ID: 918128577

View in Genome Browser
Species Human (GRCh38)
Location 1:181605399-181605421
Sequence TGCCAGTGCTGCCTTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 326}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918128577_918128580 -10 Left 918128577 1:181605399-181605421 CCATGCCCAAGGCAGCACTGGCA 0: 1
1: 0
2: 3
3: 38
4: 326
Right 918128580 1:181605412-181605434 AGCACTGGCAGCTCAAGCTCAGG 0: 1
1: 0
2: 1
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918128577 Original CRISPR TGCCAGTGCTGCCTTGGGCA TGG (reversed) Intronic
900098750 1:952007-952029 AGCCAATGATGACTTGGGCAAGG + Exonic
900550013 1:3250020-3250042 GCCCAGCGCTGCCTTGGGAAGGG - Intronic
900561581 1:3309750-3309772 GGCCAGGGCTGCCCTGGGCTAGG + Intronic
901083648 1:6597675-6597697 TGCCAGAGCTGCCCTGGCCTTGG - Intronic
901471532 1:9460025-9460047 TGCCACTGCTGCTTTGAGGATGG - Intergenic
901507438 1:9694026-9694048 TGCCTCTGCTGCCCTGGGCTGGG - Intronic
901627620 1:10632819-10632841 CGCTGGTTCTGCCTTGGGCAGGG + Intergenic
901645384 1:10714374-10714396 TAGCTGTGCTGCCTCGGGCAGGG - Intronic
901835914 1:11924031-11924053 TGCCAGGGCTGTTTTAGGCATGG - Intronic
902122270 1:14176437-14176459 TGCCACAGCTGCCCAGGGCAGGG + Intergenic
902664997 1:17931241-17931263 TGCAAGTCCTTCCTGGGGCATGG + Intergenic
904314839 1:29653440-29653462 GGGCAGAGCTGCCTTGAGCAGGG - Intergenic
904708059 1:32406749-32406771 TGCCAGGACGGCCTTGGACAGGG + Intergenic
906573197 1:46862406-46862428 TGCCAGTGATGGACTGGGCAGGG - Intergenic
906708319 1:47910960-47910982 GGCCATTCCAGCCTTGGGCAAGG - Intronic
908567419 1:65371631-65371653 TGCCCATCCTGTCTTGGGCAAGG + Intronic
911182068 1:94870072-94870094 TGCCTGTGCAGCCTTAGGCTGGG - Intronic
911880269 1:103228828-103228850 TGTCAGTGCTGCCTTTGATAAGG - Intergenic
912586184 1:110768127-110768149 TGCCACTGCTGCCTCCAGCATGG - Intergenic
913219657 1:116649198-116649220 TGCCACAGCAGCCTTGGGCTAGG - Intronic
914490394 1:148147526-148147548 GGCCAGTGCTGCTTTGGACGAGG + Intronic
915366944 1:155321984-155322006 TGCCGGTGCTGCCAGGAGCACGG + Exonic
915561748 1:156691971-156691993 GGCCAGTGCTGCAGTGGGCCGGG + Intergenic
916127198 1:161581919-161581941 GGCCAGTGCTGCCTTGGGTAAGG + Intronic
916137118 1:161663723-161663745 GGCCAGTGCTGCCTTGGGTAAGG + Intronic
916852022 1:168713495-168713517 AGGCATTTCTGCCTTGGGCAAGG - Intronic
918128577 1:181605399-181605421 TGCCAGTGCTGCCTTGGGCATGG - Intronic
919895438 1:202007081-202007103 GCCCAGTGAAGCCTTGGGCATGG - Intergenic
920734478 1:208518397-208518419 TGCCAGTCCTGAGTTGGGGAAGG + Intergenic
922566272 1:226603750-226603772 TTCCATTGCTGCCTGGGGCTGGG + Exonic
922574442 1:226652678-226652700 GGCCAGCTCTGCCCTGGGCAGGG - Intronic
923007080 1:230058525-230058547 TCGCTGAGCTGCCTTGGGCAAGG + Intronic
923016001 1:230127109-230127131 TCCCATTGCTGCCTGAGGCAGGG + Intronic
924314303 1:242779950-242779972 AAACAGTGCTGCTTTGGGCAAGG + Intergenic
924804930 1:247354544-247354566 TGTAAGTACTGCCTTGGTCATGG + Intergenic
924851292 1:247833789-247833811 TGGCAGTCCTGCCTTGAGGATGG + Intergenic
1066315526 10:34242316-34242338 TAGGAGTGCTGCCTTGGACAAGG - Intronic
1068157767 10:53223159-53223181 TGTCAGTGCTGCCCTGAGCATGG + Intergenic
