGCAGCAGG + Intergenic
1178428367 21:32497793-32497815 CATCTTATGCGGATGGCGGCAGG + Intronic
1178793543 21:35722388-35722410 CATCTTACACGGATGGCAGCAGG + Intronic
1179065004 21:38016804-38016826 CATCTTAAGTAGATGGCAGCAGG - Intronic
1179429689 21:41311940-41311962 CGTCTCATGTAGATGGCAGCAGG + Intronic
1179469262 21:41599656-41599678 CATCTTATGTAGATGGCAGCAGG - Intergenic
1180251253 21:46591429-46591451 CATCTTATGTGGATGGCAGCAGG - Intergenic
1180251536 21:46593379-46593401 CATCTTATGTGGATGGCAGCAGG - Intergenic
1181528738 22:23504074-23504096 GACTTTATCCAGAGGGCAGCAGG - Intergenic
1183156117 22:36076613-36076635 CATTTTACGTGGATAGCAGCAGG - Intergenic
1184312078 22:43652315-43652337 CATCTTATGTAGATGGTGGCAGG - Intronic
1184537539 22:45097554-45097576 CATCTTACCCGGATGGCAGCAGG - Intergenic
949359002 3:3212145-3212167 CATCTTACGTGGATGGCAGCAGG + Intergenic
950244868 3:11406708-11406730 CATCTTACGTGGATGGCAGCAGG + Intronic
950787549 3:15449082-15449104 CATCTTACGTGGATGGCAGCAGG - Intronic
950855210 3:16098156-16098178 CATCTTACGTGGATGGCAGCCGG - Intergenic
951054901 3:18136311-18136333 CATCTTACACGGATGGCAGCAGG + Intronic
951092946 3:18597088-18597110 CATCTTACGTGGATGGCAGCAGG + Intergenic
951446010 3:22781723-22781745 CATCTTACACAGATGGCAGCAGG + Intergenic
951452378 3:22853784-22853806 CATCTTACATAGATGGCAGCAGG + Intergenic
952033199 3:29169635-29169657 CATTTAATGGGGCTGGCAGCGGG - Intergenic
952109085 3:30101948-30101970 CATCTTATGCGGATGGCAGCAGG + Intergenic
952230653 3:31426361-31426383 CATGTTATGTGGATGGCGGCAGG + Intergenic
952261170 3:31741904-31741926 CATCTTATGTGGATGGCAGCAGG - Intronic
952421740 3:33138269-33138291 CAGTTTTTGCAAAAGGCAGCTGG + Intronic
952978503 3:38716441-38716463 CGTCTTATGTGGATGGCAGCAGG - Intronic
954300629 3:49699110-49699132 CATTTTGTGAAGATGGCTGTGGG + Intronic
955604740 3:60689149-60689171 CATCTTATGTGGATGGCAGCAGG - Intronic
955868904 3:63416732-63416754 CATCTTACGTGGATGGCAGCAGG + Intronic
956161198 3:66354859-66354881 CATTTTATGTGGATGGCGGCAGG - Intronic
956187675 3:66578049-66578071 CATTTTATGAAGAAGGGAGGAGG - Intergenic
956302275 3:67785246-67785268 CATCTTATATGGATGGCAGCAGG - Intergenic
956327383 3:68069302-68069324 CATTTTATGTGGATGGTGGCAGG + Intronic
956327656 3:68071240-68071262 CACCTTATGTGGATGGCAGCAGG + Intronic
956391767 3:68780576-68780598 CATTTTACACTGATGGCAGCAGG - Intronic
956707320 3:72010609-72010631 CATTTAAGGCACATGGCAGAGGG - Intergenic
956714305 3:72064659-72064681 CAACTTATGTGGATGGCAGCTGG + Intergenic
956714556 3:72067181-72067203 CATCTTATGTGGATGGCAGCAGG + Intergenic
956938451 3:74130949-74130971 CATCTTATGTGGATGGCAGCAGG + Intergenic
956938722 3:74132887-74132909 CATCTTATGTGGATGGCGGCAGG + Intergenic
957247092 3:77729372-77729394 CATCTTACGTGGATGGCAGCAGG - Intergenic
957300479 3:78386832-78386854 CATCTTATGTAGATGGCAGCAGG + Intergenic
957684494 3:83483430-83483452 CATCTTATGTGGATGGCAGCAGG - Intergenic
957694446 3:83617093-83617115 CATCTTAAGTGGATGGCAGCAGG + Intergenic
957759106 3:84532227-84532249 CATCTTACATAGATGGCAGCAGG - Intergenic
957781209 3:84820230-84820252 CATTTTATGTGGATGGTGGCAGG + Intergenic
958042746 3:88245654-88245676 CATCTTATGTGGATGACAGCAGG - Intergenic
958611751 3:96435810-96435832 CATTTTACGTGGATGGCAGAAGG + Intergenic
958612031 3:96437758-96437780 CATCTTATGTGGATGGCAGCAGG + Intergenic
958638385 3:96775280-96775302 CGTCTTACACAGATGGCAGCAGG + Intergenic
958763734 3:98340113-98340135 CATCTTACATAGATGGCAGCAGG - Intergenic
958837064 3:99158195-99158217 CATCTTAGGTGGATGGCAGCAGG - Intergenic
959155246 3:102658950-102658972 CATCTTACGTGGATGGCAGCAGG - Intergenic
959318974 3:104847276-104847298 CATCTTAGGTGGATGGCAGCAGG - Intergenic
959319234 3:104849200-104849222 CATTTTAAGTGGATGGCAGCAGG - Intergenic
959380915 3:105640747-105640769 CATCTTATGTAGATGGCAGCAGG + Intergenic
959381178 3:105642674-105642696 CATCTTACATAGATGGCAGCAGG + Intergenic
959390272 3:105763954-105763976 CAGTGTATGCAGATGTCACCTGG - Intronic
960297984 3:115967706-115967728 CATTTTATGTGGATGGCAGCAGG + Intronic
960396097 3:117139260-117139282 CATCTTACGTGGATGGCAGCAGG + Intronic
960478495 3:118159739-118159761 CATCTTATGTGGATGGCAGAAGG + Intergenic
960566789 3:119141875-119141897 CTTTTTACCCAGATGCCAGCAGG - Intronic
960842802 3:121977664-121977686 CATCTTATGTAAATGGCAGCAGG - Intergenic
960843080 3:121979588-121979610 CATCTTATGTGGATGGCAGCAGG - Intergenic
960849175 3:122034814-122034836 CATCTTATGTGGATGGCAGCAGG + Intergenic
