ID: 918127634

View in Genome Browser
Species Human (GRCh38)
Location 1:181598225-181598247
Sequence CCGTGTTAGGCATTGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918127627_918127634 -9 Left 918127627 1:181598211-181598233 CCGATTACCAGGGCCCGTGTTAG 0: 1
1: 0
2: 0
3: 1
4: 65
Right 918127634 1:181598225-181598247 CCGTGTTAGGCATTGGATGGTGG 0: 1
1: 0
2: 0
3: 3
4: 76
918127623_918127634 10 Left 918127623 1:181598192-181598214 CCAAACATTGGAGTGCCGACCGA 0: 1
1: 0
2: 0
3: 0
4: 7
Right 918127634 1:181598225-181598247 CCGTGTTAGGCATTGGATGGTGG 0: 1
1: 0
2: 0
3: 3
4: 76
918127626_918127634 -5 Left 918127626 1:181598207-181598229 CCGACCGATTACCAGGGCCCGTG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 918127634 1:181598225-181598247 CCGTGTTAGGCATTGGATGGTGG 0: 1
1: 0
2: 0
3: 3
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918127634 Original CRISPR CCGTGTTAGGCATTGGATGG TGG Intronic
903939919 1:26922340-26922362 TCTTGTTAGGCCTTGAATGGGGG + Intronic
907288639 1:53398200-53398222 CATAGTTAGGCAGTGGATGGGGG - Intergenic
913214204 1:116606822-116606844 CCATGCTAGGCATTGCAGGGCGG + Intronic
914459474 1:147869741-147869763 CCCTGTGGGTCATTGGATGGAGG - Intergenic
916721483 1:167487536-167487558 GCGGTTTAAGCATTGGATGGAGG - Intronic
918127634 1:181598225-181598247 CCGTGTTAGGCATTGGATGGTGG + Intronic
923334085 1:232951741-232951763 TTTTGTCAGGCATTGGATGGGGG + Intronic
1066210652 10:33234156-33234178 ACGTGTTAGGCATTTTATGAAGG + Intronic
1074272570 10:111969530-111969552 CTGTGTTAGGCACTGAATTGAGG - Intergenic
1076983922 11:222174-222196 CCATGCTAGGCCTAGGATGGAGG - Intronic
1078871340 11:15348022-15348044 CTGTGTTAGGAATTGGAAGCAGG + Intergenic
1081347764 11:42011349-42011371 CTGTGTTAGACATTGGATCATGG - Intergenic
1083054494 11:59806819-59806841 CACTTTTAGGCATTGGGTGGTGG - Exonic
1089622155 11:119728424-119728446 CCCGGGGAGGCATTGGATGGGGG + Intronic
1092910344 12:13140328-13140350 CCGGGTGAGGGATTGGATGTAGG - Intronic
1096496370 12:52041642-52041664 CCGGGTTAGGCATTGGAGCCTGG - Intronic
1105217420 13:18297375-18297397 CCATGCTAGGCATTGCAGGGTGG + Intergenic
1112585640 13:100716303-100716325 CAGTGTCAGGCAGTGGCTGGGGG + Intergenic
1118303232 14:64633528-64633550 CAGTGGCAGGCATAGGATGGTGG - Intergenic
1121067941 14:90986760-90986782 CTGTGTTAGTCATTGGCTGCAGG - Intronic
1122605958 14:102947903-102947925 CCGTGTTCTGCAGTGGAGGGCGG + Intronic
1123114056 14:105885929-105885951 CCGTGTTAGGATTTTGATCGAGG - Intergenic
1125433179 15:39618477-39618499 CCCAGTAAGGAATTGGATGGTGG - Intronic
1139838569 16:69859970-69859992 AGGTTTTAGGCATTGGAGGGGGG + Intronic
1144380624 17:14694049-14694071 CCATATTATGCATTGGTTGGAGG + Intergenic
1146258920 17:31409092-31409114 CCGTGTGTGGTCTTGGATGGTGG + Intronic
1146943037 17:36857049-36857071 GCATGTTAAGCAGTGGATGGTGG - Intergenic
1150795253 17:68231586-68231608 GTGTGTTAGGCAGTGCATGGTGG + Intergenic
1152007693 17:77692901-77692923 CCCTGTTGGGCATCGGGTGGCGG - Intergenic
1152648226 17:81480117-81480139 CCGTGTGAGGCCTGAGATGGGGG - Intergenic
1157987722 18:52458568-52458590 CCTTGTTAGGAGTAGGATGGGGG - Intronic
1164452032 19:28374664-28374686 CTGTGGTAGGCTTTGGATGATGG - Intergenic
930731718 2:54734415-54734437 CAGTGCTAGGCAATGGCTGGTGG + Intronic