1069828365 10:71268040-71268062 CCCCAGTCCTGCCTTGGGAATGG + Intronic
1069840761 10:71338010-71338032 AGCCACTGCTGGCCTGGGCAGGG - Intronic
1069908820 10:71747775-71747797 AGCCATGTCTGCCTTGGGCACGG - Exonic
1070092019 10:73296289-73296311 GAACAGTCCTGCCTTGGGCATGG - Intronic
1070322068 10:75362018-75362040 AGCCACTGCAGCCTTGGGAAGGG - Intergenic
1070780799 10:79136369-79136391 CCCCAGCCCTGCCTTGGGCAGGG + Intronic
1071512843 10:86275419-86275441 TGCCTGGGCTTCCTTAGGCATGG - Intronic
1072291160 10:93966175-93966197 TTCCAGTGCTGCCAAGGTCATGG - Intergenic
1074206774 10:111289591-111289613 TGCCAGTCCGGCCTTGTGCTTGG + Intergenic
1074275301 10:111996007-111996029 TGGCAGAGCTGGCTTGTGCAAGG + Intergenic
1075604762 10:123796724-123796746 TTCCAGCACTGCCTGGGGCAGGG - Intronic
1076067541 10:127460695-127460717 TGGCAGTCCTCCCTTGGGGAGGG - Intergenic
1076481149 10:130786030-130786052 TGGCTGTCCTGCCTTAGGCACGG - Intergenic
1077074221 11:692985-693007 TCCCAGGGCTGCCATGGGCCTGG - Intronic
1077249670 11:1555460-1555482 TCCAAGTTCTGCCTGGGGCATGG + Exonic
1077420829 11:2449109-2449131 TGGCTGGGCTGCCTTGGCCAGGG + Intronic
1078354838 11:10625863-10625885 GGCCAGAGCTGCCCTGGCCAGGG + Intronic
1079699093 11:23520909-23520931 TGCCAGTGCTGCTGGGTGCAGGG - Intergenic
1082788160 11:57328724-57328746 TGCCAGTGGTGTCCTGGGGATGG - Intronic
1083713996 11:64565355-64565377 TCCCAGCCCTGCCTTGGGGAGGG - Intronic
1083716930 11:64582892-64582914 TGCCAGTCCTGTGCTGGGCACGG + Intergenic
1083945536 11:65920713-65920735 TGCCAGTTCAGCCTGGGGCGAGG - Intronic
1084482076 11:69427781-69427803 TCACAGTGCTACCTGGGGCAAGG + Intergenic
1085058633 11:73424419-73424441 TTCCCGTGGTGCCTTGGGCCTGG + Intronic
1085388830 11:76171974-76171996 TTCCACACCTGCCTTGGGCATGG - Intergenic
1087658011 11:100949686-100949708 TGGCTGTGCTGCCCTGGACAAGG - Intronic
1089293977 11:117457214-117457236 GGGCAGTGCTGCTTTGGGCCCGG + Intronic
1089586189 11:119511420-119511442 TGCCAGTCTTGCCTTGGGGTTGG - Intergenic
1089754897 11:120679466-120679488 TGCCAGTGGTCCCTGGAGCATGG + Intronic
1090603319 11:128394916-128394938 TGCCAGTGCGGCCTTGAAAAAGG + Intergenic
1091841940 12:3627726-3627748 TGTCAGGGCTGCCCTGGGCCAGG + Intronic
1094717469 12:33027444-33027466 TGCCATTGCTGCCTTCTGCAAGG - Intergenic
1095298075 12:40549885-40549907 TGCCAGTGGTGCCTAAAGCAGGG - Exonic
1095413806 12:41953440-41953462 TGGAATTGCTGCCTTGGGGAGGG + Intergenic
1095709056 12:45268886-45268908 TGCATGTGCTGCCCTGAGCACGG - Intronic
1096002319 12:48140135-48140157 TGCCAGTCCTGAAGTGGGCATGG - Intronic
1096110006 12:49023001-49023023 TGGAAGTGCAGCCTTGGGAAAGG + Intronic
1096264074 12:50110151-50110173 TGCCAGGGCAGCCTGGGGGAGGG - Exonic
1096574312 12:52543255-52543277 GGCCAGTCCTGCCTTGGTAAGGG - Intergenic
1097376271 12:58846625-58846647 TGCCACTGCTTCCTGGGGAAGGG + Intergenic
1099243777 12:80170156-80170178 TGCCAGTGCTCACTTTGTCAGGG + Intergenic
1099686045 12:85890843-85890865 TGCCAGTGCCTACGTGGGCAAGG - Intergenic
1101038744 12:100732752-100732774 TGTCAGTGTGACCTTGGGCACGG + Intronic
1102039387 12:109791041-109791063 TGGCTGTGCTGCCCTGGGCCAGG - Intronic