960982777 3:123247047-123247069 CCTTTTATGCACAGGACAGCTGG + Intronic
963083887 3:141419149-141419171 CATCTTCTTCACATGGCAGCAGG + Intronic
963418224 3:145026637-145026659 CATCTTATGGGGATGGCAGCAGG - Intergenic
963494365 3:146041789-146041811 CATTTTACGTGGATGGCTGCAGG + Intergenic
963568703 3:146964352-146964374 CATCTTATATGGATGGCAGCAGG + Intergenic
963975418 3:151474798-151474820 CATATTATGTGGATGGCAGCAGG + Intergenic
964015796 3:151944961-151944983 CATCTTATGTGGATAGCAGCAGG - Intergenic
964498065 3:157316312-157316334 TATTTTATGCAGCTAGAAGCAGG - Intronic
964578241 3:158199161-158199183 CATCTTACGCGGATAGCAGCAGG - Intronic
964719227 3:159755333-159755355 CATCTTATATGGATGGCAGCAGG + Intronic
965127682 3:164650638-164650660 CATCTTATGTGGATGGCAGCAGG - Intergenic
965155464 3:165047309-165047331 CATCTTAGGTGGATGGCAGCAGG - Intronic
965363253 3:167766317-167766339 CATCTTATATGGATGGCAGCAGG + Intronic
965476691 3:169164301-169164323 CATCTTATGTGGATGGCAGCAGG - Intronic
965829813 3:172772816-172772838 CATTTTTTGCTTATGGCAGATGG + Intronic
966345476 3:178974379-178974401 CATCTTACGTGGATGGCAGCAGG - Intergenic
966538858 3:181066425-181066447 CATTTTATTCTCCTGGCAGCTGG - Intergenic
967462146 3:189759926-189759948 CATCTTATGTGGATGGCAGCAGG + Intronic
967462416 3:189761857-189761879 CATCTTATGTGGATGGCAGCAGG + Intronic
967505375 3:190247111-190247133 CATCTTATGTAATTGGCAGCAGG + Intergenic
967528227 3:190518687-190518709 CATCTTACGTGGATGGCAGCAGG + Intronic
968826955 4:2905650-2905672 CAGTCCATGCAGAGGGCAGCTGG - Intronic
969049794 4:4364593-4364615 CATCTTACGTGGATGGCAGCGGG + Intronic
969128596 4:4973789-4973811 CACCTTATTCACATGGCAGCAGG - Intergenic
969974322 4:11082404-11082426 CATCTTATATGGATGGCAGCAGG - Intergenic
970031953 4:11686021-11686043 CATCTTACGTGGATGGCAGCAGG + Intergenic
970094326 4:12445398-12445420 CATCTTACACATATGGCAGCAGG + Intergenic
970112993 4:12659684-12659706 CATCTTATATGGATGGCAGCAGG - Intergenic
970140470 4:12976636-12976658 CATCTTATGTGGATGGCGGCAGG + Intergenic
970554066 4:17214224-17214246 CATCTTATGTGCATGGCAGCAGG + Intergenic
970554393 4:17216432-17216454 CATCTTATGTGGATGGCAGGAGG + Intergenic
970706599 4:18811647-18811669 AATTCTATGCATATGGCAGGAGG + Intergenic
970977520 4:22058173-22058195 CATTTTACACGGATGGCAGCAGG - Intergenic
971687582 4:29788482-29788504 CATCTTATGTGGATGGCAGCAGG + Intergenic
971705626 4:30038875-30038897 CATCTTACGTGGATGGCAGCAGG + Intergenic
971797007 4:31241321-31241343 TAATTAATGCAGGTGGCAGCGGG + Intergenic
971844981 4:31906823-31906845 CATCTTATGTATATGGCAGCAGG + Intergenic
971884073 4:32420704-32420726 CATCTTACATAGATGGCAGCAGG + Intergenic
972370407 4:38418500-38418522 CATCTTATGTGGATGGCAGCAGG + Intergenic
972467381 4:39370332-39370354 CATCTTATGTGGATGGCAGCAGG - Intergenic
972678107 4:41279733-41279755 CATCTTACGTGGATGGCAGCAGG + Intergenic
972749524 4:41974167-41974189 CATCTTACGTGGATGGCAGCAGG - Intergenic
972913526 4:43847957-43847979 CATCTTACGGGGATGGCAGCAGG + Intergenic
972935991 4:44136296-44136318 CATCTTATGTGAATGGCAGCAGG - Intergenic
972987918 4:44787529-44787551 CATCTTATATGGATGGCAGCAGG - Intergenic
974029847 4:56766649-56766671 CAATTTCTGCATATGGGAGCTGG - Intergenic
974144982 4:57936210-57936232 CATCTTATATGGATGGCAGCAGG - Intergenic
974340979 4:60614915-60614937 CATCTTATATGGATGGCAGCAGG - Intergenic
974476093 4:62382435-62382457 CATCTTATATGGATGGCAGCAGG + Intergenic
974477684 4:62405132-62405154 CATCTTATGTGAATGGCAGCAGG - Intergenic
974555955 4:63447332-63447354 CATCTTATGTAGATGGTGGCAGG + Intergenic
974601890 4:64093797-64093819 GATGTAATGAAGATGGCAGCTGG + Intergenic
974675711 4:65086156-65086178 CGTCTTACACAGATGGCAGCAGG + Intergenic
974679739 4:65146025-65146047 CGTCTTATACGGATGGCAGCAGG + Intergenic
974796975 4:66765927-66765949 CATCTTACGTGGATGGCAGCAGG - Intergenic
974831444 4:67194458-67194480 CGTATTATGTAGTTGGCAGCAGG - Intergenic
975200494 4:71582608-71582630 CATCTTATGTGGATGGCAGCAGG - Intergenic
975214680 4:71739291-71739313 CATCTTATGTGGATGGCAGCAGG - Intergenic
975216632 4:71762762-71762784 CATCTTACGTGGATGGCAGCAGG - Intronic
975496815 4:75044831-75044853 CATCTTATGTGGATGGCAGCAGG + Intronic
975533486 4:75424857-75424879 CATTTTACATGGATGGCAGCAGG + Intergenic
975594533 4:76036726-76036748 CATTATAGGCAGATGGCAGGGGG + Intronic
975803907 4:78092432-78092454 CATCTTATGTGGATGGCAGTAGG + Intronic
976051255 4:81013371-81013393 CATTTTACATGGATGGCAGCAGG - Intergenic
976051432 4:81015678-81015700 CATCTTACACAGATGGAAGCAGG + Intergenic