934296900 2:91749308-91749330 CCATGCTAGGCATTGCAGGGCGG - Intergenic
934473804 2:94579182-94579204 CTGTGTTGGGCATTGGAGAGGGG - Intergenic
936538367 2:113329829-113329851 CTGTGTCAGGCATTGGGTAGTGG + Intergenic
936635422 2:114250731-114250753 CTGTGTTAAGCATTGGATTTTGG + Intergenic
942327801 2:174790415-174790437 CCGTGTTCAGCATGGTATGGTGG - Intergenic
944181831 2:196904188-196904210 CAGAGTTAGCCACTGGATGGTGG + Intronic
945515217 2:210755364-210755386 CCCTGTGAGGCCTTGGAGGGAGG - Intergenic
1170945151 20:20884893-20884915 CCCTCTTAAGCATTGGATGGTGG - Intergenic
1172800379 20:37572121-37572143 CTCTGTTAGTCATTGGCTGGGGG + Intergenic
1173309846 20:41887746-41887768 CCTTGTTGGGCATTGGCTGGAGG + Intergenic
1173438932 20:43057918-43057940 CTGGGTTAGGCATTGAGTGGGGG - Intronic
1181784010 22:25212783-25212805 TCCTGTTAGTCATTGGATGAAGG - Intergenic
1184341409 22:43888014-43888036 CCTTGTAGGGCAGTGGATGGGGG + Intronic
956259110 3:67317462-67317484 CTGTGTTTGGCATTGGTTGTGGG + Intergenic
958538410 3:95434175-95434197 CCGTGTTAGGTATTCGATGTTGG + Intergenic
958628642 3:96658897-96658919 CCTTATTAAGCATTGGGTGGAGG + Intergenic
978037498 4:104013797-104013819 TGGTGTTGGGCATTGGATGCTGG - Intergenic
988578571 5:32449162-32449184 GGTTGTTAGGCATTGGAAGGAGG - Intergenic
998874527 5:146586112-146586134 CCTGGTTAGTCTTTGGATGGGGG - Intronic
1000091442 5:157932866-157932888 CCTTGTTGGGCAATTGATGGGGG - Intergenic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1008610311 6:53179483-53179505 GAGTGTGAGGCATTGGGTGGTGG - Intergenic
1016453864 6:144211202-144211224 CAGTTTTAGGCATTTGCTGGGGG - Intergenic
1020356253 7:7278894-7278916 CCATGTTAGGCTCAGGATGGGGG - Intergenic
1022043407 7:26602428-26602450 CAGTGCCAGGCATAGGATGGGGG + Intergenic
1032153879 7:129452766-129452788 TCCTGTTAGTCATTGGATGAGGG - Intronic
1037466759 8:19168540-19168562 CCGTGCTACACATTGCATGGAGG + Intergenic
1037748995 8:21667783-21667805 CTGTGGTAGGTATTGGGTGGAGG - Intergenic
1043228311 8:77763780-77763802 GTGTGTTAGGCAGTGCATGGTGG + Intergenic
1053684525 9:40509327-40509349 CTGTGTTGGGCATTGGAGAGGGG + Intergenic
1053934495 9:43137614-43137636 CTGTGTTGGGCATTGGAGAGGGG + Intergenic
1054279200 9:63115625-63115647 CTGTGTTGGGCATTGGAGAGGGG - Intergenic
1054297622 9:63344794-63344816 CTGTGTTGGGCATTGGAGAGGGG + Intergenic
1054395636 9:64649300-64649322 CTGTGTTGGGCATTGGAGAGGGG + Intergenic
1054430280 9:65154500-65154522 CTGTGTTGGGCATTGGAGAGGGG + Intergenic
1054500100 9:65867032-65867054 CTGTGTTGGGCATTGGAGAGGGG - Intergenic
1057261323 9:93586444-93586466 CCCTGGTGGGCTTTGGATGGAGG + Intronic
1057866796 9:98687792-98687814 CTGTGTTGGGCATTGGTAGGTGG - Intronic
1062379606 9:136280854-136280876 CAGGGTTAGGGGTTGGATGGGGG + Intergenic
1187282639 X:17870707-17870729 CAGTGGTAGGGATGGGATGGAGG - Intergenic
1187685724 X:21813885-21813907 CCCTGTTAGGCTTTGTCTGGAGG - Intergenic
1198045288 X:132895582-132895604 GCGTGTCAGGCATTAGATGAGGG + Intronic
1198535645 X:137583336-137583358 ACGTGTTAGGCAGGGCATGGTGG + Intergenic
1200039222 X:153353716-153353738 CCGGGGCAGGCATTGGCTGGGGG - Intronic
1200962196 Y:9005939-9005961 CCCTGCTAGGCATAGGATGATGG + Intergenic
1200981706 Y:9268563-9268585 CCCTGCTAGGCATAGGATGATGG - Intergenic
1202128710 Y:21591161-21591183 CCCTGCTAGGCATAGGATGATGG + Intergenic