1104414887 12:128589779-128589801 CAGCAGTGCAGCCTTGGGCAAGG + Intronic
1104910896 12:132240516-132240538 TGGCAGTGCTGCTGTGGGCCTGG + Intronic
1105639490 13:22247737-22247759 TGCGAGTGCTGTCATGGGCTAGG - Intergenic
1107635780 13:42390816-42390838 TCCCAGAGCTGCCTTAGGTAAGG + Intergenic
1107720143 13:43239635-43239657 TGCTAAGCCTGCCTTGGGCATGG + Intronic
1109092637 13:58068572-58068594 TGCCAGTGCTGCAGTGGTCTAGG - Intergenic
1110436407 13:75481922-75481944 TGGAAGTGCTGCATGGGGCAGGG - Exonic
1113444885 13:110357523-110357545 TGCCAGTGCTACCCTGAGAAAGG + Exonic
1113460681 13:110479893-110479915 TGCCAGCTCTGGCTGGGGCATGG - Intronic
1113891312 13:113737021-113737043 AGTCAGTGCTGCAGTGGGCAGGG + Exonic
1115642939 14:35346940-35346962 TGGCTGTGTGGCCTTGGGCAGGG + Intergenic
1116761589 14:49021963-49021985 TGCCATTGCTGTCTTGGGGTCGG - Intergenic
1118887143 14:69877085-69877107 TGTCAGTGCTGCACAGGGCACGG + Intronic
1122084617 14:99290930-99290952 GGCCAGTGGTGACTTTGGCAAGG - Intergenic
1122912178 14:104836266-104836288 TGCCAGTGCCCCCGTGTGCAGGG + Intergenic
1122978844 14:105181998-105182020 CTTCAGTGCTTCCTTGGGCATGG + Intergenic
1124222590 15:27863188-27863210 GGGCAGAGCTGCCTGGGGCATGG + Intronic
1125931788 15:43605285-43605307 TGCCAGGGCTGCCTGGTGGAGGG + Exonic
1125944888 15:43704763-43704785 TGCCAGGGCTGCCTGGTGGAGGG + Intergenic
1126144837 15:45464637-45464659 TGCAAGTCCTGCCTTGGGAGAGG + Intergenic
1128231544 15:66038957-66038979 TGCCAGTGCAGTCTAGGGAATGG + Intronic
1128757018 15:70190074-70190096 TGCCAGGGCTGCACTGGGCTCGG - Intergenic
1128792039 15:70440705-70440727 TATCAGGCCTGCCTTGGGCATGG + Intergenic
1129208785 15:74053452-74053474 TGCCACTGCTGGCTGGGGCGGGG - Intergenic
1129832889 15:78682102-78682124 CCCCAGGGCTGCCTTGTGCAGGG + Intronic
1129878667 15:78993430-78993452 TGGCAGAGCTGCCCTGGGCAGGG + Intronic
1130775044 15:86970142-86970164 TTCCAATGCTGCCTTGGCCTGGG - Intronic
1131475353 15:92734030-92734052 TGCCACTGCTGCCGTGCACAGGG - Intronic
1131693188 15:94847878-94847900 AGCCAGTGATGGCTTGGGCCAGG + Intergenic
1132626730 16:894933-894955 TGACAGGGCTGTCCTGGGCAGGG + Intronic
1132883823 16:2173699-2173721 TGCCCCTGCTGCCCTGGGCCAGG - Intronic
1132903382 16:2270205-2270227 TGTCAGTGGGGCCCTGGGCATGG - Intergenic
1132945196 16:2528471-2528493 TGCCATCCCTGCCTTGGGCCTGG + Exonic
1133728302 16:8557268-8557290 GGCTAGTGCTCCCATGGGCAAGG - Intergenic
1133850838 16:9501796-9501818 TGCCAGTCCTGCCTGAGTCAGGG - Intergenic
1135091202 16:19519289-19519311 TTCCAGTCCTGCCTTGGGGTAGG + Intronic
1136271579 16:29151955-29151977 TGCCAGGGCCGCACTGGGCAGGG + Intergenic
1137797845 16:51237250-51237272 TGCCAGCCCTGCCTTGGAGAAGG - Intergenic
1138127634 16:54452078-54452100 TTGCAGAGCTGCCTAGGGCAGGG - Intergenic
1138505993 16:57478536-57478558 TGCCAGACCTGTCTTTGGCAGGG + Intronic
1140639460 16:76955407-76955429 TGCCAGTCATGCCATGGGAATGG + Intergenic
1141715608 16:85725108-85725130 TGCCCGCTCTGCCCTGGGCAGGG + Intronic
1141982934 16:87561085-87561107 AGCCAGTTGTCCCTTGGGCAGGG + Intergenic
1142060875 16:88028301-88028323 TGCGAGGGCAGCCGTGGGCAGGG + Intronic
1142075194 16:88113939-88113961 TGCCAGGGCCGCACTGGGCAGGG + Intronic