976056966 4:81080443-81080465 CATCTTATATGGATGGCAGCAGG - Intergenic
976260013 4:83136539-83136561 TATCTTATGTGGATGGCAGCAGG + Intronic
976397544 4:84572423-84572445 CATCTCAGGCAGGTGGCAGCAGG - Intergenic
976514239 4:85946031-85946053 CATCTTATGTGGATGGCGGCAGG + Intronic
976668579 4:87627051-87627073 CATCTTATGTGGATGGCAGCAGG + Intergenic
976674641 4:87690988-87691010 CATTTTATATGAATGGCAGCAGG - Intergenic
976875739 4:89851352-89851374 CGTCTTATGTGGATGGCAGCAGG + Intergenic
976892648 4:90068885-90068907 CATCTTAGGTGGATGGCAGCAGG - Intergenic
976902195 4:90192175-90192197 CATGTTACGTGGATGGCAGCAGG + Intronic
976906022 4:90237306-90237328 CATTAAATGCAGATGACAGAGGG - Intronic
977418529 4:96765489-96765511 CATTTTAGGCAGATCACAGGAGG - Intergenic
977578933 4:98703835-98703857 CATTTTACATGGATGGCAGCAGG - Intergenic
977682702 4:99813367-99813389 CATCTTATGTGGATGGCAGCAGG + Intergenic
977797374 4:101182891-101182913 CATTTTACATGGATGGCAGCAGG - Intronic
978181359 4:105800214-105800236 CATCTTATGTGGATGGCGGCAGG + Intronic
978244203 4:106552584-106552606 CATTTTACATGGATGGCAGCAGG - Intergenic
978592559 4:110341425-110341447 CATTTTATTCAGATAAGAGCAGG - Intergenic
979132281 4:117062348-117062370 CATCTTACATAGATGGCAGCAGG - Intergenic
979146044 4:117250425-117250447 CATCTTATATGGATGGCAGCAGG - Intergenic
979147136 4:117258084-117258106 CATCTTACGTGGATGGCAGCAGG - Intergenic
979327730 4:119399245-119399267 TATCTTATGTGGATGGCAGCAGG + Intergenic
979390251 4:120118993-120119015 CATTTTATGTGGATGGCAGCAGG + Intergenic
979426222 4:120571317-120571339 CAGCTTATGTGGATGGCAGCAGG + Intergenic
979496017 4:121383243-121383265 CATCTTACATAGATGGCAGCAGG - Intergenic
979629329 4:122881965-122881987 CATCTTAAATAGATGGCAGCAGG + Intronic
980201173 4:129657941-129657963 CATCTTACATAGATGGCAGCAGG + Intergenic
980368744 4:131839682-131839704 CATCTTATGTGGGTGGCAGCAGG - Intergenic
980391456 4:132153045-132153067 CATTTTACACTGATGGCAGCAGG - Intergenic
980569666 4:134597983-134598005 CATCTTAGGTGGATGGCAGCAGG - Intergenic
980984650 4:139683839-139683861 CATTTTACATGGATGGCAGCAGG + Intronic
981286927 4:143028315-143028337 CATCTTATGGGTATGGCAGCAGG - Intergenic
981483677 4:145262862-145262884 CATCTTAAGTGGATGGCAGCAGG - Intergenic
981832479 4:149018231-149018253 CATCTTACGTGGATGGCAGCAGG + Intergenic
982436546 4:155387468-155387490 CATCTTATGTGGATGGCAGCAGG + Intergenic
982855938 4:160383120-160383142 CATCTTATATAGATGGCAGTAGG - Intergenic
982860616 4:160444389-160444411 CATCTTATGTGGATGGCAGCAGG + Intergenic
982868056 4:160543143-160543165 CATTGTATGTGGATCGCAGCAGG + Intergenic
983245481 4:165282967-165282989 TATCTTATGTGGATGGCAGCAGG + Intronic
983431914 4:167660908-167660930 CATCTTACGTGGATGGCAGCAGG + Intergenic
983433619 4:167683053-167683075 CATTTTACGTGGATGGCGGCAGG + Intergenic
983712742 4:170739727-170739749 CATCTTATATGGATGGCAGCAGG - Intergenic
983968401 4:173842703-173842725 CATTTTAGATAGATGGCAGCAGG - Intergenic
984231994 4:177111319-177111341 TATCTTACGTAGATGGCAGCAGG + Intergenic
984327232 4:178269875-178269897 CATCTTACGTGGATGGCAGCAGG + Intergenic
984811969 4:183803066-183803088 CATCTTACGTGGATGGCAGCAGG + Intergenic
985018043 4:185657799-185657821 CATTTTATGAAGAAGGCTGAGGG + Intronic
985100448 4:186452993-186453015 CATCTTATGTGGATGGCGGCAGG + Intronic
985110155 4:186540056-186540078 CATCTTACGTGGATGGCAGCAGG + Intronic
985844219 5:2332227-2332249 CATCTTATGTGGATGGCAGCAGG + Intergenic
986080975 5:4394170-4394192 CATCTTAAGTAGATGGCAGCAGG + Intergenic
986085071 5:4436942-4436964 CATCTTATGTGGATGGCAGCAGG + Intergenic
986133245 5:4949904-4949926 CAGTTTCTGCTGATGCCAGCTGG - Intergenic
986201211 5:5580444-5580466 CATCTTAAGTGGATGGCAGCAGG - Intergenic
986221952 5:5776118-5776140 CATTTTACATGGATGGCAGCAGG - Intergenic
986364055 5:7011899-7011921 CATGTCCTGCACATGGCAGCAGG + Intergenic
986756880 5:10844962-10844984 CATCTTATGTGGATGGCAGCAGG + Intergenic
986780091 5:11057461-11057483 CATCTTACGTGGATGGCAGCAGG - Intronic
986780360 5:11059400-11059422 TATCTTATGTGGATGGCAGCAGG - Intronic
987509174 5:18814244-18814266 CAGCTTATGTGGATGGCAGCAGG + Intergenic
987509426 5:18816301-18816323 CATCTTATGCAGACATCAGCAGG + Intergenic
987790718 5:22563802-22563824 CATCTTATGTGGATGGCAGCAGG + Intronic
987843886 5:23256600-23256622 CATTTTTGGCAGAAGGCAGAAGG - Intergenic
988148735 5:27347497-27347519 CATCTTACGTGGATGGCAGCAGG - Intergenic
988221105 5:28348311-28348333 CATCTTACGTAGATGGCAGCAGG + Intergenic
988221373 5:28350233-28350255 CATCTTATGTAAACGGCAGCAGG + Intergenic
988865621 5:35331286-35331308 CATCTTACATAGATGGCAGCAGG - Intergenic
989285298 5:39692239-39692261 TATTTTAGGCAGGTAGCAGCAGG - Intergenic
989806602 5:45615334-45615356 CATTTTACGCAGATGGCTATAGG + Intronic
990264442 5:54060510-54060532 CATCTTACGTGGATGGCAGCAGG - Intronic
990264734 5:54062568-54062590 CATCTTATGTGGATGGCAGCAGG - Intronic
990767496 5:59202742-59202764 CATCTTATGTGGATGGCAACAGG - Intronic
991121021 5:63013768-63013790 CCCTTTATCCAGATGGCAACTGG - Intergenic
991616174 5:68498966-68498988 CATCTTACGTGGATGGCAGCAGG - Intergenic
992412343 5:76518347-76518369 CATTTTACATGGATGGCAGCAGG + Intronic
992436711 5:76761681-76761703 CATTGTATGTGGATGGCGGCAGG - Intergenic
992854713 5:80848591-80848613 CATCTTATGTGGATGGCAGCAGG + Intronic
992855001 5:80850528-80850550 CATCTTATGGGGATGGCAGCAGG + Intronic
993801659 5:92350572-92350594 CATCTTACGTGGATGGCAGCAGG - Intergenic
993840749 5:92875975-92875997 CATTGTATGCAGGTGCAAGCAGG + Intergenic
994344112 5:98664619-98664641 CATCTTAGGCAGCAGGCAGCAGG - Intergenic
994755751 5:103791462-103791484 CATCTTACATAGATGGCAGCAGG + Intergenic
994823148 5:104679403-104679425 CATTTTATATGGATGGCAGCAGG - Intergenic
994853325 5:105085147-105085169 CATATTACACAGAGGGCAGCAGG - Intergenic
995004433 5:107173992-107174014 CATCTTACGTGGATGGCAGCAGG + Intergenic
995145014 5:108777775-108777797 CATCTTACGTGGATGGCAGCAGG + Intronic
995153540 5:108881320-108881342 CGTTTTACACGGATGGCAGCAGG + Intronic
995403179 5:111764449-111764471 CATCTTACGTGGATGGCAGCAGG + Intronic
995671758 5:114611967-114611989 CATTTCACGTGGATGGCAGCAGG + Intergenic
995860569 5:116636267-116636289 CATCTTCTGTGGATGGCAGCTGG + Intergenic
996172833 5:120316050-120316072 CATTTTACATGGATGGCAGCAGG + Intergenic
996214445 5:120849828-120849850 CGTCTTATGTGGATGGCAGCAGG + Intergenic
996225725 5:120993308-120993330 CGTATTATGTGGATGGCAGCAGG - Intergenic
996370465 5:122747473-122747495 CATCTTATGTGGATGGCAGCAGG + Intergenic
996392990 5:122983421-122983443 TATTTTATGCAGATGGTATATGG - Intronic
996430529 5:123371336-123371358 CATTTTATGTGGATGGCGGCAGG + Intronic
996788977 5:127271722-127271744 CATCTTTTCCACATGGCAGCAGG - Intergenic
997092836 5:130877544-130877566 CATCTTATGTGGATGGCGGCAGG - Intergenic
997513918 5:134472051-134472073 CATCTTACGTGGATGGCAGCAGG + Intergenic
997780087 5:136648512-136648534 CATCTTACGTGGATGGCAGCAGG + Intergenic
998220636 5:140275780-140275802 CAGTTTGTGTAGATGGCAGGAGG - Intronic
998700043 5:144687921-144687943 CGTCTTATGTAGATGGCAGCAGG + Intergenic
999040872 5:148410379-148410401 CATTTTTGCCTGATGGCAGCAGG - Intronic
999124628 5:149238193-149238215 TGTTTTCTGGAGATGGCAGCAGG + Intronic
999178418 5:149648851-149648873 CATCTTACGTGGATGGCAGCAGG + Intergenic
999473880 5:151880027-151880049 CATCTTACGTGGATGGCAGCAGG - Intronic
1000034685 5:157436279-157436301 CATCTTATGTGGATTGCAGCAGG - Intronic
1000229235 5:159299421-159299443 CATCTTATGTGGATGGAAGCAGG + Intergenic
1001202543 5:169731416-169731438 CGTTTTACACGGATGGCAGCAGG - Intronic
1001236803 5:170036625-170036647 AATTTTATCCTGAAGGCAGCAGG - Intronic
1001240453 5:170065639-170065661 CATCTTACGTGGATGGCAGCAGG + Intronic
1001349639 5:170947625-170947647 CATTGTAATCAGATGACAGCTGG + Intronic
1001983175 5:176050658-176050680 TGTTTTATGAAAATGGCAGCTGG - Exonic
1002234290 5:177793394-177793416 TGTTTTATGAAAATGGCAGCTGG + Exonic
1002520332 5:179789438-179789460 CATCTTACGTGGATGGCAGCAGG - Intronic
1002771986 6:297834-297856 CATTTTTTCCACCTGGCAGCAGG + Intronic
1002802443 6:537881-537903 GATTCTCTGCAGATAGCAGCTGG + Intronic
1003470385 6:6424503-6424525 CCTCTTATGTGGATGGCAGCAGG + Intergenic
1003649202 6:7943083-7943105 CATCTTATGTGGATGGCAGCAGG - Intronic
1004107188 6:12676903-12676925 CATCTTATGCGGATGGCAGCAGG - Intergenic
1004819881 6:19356030-19356052 CATCTTATGTGGATGGCAGCAGG + Intergenic
1004893040 6:20120215-20120237 CATTTTATGCTCAAGGGAGCAGG - Intronic
1004963724 6:20822759-20822781 CACTTTCTTCAGAAGGCAGCAGG - Intronic
1005922393 6:30414341-30414363 CATCTTGTGTGGATGGCAGCAGG + Intergenic
1006186877 6:32186460-32186482 CCTTTCAGGCAAATGGCAGCTGG - Exonic
1006995432 6:38255611-38255633 CATTTAATGCATATGGCACTGGG - Intronic
1007203326 6:40129658-40129680 CATTTTATTCAGATTCTAGCAGG - Intergenic
1008260379 6:49359197-49359219 CATCTTACACTGATGGCAGCAGG - Intergenic
1009300164 6:62008789-62008811 CATCTTACACAGATGGCAGCAGG - Intronic
1009300436 6:62010708-62010730 CATCTTATGTGGATGGCAGCAGG - Intronic