1143296907 17:5877963-5877985 GGCCAGTGCTTCCTTTGACAGGG - Intronic
1143750347 17:9022538-9022560 TGTCAATGCGGCCTTCGGCAAGG + Exonic
1144637550 17:16919977-16919999 TCCCAGTGCTGCCTTGAGCCTGG + Intergenic
1144696421 17:17306752-17306774 GGCAAGTGCAGCCTTGCGCAGGG - Intronic
1145190987 17:20842129-20842151 GGCCAGTGCTGCTTTGGACGAGG + Intronic
1145210857 17:21012002-21012024 GGCCAGTGCTGCCTGTGTCACGG - Intronic
1145750867 17:27354110-27354132 GGGCTGTGCTGCCTTGGTCAAGG - Intergenic
1146233022 17:31130673-31130695 TGCCAGTGCTCCCTTGACAATGG + Intronic
1148978166 17:51547682-51547704 TGCCTGTGCTCCCTTGGAGATGG - Intergenic
1150211113 17:63441998-63442020 TGCCTGGGCTGCCTAGGCCAGGG - Intronic
1151321321 17:73354377-73354399 TGCGGGTGCTGCCTGGGTCAGGG + Intronic
1151626188 17:75277352-75277374 TGCCAGAGCTGCCTTTGGCCAGG - Exonic
1151675547 17:75595638-75595660 GGCCGGTCCTGCCTTTGGCATGG + Intergenic
1152075175 17:78154928-78154950 TGTCTGTGCAGCCCTGGGCAGGG + Intronic
1155309380 18:24509266-24509288 TTGCAGGGCTGCCCTGGGCAGGG - Intergenic
1155921968 18:31612192-31612214 TGCCAGGGCTGCCTTTGCCCGGG - Intergenic
1156472416 18:37385637-37385659 TGCAAACCCTGCCTTGGGCATGG + Intronic
1156687413 18:39666680-39666702 TGCCAGTGCCACCCTGGGCCTGG + Intergenic
1158741930 18:60153000-60153022 AGCCAGTGCTGCCTTGCTCTCGG + Intergenic
1159019649 18:63132921-63132943 TGCCAGTCCTGACATGAGCAAGG - Intronic
1160527019 18:79544167-79544189 AGCCAGTGCTGTCTTGGGAAGGG - Intergenic
1160559863 18:79749433-79749455 GGCCAGGGCTCCCTTGAGCAAGG + Intronic
1160995215 19:1879294-1879316 GGCCAGTGCTGCTTTGGACGAGG - Intronic
1161882816 19:6968762-6968784 TTCCACTGCTGCCTTGAGCAGGG + Intergenic
1163495907 19:17646565-17646587 TGCCCCAGCTGCCTTGCGCATGG + Intronic
1163546146 19:17942492-17942514 TCCCGGTGCTGCCCTGGGCGGGG - Intronic
1163790923 19:19305754-19305776 GGCAAGTGCTGCCAGGGGCATGG - Intronic
1164726200 19:30467601-30467623 TGCCACTCCTGTCTTGTGCAGGG - Intronic
1166552443 19:43675181-43675203 GGCGAGGGCAGCCTTGGGCAGGG - Intergenic
1166778662 19:45328158-45328180 GGGCAGGGCTGCCTTGGGAATGG - Intergenic
1167336936 19:48892258-48892280 TGCCCAGGCTTCCTTGGGCAGGG + Intronic
1167721490 19:51183051-51183073 TGCCAGGGCCGCCTTGAGAAAGG + Intergenic
1167763487 19:51463719-51463741 TGCCAGGGCCGCCTTGAGAAAGG - Intergenic
1168069318 19:53941129-53941151 TGCCAAACCTGCCTGGGGCAGGG - Intronic
1168123878 19:54272132-54272154 GGCCAGTGGTGCCTGGGTCATGG + Intronic
1168178481 19:54643403-54643425 GGCCAGTGGTGCCTGGGTCATGG - Intronic
925023253 2:588146-588168 GGGCTGTGCTGCCTGGGGCAGGG + Intergenic
925116384 2:1382017-1382039 TGCCAGTGCCTCCTTGGGATTGG - Intronic
925284289 2:2705792-2705814 TGCCAGTGGTGCCCTGCCCAGGG + Intergenic
925596831 2:5563595-5563617 TGGCAGTGCGGCCCTGGGCTGGG + Intergenic
925858230 2:8150880-8150902 TGCCAGTGCTGGCTTTTGCCCGG - Intergenic
926062324 2:9812287-9812309 TCCCAGTGCTGCCCTGGAGAAGG + Intergenic
926113610 2:10197452-10197474 TCCCAGTGCTGCCTGGGGCAGGG - Intronic
927911335 2:26902016-26902038 TGGGGGTGCTGCCTGGGGCAGGG - Intronic
927915449 2:26933170-26933192 TGCCAGGGCTGACTTTGCCAGGG + Intronic
928789792 2:34936276-34936298 TCCCTGTGCTGCCTCTGGCATGG - Intergenic