1009503282 6:64443739-64443761 CATATTACATAGATGGCAGCAGG - Intronic
1009635045 6:66254086-66254108 CATTTTACATGGATGGCAGCAGG + Intergenic
1009824928 6:68856070-68856092 CAACTTATGTGGATGGCAGCAGG - Intronic
1009945780 6:70340709-70340731 CATGTTTTTCACATGGCAGCAGG + Intergenic
1009990419 6:70836275-70836297 CATCTTATGTGAATGGCAGCAGG + Intronic
1010530843 6:76965790-76965812 CATTTTATGTGGATGGCAGCAGG - Intergenic
1010550903 6:77221671-77221693 CATTTTATGTGGATGGTGGCAGG - Intergenic
1010714026 6:79207442-79207464 CATCTTATGTGGATGGCAGCAGG - Intronic
1010898081 6:81391385-81391407 CACTTTGTTCACATGGCAGCAGG - Intergenic
1010906705 6:81500456-81500478 CATGTTCTTCACATGGCAGCAGG - Intronic
1011146130 6:84219026-84219048 CATTTTATTCCTATGGCAACTGG + Intronic
1011207301 6:84913547-84913569 CATCTTATGCGGAAAGCAGCAGG + Intergenic
1011348879 6:86401054-86401076 CAGCTTATGCAGATGGCAGCAGG + Intergenic
1011461810 6:87613220-87613242 CATCTTACATAGATGGCAGCAGG + Intronic
1012194292 6:96319235-96319257 CATCTTACGTGGATGGCAGCAGG + Intergenic
1012417618 6:99026675-99026697 CATCTTATGTGGATGGCAGCAGG - Intergenic
1012485787 6:99721600-99721622 CATTTTATTCACAAGGCAGCAGG - Intergenic
1012649482 6:101735522-101735544 CATCTTAGGTGGATGGCAGCAGG + Intronic
1012723730 6:102782768-102782790 CATCTTACGTGGATGGCAGCAGG - Intergenic
1013039761 6:106421863-106421885 CATCTTATGTGGATGGTAGCAGG + Intergenic
1013378788 6:109545533-109545555 CATCTTACGTGGATGGCAGCAGG - Intronic
1013558197 6:111278633-111278655 CATCTTATATAGATGGCAGCAGG - Intergenic
1013693564 6:112673826-112673848 CATCTTATGTGGATGGCAACAGG + Intergenic
1014094227 6:117442493-117442515 CATCTTACACGGATGGCAGCAGG + Intronic
1014579923 6:123124447-123124469 CATCTTACGTGGATGGCAGCAGG - Intergenic
1015044785 6:128764066-128764088 CATCTTATGTGGATGGCAGCAGG + Intergenic
1015112411 6:129608604-129608626 TGTTTTTTGCAGCTGGCAGCAGG - Intronic
1015675100 6:135737106-135737128 CATCTTACGCGGATGGCGGCAGG + Intergenic
1016125016 6:140389393-140389415 CATCTTAAGTGGATGGCAGCAGG + Intergenic
1016241755 6:141939569-141939591 CATCTTACATAGATGGCAGCAGG - Intergenic
1016256777 6:142116070-142116092 CATCTTATGGGGATGGCGGCAGG - Intergenic
1016281898 6:142427776-142427798 CATCTTATGTGGATGGCAGCAGG + Intronic
1016649728 6:146449512-146449534 CATCTTATGTGGAAGGCAGCAGG + Intergenic
1016862369 6:148733658-148733680 CATCTTACACAGATGGCAGCAGG + Intergenic
1017034970 6:150258931-150258953 CATCTTATGTGGATGTCAGCAGG + Intergenic
1017380574 6:153823759-153823781 CATCTTACGCGGATGGCAGCAGG + Intergenic
1017601848 6:156092184-156092206 CATCTTACGTGGATGGCAGCAGG + Intergenic
1017618081 6:156266188-156266210 CATCTTATATGGATGGCAGCAGG + Intergenic
1018031884 6:159847923-159847945 CATCTTACACGGATGGCAGCAGG - Intergenic
1018466267 6:164048283-164048305 CATCTTACGTGGATGGCAGCAGG - Intergenic
1019123318 6:169822936-169822958 CATCTTAAGTGGATGGCAGCAGG - Intergenic
1020782572 7:12535320-12535342 CATCCTATGTGGATGGCAGCAGG + Intergenic
1020878511 7:13728609-13728631 CATCTTACACGGATGGCAGCAGG - Intergenic
1020885777 7:13817425-13817447 CATTTTACATGGATGGCAGCAGG - Intergenic
1020890784 7:13875716-13875738 CATCTTATATGGATGGCAGCAGG + Intergenic
1020936753 7:14474297-14474319 CATCTTATGTGGATGGCAGCAGG - Intronic
1021036707 7:15809027-15809049 CATCTTACGTGGATGGCAGCGGG + Intergenic
1021177242 7:17463187-17463209 CATCTTATGTGGATGGCAGCAGG - Intergenic
1021372980 7:19873031-19873053 CATCTTACATAGATGGCAGCAGG - Intergenic
1021646883 7:22797425-22797447 CATCTTACATAGATGGCAGCAGG + Intergenic
1021945801 7:25726163-25726185 CATTGTCAGCTGATGGCAGCAGG + Intergenic
1022308227 7:29170828-29170850 CATCTTATGTGGATGGCTGCAGG + Intronic
1022458053 7:30576622-30576644 CATCTTATGTGGATGGCAGCAGG + Intergenic
1022493012 7:30835254-30835276 CATCTTATGTGGATGGCAGCAGG + Intronic
1022964385 7:35458970-35458992 CATCTTACATAGATGGCAGCAGG + Intergenic
1023216103 7:37864815-37864837 CATCTTACGTGGATGGCAGCAGG + Intronic
1023352981 7:39338765-39338787 CAATTTCTGCAGAAGGAAGCTGG - Intronic
1024021552 7:45375183-45375205 CATCTTATGTGGATGGCAGCAGG + Intergenic
1024256368 7:47543013-47543035 CAATTTCTGCAGATGAGAGCTGG - Intronic
1024328195 7:48130064-48130086 CATCATATGTAAATGGCAGCAGG + Intergenic
1024894498 7:54242193-54242215 CATCTTATGCGGATGGCGGCAGG - Intergenic
1025725233 7:64052401-64052423 TATCTTATGTGGATGGCAGCAGG - Intronic
1026230831 7:68482460-68482482 CATCTTATATGGATGGCAGCAGG - Intergenic
1026803149 7:73412420-73412442 TCTTTGATGAAGATGGCAGCAGG - Intergenic
1027369440 7:77493177-77493199 CATCTTAAGTGGATGGCAGCAGG - Intergenic
1027518963 7:79180414-79180436 CATCTTATGTGGATGGCAGCAGG + Intronic
1027519206 7:79182334-79182356 CATCTTATGTGGATGGCAGCAGG + Intronic
1027586223 7:80062083-80062105 CATCTTATGCGGATGGCAGGAGG + Intergenic
1027624903 7:80533014-80533036 CATTTTATGTGGATGGCACTAGG - Intronic
1027681009 7:81222063-81222085 CATCTTATGTGGATGGCAGCAGG - Intergenic
1028106562 7:86885957-86885979 CATTTGTTGCAAATGGCAGTTGG - Intronic
1028250221 7:88531405-88531427 CATCTTATGTGGATGGCACCAGG - Intergenic
1028315075 7:89391474-89391496 CATCTTATGTGGATGGCGGCAGG - Intergenic
1028348499 7:89813985-89814007 CATTTTACATGGATGGCAGCAGG + Intergenic
1028360147 7:89957040-89957062 CATCTTATGTGCATGGCAGCAGG + Intergenic
1029140888 7:98409138-98409160 TATCTTATGTGGATGGCAGCAGG - Intergenic
1030131888 7:106208689-106208711 CATTTTATACACATGGAAACAGG - Intergenic
1030511045 7:110482189-110482211 CATCTTACATAGATGGCAGCAGG + Intergenic
1030587030 7:111433407-111433429 CATCTTACACGGATGGCAGCAGG + Intronic
1030703380 7:112666390-112666412 CATCTTACGTGGATGGCAGCAGG + Intergenic
1030838595 7:114319522-114319544 CATTGTATGAGGATGGCAGCAGG + Intronic
1030866339 7:114705389-114705411 CATCTTCTTCACATGGCAGCAGG - Intergenic
1031158323 7:118136377-118136399 CATCTTATGTGGATGACAGCAGG - Intergenic
1031298956 7:120040223-120040245 CATCTAATGTGGATGGCAGCAGG + Intergenic
1031559298 7:123218406-123218428 CATCTTACATAGATGGCAGCAGG - Intergenic
1031674100 7:124588228-124588250 CATCTTACGTGGATGGCAGCAGG - Intergenic
1031674364 7:124590207-124590229 CATCTTACGTGGATGGCAGCAGG - Intergenic
1031791865 7:126117178-126117200 CATCTTATATGGATGGCAGCAGG - Intergenic
1032802971 7:135331194-135331216 CATCTTACGTGGATGGCAGCAGG - Intergenic
1033139718 7:138814596-138814618 CATCTTATGCAGATGACCCCTGG - Intronic
1033403126 7:141046325-141046347 CATCTTACGTGGATGGCAGCAGG + Intergenic
1033412820 7:141135042-141135064 CATCTTATGTGGATGTCAGCAGG - Intronic
1033544390 7:142386663-142386685 CTTTTTGTGCAGAGGGCAGCTGG - Intergenic
1033579284 7:142716874-142716896 CTTTTTGTGCAGACTGCAGCTGG + Intergenic
1033707557 7:143903800-143903822 CATCTTATGTGGATGGCGGCAGG + Intergenic
1033717609 7:144018915-144018937 CATCTTACGTGGATGGCAGCAGG + Intergenic
1033760125 7:144428543-144428565 CATCTTATGTGGATGGCAGCAGG + Intergenic
1034762978 7:153690824-153690846 CATATTATATGGATGGCAGCAGG + Intergenic
1034897840 7:154888870-154888892 CATCTTACACAGATGGCAGCAGG + Intronic
1035072100 7:156153186-156153208 CATCTTATATGGATGGCAGCAGG - Intergenic
1035773695 8:2170776-2170798 CATTTTAATTAGATGTCAGCTGG + Intergenic
1035821792 8:2600764-2600786 CATCTTACATAGATGGCAGCAGG - Intergenic
1035993746 8:4522241-4522263 CGTCTTATGTGGATGGCAGCAGG - Intronic
1036914404 8:12790816-12790838 CATCTTAGGGGGATGGCAGCAGG + Intergenic
1036927761 8:12923776-12923798 CATCTTTCACAGATGGCAGCAGG + Intergenic
1037130188 8:15399218-15399240 CATCTTACGGGGATGGCAGCAGG - Intergenic
1037200849 8:16250456-16250478 CATCTTACGTGGATGGCAGCAGG + Intronic
1037393646 8:18420037-18420059 CATCTTACACGGATGGCAGCAGG - Intergenic
1037451048 8:19015232-19015254 CATCTTAAGCGGATGGCAGTAGG - Intronic
1038746747 8:30261498-30261520 CATCTTCTGTGGATGGCAGCAGG - Intergenic
1038940709 8:32301657-32301679 CATCTTAGGTGGATGGCAGCAGG + Intronic
1039122086 8:34158433-34158455 CATCTTATGTGGATGGCAGCAGG - Intergenic
1039389009 8:37162143-37162165 CATCTTATGTGGATGGCAGCAGG + Intergenic
1040005121 8:42613935-42613957 CATCTTATGTGGATGGCAGCAGG + Intergenic
1040615504 8:49032968-49032990 CATCTTACATAGATGGCAGCAGG - Intergenic
1040965791 8:53079790-53079812 CATCTTATGTGGATGGCAGCAGG - Intergenic
1041551066 8:59102167-59102189 CATCTTATGTGGATGGCGGCAGG + Intronic
1041991058 8:63992019-63992041 CATTTTATGTGGATGGCAGCAGG - Intergenic
1042169911 8:65981121-65981143 CATCTTACGTGGATGGCAGCAGG - Intergenic
1043073749 8:75669514-75669536 CATCTTATGTGGATGGCAGCAGG - Intergenic
1043092885 8:75927523-75927545 CATCTTACACGGATGGCAGCAGG + Intergenic
1043510822 8:80948694-80948716 CATCTTATGTGGATGGCAGCAGG - Intergenic
1043924131 8:86017598-86017620 CATTTTTGGCAGAGGGCCGCTGG - Intronic
1044181802 8:89205394-89205416 CATCTTATATAGATGGCAGCAGG + Intergenic
1044450282 8:92328145-92328167 CATCTTACATAGATGGCAGCAGG - Intergenic
1044758102 8:95488279-95488301 CATCTTATATGGATGGCAGCAGG - Intergenic
1044877341 8:96682386-96682408 CGTTTTACGTGGATGGCAGCAGG - Intronic