929549412 2:42880009-42880031 TTCCTGTGCAACCTTGGGCAGGG - Intergenic
930105111 2:47633163-47633185 TGCCCAGGCTGCCCTGGGCAAGG - Intergenic
931431051 2:62209301-62209323 CCCCAGGGCAGCCTTGGGCAAGG + Intronic
932619648 2:73258126-73258148 TGACAGGGCTGCCTGGGGCTGGG + Exonic
935382813 2:102470206-102470228 AGCCAGTGAAGCCTGGGGCATGG + Intergenic
935393924 2:102585776-102585798 TTGCAGGGCTGCCTTGTGCATGG - Intergenic
935427437 2:102934756-102934778 AGCCATTGCTGCCTGGGGCATGG + Intergenic
937181260 2:119997772-119997794 TGCCACTGCTGGCTGGGGGAGGG - Intergenic
937485417 2:122310219-122310241 TCCCAGGGCTGCCGTGTGCATGG + Intergenic
937763651 2:125634606-125634628 TGGCTGTGTTGCCTTGGGCATGG + Intergenic
938407166 2:131039101-131039123 TGCCAGAGCTGTTTTGGGCTTGG - Intronic
939637074 2:144595160-144595182 TGCCAGTGGTGCCAAGGTCAAGG + Intergenic
941353739 2:164463944-164463966 TGTCAGTGAAGCCCTGGGCAAGG - Intergenic
941945063 2:171086989-171087011 TGTCAGTGCTGCCCTCTGCAGGG + Intronic
942057478 2:172198142-172198164 GACCAGTGCTGCCTGGGGCTGGG + Intergenic
942245437 2:174003768-174003790 AGCCAGTGCTGCATGTGGCAGGG - Intergenic
942337670 2:174907356-174907378 TGGCAGTGCTGTCTCTGGCATGG - Intronic
942348682 2:175030365-175030387 TGGCAGTGATGCTATGGGCAAGG - Intergenic
944542299 2:200765818-200765840 TGGAAGAGCTGCCTGGGGCAAGG + Intergenic
944551604 2:200849604-200849626 TGGAAGAGCTGCCTAGGGCAAGG + Intergenic
945201214 2:207283534-207283556 CAGCAGTGCAGCCTTGGGCAGGG - Intergenic
947061982 2:226177291-226177313 AGACAGTGCTGCCGTGAGCATGG - Intergenic
947838535 2:233192067-233192089 TGCCAGTGCTGCACTGGGAACGG - Intronic
947979928 2:234399915-234399937 TGCCAGCTCTGCCTTAAGCAGGG - Intergenic
948002258 2:234577834-234577856 TACCAGTGCTGCCGTGGGCCAGG + Intergenic
948247113 2:236495876-236495898 TGCCATTGTTGCCGTGGGGATGG - Intronic
949028062 2:241775489-241775511 AGCCTGTGGTGCCCTGGGCAGGG + Intergenic
1169146488 20:3255866-3255888 TGCAAGTGCTGGCTGGGCCAGGG + Intronic
1169227546 20:3865850-3865872 TGCCAGCACCTCCTTGGGCATGG + Exonic
1170128206 20:12989026-12989048 GGCCACTACTGCCTTGGGCCTGG - Intergenic
1170166433 20:13364456-13364478 TGCCACTCCTGCCATGGCCATGG - Intergenic
1170500944 20:16974855-16974877 TGTCAGCGCTGCCATGAGCATGG - Intergenic
1173301754 20:41809678-41809700 TGCCAGGGGTGCCTTCTGCATGG - Intergenic
1173847640 20:46198122-46198144 TGGCAGTGTTGCTCTGGGCATGG + Intronic
1175446181 20:59021420-59021442 TGACAGTGCTGCTCTGGCCATGG - Intronic
1175625432 20:60485052-60485074 TGGAAGTGCTGGCTGGGGCAAGG - Intergenic
1179921856 21:44511935-44511957 TTCCAGGGCTCCTTTGGGCAGGG - Intronic
1180592844 22:16955677-16955699 TGCCTGTTCTGCCTTCGGCCTGG + Intergenic
1180595381 22:16969740-16969762 TGCCTGACTTGCCTTGGGCAGGG + Intronic
1180783662 22:18535344-18535366 TGTCAGGGCTGCCATGGGCAGGG + Intergenic
1180820949 22:18827256-18827278 TGCCACAGCAGCCTTGGGCTAGG - Intergenic
1180956899 22:19745273-19745295 GGCCAGGGCTGCCTCGAGCAGGG + Intergenic
1181121288 22:20669834-20669856 GGCCAGTGCTGCTTTGGACGAGG - Intergenic
1181127232 22:20709395-20709417 TGTCAGGGCTGCCATGGGCAGGG + Intronic
1181192028 22:21148789-21148811 TGCCACAGCAGCCTTGGGCTAGG + Intergenic