1045249438 8:100471106-100471128 CATCTTACGTGGATGGCAGCAGG - Intergenic
1045297418 8:100884204-100884226 TATTTTCTGCACATTGCAGCAGG + Intergenic
1045316637 8:101049152-101049174 CATTTTATCCTGAAGGCACCGGG - Intergenic
1045611170 8:103844053-103844075 CATTTTATGTGAATGGCAGCAGG - Intronic
1045931857 8:107636294-107636316 CAGTTTCTGCAGATCACAGCTGG - Intergenic
1045940686 8:107734943-107734965 CATCCTATGTGGATGGCAGCAGG + Intergenic
1045995786 8:108359874-108359896 CATCTTACGTGGATGGCAGCAGG + Intronic
1046050283 8:109013607-109013629 CATCTTATGTGGATTGCAGCAGG - Intergenic
1046207072 8:111014922-111014944 CATCTTATGTGGATGGCAGCAGG - Intergenic
1046561626 8:115845175-115845197 CATCTTATGTGAATGGCAGCAGG + Intergenic
1046959441 8:120094917-120094939 CATTTTAATCAGATAGCAGATGG - Intronic
1047049824 8:121098423-121098445 CATCTTATGTGGATGGCAGCAGG + Intergenic
1047149028 8:122240310-122240332 CATCTTATGTGGATGGCAGGAGG - Intergenic
1047158730 8:122352304-122352326 CATTTTACATAGATGGCAGCAGG - Intergenic
1047193282 8:122698296-122698318 CATTTTATGCAGCTTTCAACTGG - Intergenic
1047266247 8:123312162-123312184 GATTTTATGCAGAAGGGAGAAGG - Intergenic
1047308498 8:123672891-123672913 CATCTTACGTGGATGGCAGCAGG + Intergenic
1047513460 8:125533025-125533047 CATCTTACGTGGATGGCAGCAGG - Intergenic
1047920601 8:129630735-129630757 CATCTTACGTGGATGGCAGCAGG + Intergenic
1048057308 8:130880056-130880078 CATCTTATGTGGCTGGCAGCAGG - Intronic
1048137869 8:131763782-131763804 CATTTTACATGGATGGCAGCAGG + Intergenic
1048419476 8:134262588-134262610 CATCTTAAGTGGATGGCAGCAGG - Intergenic
1048430361 8:134364808-134364830 CATCTTATGTGGATGGGAGCAGG + Intergenic
1048591994 8:135828922-135828944 CATCTTATACGGATGGCAGCAGG - Intergenic
1048722708 8:137344804-137344826 CATCTTACGTGGATGGCAGCAGG - Intergenic
1048852718 8:138659877-138659899 CATGTTAAACAGATGGCAACTGG + Intronic
1048918664 8:139207824-139207846 CATCTTACGTGGATGGCAGCAGG + Intergenic
1050264181 9:3872516-3872538 CATTTTACATGGATGGCAGCAGG + Intronic
1051015991 9:12475885-12475907 CATCTTATGTGGATGGCAGCAGG - Intergenic
1051070170 9:13156459-13156481 CATCTTATGTGGATGGCAGCAGG + Intronic
1051743470 9:20273591-20273613 CGTCTTATGTGGATGGCAGCAGG - Intergenic
1052598928 9:30599523-30599545 CATCTTATGTGGGTGGCAGCAGG + Intergenic
1053633114 9:39965406-39965428 CATCTTATGTGGGTGGCAGCAGG - Intergenic
1053772637 9:41498127-41498149 CATCTTATGTGGGTGGCAGCAGG + Intergenic
1054210774 9:62285291-62285313 CATCTTATGTGGGTGGCAGCAGG + Intergenic
1054314208 9:63563563-63563585 CATCTTATGTGGGTGGCAGCAGG - Intergenic
1054879422 9:70129312-70129334 CATCTTATGTGGATGGAAGCAGG - Intronic
1055083625 9:72291743-72291765 CATCTTATGTGGACGGCAGCAGG + Intergenic
1055735092 9:79319241-79319263 CATCTTAGGTGGATGGCAGCAGG - Intergenic
1055863176 9:80779390-80779412 CATCTTATGTGGATGGCGGCAGG - Intergenic
1056060404 9:82879714-82879736 CATCTTACGTGGATGGCAGCAGG + Intergenic
1056462149 9:86818469-86818491 GATGGTATGTAGATGGCAGCAGG + Intergenic
1057732633 9:97623262-97623284 CATCTTACGTAGATGGCAGCAGG - Intronic
1057858190 9:98618691-98618713 CATGTTAGGCAGATGTCAACTGG - Intronic
1058065786 9:100546296-100546318 CATCTTACGTGGATGGCAGCAGG + Intronic
1058764635 9:108169451-108169473 CATCTTATGTGGATGGCAGCAGG - Intergenic
1058827939 9:108791790-108791812 CATTTTACATGGATGGCAGCAGG - Intergenic
1058924166 9:109645223-109645245 CATCTTATGTGGAGGGCAGCAGG + Intronic
1059559518 9:115319656-115319678 CATCTTATGTGGATGGCAGCAGG - Intronic
1059582398 9:115566075-115566097 CATCTTATGTGAATGGCAGCAGG - Intergenic
1059766822 9:117391409-117391431 CATCTTATGTGGATGGCAGCAGG + Intronic
1060179387 9:121522536-121522558 CATTTTAGGTGGATGACAGCAGG - Intergenic
1060631223 9:125160558-125160580 CATCTTATGTGGATGGCGGCAGG - Intronic
1061255376 9:129452078-129452100 GACTTTATCCAGAGGGCAGCGGG + Intergenic
1061406872 9:130397197-130397219 CATCTTACGTGGATGGCAGCAGG + Intronic
1061635146 9:131903227-131903249 CATCTTATGTGGATGGCAGCAGG + Intronic
1061750219 9:132771935-132771957 CATCTTATATGGATGGCAGCAGG + Intronic
1062151132 9:135019594-135019616 CATCATAAGCAGATGGGAGCAGG + Intergenic
1203747069 Un_GL000218v1:45677-45699 CAGTTTCCCCAGATGGCAGCAGG + Intergenic
1203563036 Un_KI270744v1:73803-73825 CAGTTTCCCCAGATGGCAGCAGG - Intergenic
1186066984 X:5776829-5776851 CATTTCATGTGGATGGCAGCAGG + Intergenic
1186926905 X:14343604-14343626 CATCTTACGTGGATGGCAGCAGG - Intergenic
1186954858 X:14670552-14670574 CATCTTATGTGGACGGCAGCAGG + Intronic
1187030292 X:15480186-15480208 CATCTTATATGGATGGCAGCAGG - Intronic
1187072486 X:15902049-15902071 CATCTTATATGGATGGCAGCAGG + Intergenic
1187402655 X:18975350-18975372 CATCTTATGTGGATGGCAGCGGG - Intronic
1187413604 X:19072823-19072845 CGGTTTATGCAGAAGGCAGTAGG - Intronic
1187677161 X:21727724-21727746 GACTTTATGCAGATGGCAAGGGG - Intronic
1188069350 X:25700133-25700155 CATCTTGTGCGGATGGCAACGGG + Intergenic
1188397768 X:29706037-29706059 CATCTTACGTGGATGGCAGCAGG + Intronic
1188725014 X:33572228-33572250 CATCTTACATAGATGGCAGCAGG + Intergenic
1189464590 X:41268748-41268770 CATCTTATGTGGATGGCAGCAGG - Intergenic
1189707534 X:43773762-43773784 CATCTTACGTCGATGGCAGCAGG - Intronic
1189772277 X:44438382-44438404 CACCTTATGTGGATGGCAGCAGG - Intergenic
1191188718 X:57641159-57641181 CATCTTACACGGATGGCAGCAGG - Intergenic
1191596037 X:62945064-62945086 CATTTTACGTGGATGGCAGGAGG + Intergenic
1191673510 X:63770812-63770834 CATTGTATGTGGATGGCAGCAGG - Intronic
1192410062 X:70926105-70926127 CTTATGATGCAGATGACAGCTGG - Exonic
1192856667 X:75019227-75019249 CATCTTATGTGGATGGCAGCAGG + Intergenic
1193271663 X:79536383-79536405 CATCTTATGGGAATGGCAGCAGG - Intergenic
1193917510 X:87383172-87383194 CATCTTACGTGGATGGCAGCAGG - Intergenic
1194155307 X:90380584-90380606 CATATTATGCAGATGTAAACAGG + Intergenic
1194269620 X:91794968-91794990 CATCTTATATAGATGGCAGCAGG - Intronic
1194283460 X:91981725-91981747 CACCTTATGTGGATGGCAGCAGG + Intronic
1194320477 X:92440594-92440616 CATCTTACGTGGATGGCAGCAGG - Intronic
1194320737 X:92442510-92442532 CATCTTACGTGGATGGCAGCAGG - Intronic
1194320994 X:92446544-92446566 CATCTTATAGGGATGGCAGCAGG - Intronic
1194501633 X:94689394-94689416 CATCTTATGTGGATGGCACCAGG - Intergenic
1194518970 X:94894906-94894928 CATTTTACTTGGATGGCAGCAGG - Intergenic
1194578329 X:95641023-95641045 CATCTTACGTGGATGGCAGCAGG + Intergenic
1195403186 X:104483944-104483966 CACTTTATGGGGATGGCAGCAGG - Intergenic
1195545095 X:106105179-106105201 CATCTTACGTGGATGGCAGCAGG - Intergenic
1195545380 X:106107110-106107132 CATCTTACGTGGATGGCAGCAGG - Intergenic
1195560506 X:106277217-106277239 TATTTTACGTGGATGGCAGCAGG + Intergenic
1195561456 X:106289122-106289144 TATTTTACGTGGATGGCAGCAGG - Intergenic
1195735507 X:108008745-108008767 CATCTTACGTGGATGGCAGCAGG + Intergenic
1196125334 X:112092793-112092815 CATCTTATGTGGATGGCAGTAGG - Intergenic
1196170654 X:112584673-112584695 CATCTTGTGTGGATGGCAGCAGG + Intergenic
1196230503 X:113216024-113216046 CATTTTATGAAGATAACAGTGGG + Intergenic
1196567803 X:117229530-117229552 CATCTTACGTGGATGGCAGCAGG + Intergenic
1196567995 X:117230894-117230916 CATCTTACGTGGATGGCAGCAGG + Intergenic
1196579264 X:117360535-117360557 CATCTTATATGGATGGCAGCAGG - Intergenic
1196579533 X:117362449-117362471 CATCTTATGTGGATGGCAACAGG - Intergenic
1196782163 X:119393285-119393307 CTTCTTACACAGATGGCAGCAGG + Intergenic
1197054418 X:122098900-122098922 CATCTTATACGGATGGCAGCAGG - Intergenic
1197103820 X:122689226-122689248 CATCTTACGTAGATGGCAGCAGG - Intergenic
1197202220 X:123758129-123758151 CATCTTACGTGGATGGCAGCAGG - Intergenic
1197301537 X:124787985-124788007 CATCTTATGTGGATGGCAGCAGG + Intronic
1197387592 X:125820613-125820635 CATCTTACATAGATGGCAGCAGG + Intergenic
1197561110 X:128023751-128023773 CATCTTATGTGTATGGCAGCAGG + Intergenic
1197561365 X:128025690-128025712 CATCTTACGTGGATGGCAGCAGG + Intergenic
1197579592 X:128264586-128264608 CATCTTATGTGAATGGCAGCAGG - Intergenic
1197610770 X:128635726-128635748 CTTATTATGTGGATGGCAGCAGG + Intergenic
1197637448 X:128930948-128930970 CATCTTACACGGATGGCAGCAGG - Intergenic
1197975535 X:132162412-132162434 CGTCTTATGTGGATGGCAGCAGG - Intergenic
1198116361 X:133548854-133548876 CATCTTATGTGGATGGCGGCAGG - Intronic
1198888050 X:141361262-141361284 CATCTTATGTGGATGGCGGCAGG + Intergenic
1199309910 X:146310544-146310566 CATCTTACATAGATGGCAGCAGG + Intergenic
1200586842 Y:5015949-5015971 CATCTTATATAGATGGCAGCAGG - Intronic
1200601036 Y:5206288-5206310 CACCTTATGTGGATGGCAGCAGG + Intronic
1200628591 Y:5553724-5553746 CATCTTACGTGGATGGCAGCAGG - Intronic
1200974051 Y:9188487-9188509 CATCTTACACAGATGGCAGCAGG - Intergenic
1201160390 Y:11160672-11160694 CAGTTTCCCCAGATGGCAGCAGG + Intergenic
1201344551 Y:12968187-12968209 CATTTTACGTGGATGGCAGCAGG + Intergenic
1201467013 Y:14293506-14293528 CATCTTATGTGGATGGCAGAAGG + Intergenic
1201959241 Y:19660526-19660548 CATCTTATGTGGAAGGCAGCAGG + Intergenic