1181207169 22:21261721-21261743 TGCCACAGCAGCCTTGGGCTAGG - Intergenic
1181240565 22:21474696-21474718 TGTCAGGGCTGCCATGGGCAGGG + Intergenic
1181334244 22:22116859-22116881 GGCCAGTGCTGCTTTGGACGAGG - Intergenic
1181511886 22:23392985-23393007 GGACAGGGCTGCCTTGGGCAAGG - Intergenic
1181775116 22:25153829-25153851 AGCTTGTGCAGCCTTGGGCAGGG - Intronic
1181861608 22:25823457-25823479 TGGCAGTGAGGCCTTGGGCATGG - Intronic
1182002878 22:26935577-26935599 TGCCTGTGGTGCCAGGGGCAAGG + Intergenic
1182592685 22:31394200-31394222 TGCCACTGCTGGCTTGGGGGAGG - Intergenic
1182599021 22:31445207-31445229 TGCCTGTGCTTCACTGGGCAGGG + Intronic
1183253395 22:36745648-36745670 TGCCAGTGCTGGGTGGAGCAGGG - Intergenic
1183326454 22:37197237-37197259 TGGGAATGCTGCCTGGGGCAGGG - Intronic
1183598997 22:38829241-38829263 TGCAATTGCTGTCTAGGGCAGGG + Intronic
1184262811 22:43329105-43329127 TGCCAGTGCTGTCCTGGGCCAGG + Intronic
1184728136 22:46357945-46357967 GGTCAGTGCTGCCCTGGCCAGGG + Intergenic
1184730339 22:46368146-46368168 AGCTAGTGCAGCCATGGGCATGG - Intronic
1184808984 22:46815961-46815983 TCCCACTGCAGCCTTGGGGAGGG + Intronic
1185288056 22:50011093-50011115 TGCCTGGGCAGCCTTGGACAGGG - Intronic
1203219751 22_KI270731v1_random:33695-33717 TGCCACAGCAGCCTTGGGCTAGG + Intergenic
1203271076 22_KI270734v1_random:53132-53154 TGCCACAGCAGCCTTGGGCTAGG - Intergenic
949535553 3:4993438-4993460 TGCCAGCTCAGCCCTGGGCAGGG + Intergenic
950044953 3:9943571-9943593 TGCCACTGCTACCTGGGGAAGGG - Intronic
950764682 3:15265091-15265113 TGCCAGTATTGCCATGGGCTCGG - Intronic
952191012 3:31023629-31023651 AGCCAGGGCTGCCTTGAGAATGG - Intergenic
953043769 3:39277680-39277702 TGCCATAGCTGCCTAGGGCCGGG + Intronic
953889146 3:46737465-46737487 AGCCAGTGCTGCCAAGGACACGG + Intronic
954412080 3:50375153-50375175 TGCCAGTGTTGCCGTGGGAGTGG + Intronic
955954858 3:64278338-64278360 TCCCAGTGCTGCTTTTTGCAGGG - Intronic
960134280 3:114089961-114089983 TGACAGTGCTGTGTAGGGCAGGG + Intergenic
960985829 3:123280065-123280087 TACCAGGGTGGCCTTGGGCAAGG + Intergenic
961383842 3:126513339-126513361 TGCTAGTGCAGCCTTCAGCAGGG + Intronic
961515210 3:127427949-127427971 TGCCCGTGCTGTTCTGGGCATGG - Intergenic
961651218 3:128417563-128417585 TGCCAGTGTTCCCATGGGAAGGG + Intergenic
961735581 3:129000748-129000770 TGCCGGTGCTGACTTGGCAATGG - Intronic
963110008 3:141680705-141680727 CACCAGTACTGCCATGGGCAAGG - Intergenic
964516495 3:157514774-157514796 TGTAAGTGCTTCCTTGTGCACGG + Intronic
966912193 3:184565877-184565899 TGCCGAAGCTGCCGTGGGCAAGG + Intronic
967204075 3:187103514-187103536 TACCAGTGGGGCCTGGGGCATGG - Intergenic
967504246 3:190235721-190235743 GGCCAGTGCTGTCTTATGCAGGG + Intergenic
968235572 3:197028759-197028781 TGGCAGTGCTGGCTGGGGCAGGG - Intronic
968274084 3:197426492-197426514 TGCCAGTTCTGCCTTAGGTGGGG - Intergenic
968315194 3:197718116-197718138 TGCCAGTGCTCCCTCCTGCAAGG + Exonic
968687323 4:1970071-1970093 TGCGAGTGACGCCTTGGGCAGGG + Intronic
968926021 4:3548932-3548954 TGCCAGGGCTGCGCTGAGCAGGG - Intergenic
969263387 4:6047594-6047616 TACCAGTGTGACCTTGGGCAAGG + Intronic
969299804 4:6291260-6291282 GACCAGGGCTGCCTTGCGCACGG - Exonic
969859620 4:10025327-10025349 GGCCAGTGATGCCTTCAGCATGG + Intronic
971298898 4:25425704-25425726 TGTGAGTGCAGCCATGGGCAAGG - Intergenic
972388688 4:38592292-38592314 TGCCAATGCTGGCTTAGGCAAGG - Intergenic
973978557 4:56286765-56286787 TCCCACTGCTGCCGTGGTCAGGG + Intronic
975717717 4:77221153-77221175 TGCCAGTGCTGTCTTGGGACTGG - Intronic
975817825 4:78237537-78237559 TGCCAGAGCTGCCGTTGCCATGG + Exonic
976053796 4:81039193-81039215 TGCCAGGGGTGCCTAGGACAGGG - Intronic
981316912 4:143349463-143349485 TGGCAGTGCAGCCCTGGGCTGGG + Intronic
982242577 4:153315095-153315117 GGTCTGTGCTGCCTTGGGCATGG - Intronic
983557114 4:169068609-169068631 TGGCAGTGCTGCTCTGGCCAAGG - Intergenic
983651812 4:170043237-170043259 TGCAAGTGCAGAGTTGGGCAAGG - Intergenic
985830513 5:2224833-2224855 AGCCAGTTCTCCCTTGGGCTGGG + Intergenic
985910150 5:2872952-2872974 TCCCAGTGCTGGCTTGAGCAAGG + Intergenic
986418158 5:7549288-7549310 TGGGAGTGCTGCCTTCGCCAGGG - Intronic
986631905 5:9782171-9782193 TGCCAGGCCTGCCCTGTGCATGG - Intergenic
987048542 5:14129790-14129812 TACCAGTGCAGCCTGGGGCAGGG - Intergenic
990866544 5:60386599-60386621 AGCCAGTGCAGCATTGGGCAGGG + Intronic
991599353 5:68337056-68337078 TGCCTGTGCTTCCTGGGGCAAGG - Intergenic
999303930 5:150507904-150507926 TGCCAGTGGTTCCCTGGGCACGG + Intronic
999359682 5:150972620-150972642 CGATAGTGCAGCCTTGGGCATGG - Intergenic
999743579 5:154575003-154575025 CCCCACTGCTGCCTTGGGGAGGG + Intergenic
1001029341 5:168250499-168250521 TTCCATTCCTGCCTTGGGGATGG - Intronic
1001052132 5:168422116-168422138 GGCCACTGCTCCCCTGGGCATGG + Intronic
1001675326 5:173507408-173507430 TGCCAATCCTCCCTTGGCCAAGG + Intergenic
1001835104 5:174825041-174825063 TGCCATTCCTGCCTTGGTTAAGG + Intergenic
1001955373 5:175845083-175845105 GGCAAGTGCTTCCATGGGCACGG - Intronic
1002193403 5:177490266-177490288 GGTCTGTGCTGCCTTGGGCATGG - Intronic
1002452414 5:179326428-179326450 GGCCGGTGATGCCTGGGGCAGGG + Intronic
1002588935 5:180274456-180274478 TGCCACTGCTGCCTTGAAGATGG + Intronic
1002626490 5:180533181-180533203 TTAGAGTCCTGCCTTGGGCAGGG + Intronic
1002879682 6:1239941-1239963 TGGCTGTGCAACCTTGGGCAAGG - Intergenic
1006417371 6:33912685-33912707 TGACAGGGCAGCCTTGGGCATGG - Intergenic
1006438131 6:34037127-34037149 TGGCAGAGGTGCCTTGGGCTGGG - Intronic
1006516379 6:34547947-34547969 GGCCTGGGCTGCCTTGGGGACGG - Intronic
1007605001 6:43111452-43111474 GGCCAGTGCTGGCTTAGGGATGG + Intronic
1007914517 6:45548836-45548858 TGCCAGTGGGGCCTTGGGTAAGG - Exonic
1011618104 6:89216515-89216537 TGCCAGTGCTGCCGTCAGAATGG + Intronic
1011936457 6:92784621-92784643 TGCTAGTGCTGGCTTTGGAAAGG - Intergenic
1012887397 6:104860997-104861019 TGCCAGTGGTGCCACAGGCACGG + Intergenic
1016185890 6:141197035-141197057 TGCCACTGCTGCCAGGGGTAGGG + Intergenic
1017777913 6:157694016-157694038 TGCCAGTGCTGCCCGAGGCCAGG - Intergenic
1017990417 6:159483176-159483198 TGCCAATGCTGGCCTGGGCCAGG - Intergenic
1018372369 6:163179889-163179911 TGCCTGTGTGGCCTCGGGCAAGG - Intronic
1018965636 6:168486608-168486630 AGCCAGTGCTGGCTTGGGGAAGG - Intronic
1019152661 6:170019163-170019185 TGCCTGTGCTGGCTTGGTCCTGG + Intergenic
1019695723 7:2445178-2445200 TCCCAGTGGTGCTTTGGGAAGGG + Intergenic
1019747626 7:2709482-2709504 GGCCTGTGCCGCCTGGGGCAGGG + Intronic
1020137833 7:5596422-5596444 GCCCAGAGCTGCCCTGGGCAGGG + Intronic
1020951177 7:14679610-14679632 TGCCAGTGCTGGCTTCAGAAAGG - Intronic
1021102946 7:16604801-16604823 GGCCAGTGATGGCTTGGGTAAGG + Exonic
1021937306 7:25643971-25643993 TGACAGAGCTGACTTGGGCCCGG - Intergenic
1024739659 7:52340242-52340264 TTCCAGGGCTGCCTGGGGAAAGG - Intergenic
1027265905 7:76495166-76495188 TCACACTGCTGCCTGGGGCAGGG + Intronic
1027317279 7:76993283-76993305 TCACACTGCTGCCTGGGGCAGGG + Intergenic
1029001468 7:97159439-97159461 AGTCAGTGCTGCCTGGGGCAAGG - Intronic
1029126253 7:98296987-98297009 TGGCAGTGCTGCCTGTGGCTTGG - Intronic
1029283104 7:99449373-99449395 CCCCAGTGCTGCTATGGGCAAGG - Intronic
1029421211 7:100472711-100472733 TGCCAGTGCTGGGTGGGGCTGGG - Intronic
1032513905 7:132493072-132493094 TGCCAGGGCTGCCTGGGCCCGGG + Intronic
1035309540 7:157956614-157956636 TGCCAGTGCTCCCCAGGGGAAGG + Intronic
1035672564 8:1431565-1431587 GGCCAGTGCTGCCTTTGGCCTGG - Intergenic
1038150419 8:24938429-24938451 AGGCAGTGCTGCCTAGTGCAGGG + Intergenic
1039239782 8:35544051-35544073 TGTCAGTGCAGCCTTAGGCAAGG + Intronic
1039574737 8:38613955-38613977 TACCAGTGGTGCCTTGGGATTGG - Intergenic
1039760148 8:40565801-40565823 TGCCAGTGATAACTTGGGCTTGG + Intronic
1039919955 8:41886518-41886540 TTCCAGTGTACCCTTGGGCAAGG - Intronic
1039949923 8:42162320-42162342 TGTCAGTGGTGCCTTGGCGACGG + Exonic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1042498821 8:69486757-69486779 TCTCAGGGCTGGCTTGGGCATGG - Intronic
1042730054 8:71923222-71923244 TCTCTGTGCTGCCTTGGGCTGGG + Intronic
1044296260 8:90530820-90530842 TGTCACTGTTGCCCTGGGCAAGG + Intergenic
1048573400 8:135672781-135672803 TGCCAGGGCTGGCCAGGGCATGG - Intergenic
1048823109 8:138397846-138397868 CACCAGGGCTGCCCTGGGCAAGG - Intronic
1049359490 8:142205562-142205584 TGCCTGTGCTCCCTTGGGAGAGG - Intergenic
1052733677 9:32318611-32318633 TGCCCCTGCTACCTTGGGCCTGG - Intergenic
1053800901 9:41764110-41764132 TGCCAGGGCTGCGCTGAGCAGGG - Intergenic
1054144294 9:61550729-61550751 TGCCAGGGCTGCATTGAGCAGGG + Intergenic
1054189332 9:61976260-61976282 TGCCAGGGCTGCGCTGAGCAGGG - Intergenic
1054649183 9:67612351-67612373 TGCCAGGGCTGCGCTGAGCAGGG + Intergenic
1055319551 9:75068756-75068778 TTCCAGTGCTGCCCTGGAGATGG - Intronic
1056796577 9:89662820-89662842 GGCCAGGGCAGCCATGGGCAGGG - Intergenic
1057090647 9:92255081-92255103 TCCCAGTGCTGCCCTCGCCAGGG + Intronic
1058922046 9:109626348-109626370 TGGAAGTGCTGACTGGGGCAGGG + Intergenic
1060815715 9:126634103-126634125 TTCCAGTCCTGCCTGGAGCAGGG - Intronic
1061014207 9:127972586-127972608 TGCCTGTGTGACCTTGGGCAAGG - Intronic
1061368944 9:130187182-130187204 TGCCGGTGCCTCCCTGGGCAGGG - Intronic
1062146309 9:134991670-134991692 TGCCAGTGAGGCCTTGGGCCAGG + Intergenic
1062281394 9:135753513-135753535 GGCCAGAGCTGCCTTGAACAAGG - Intronic
1186326397 X:8482092-8482114 TGCCAGGGATGTCTTGGGCATGG + Intergenic
1187522822 X:20028484-20028506 TGACAGTGCTCCATTGAGCATGG + Intronic
1188317566 X:28693325-28693347 TGGCAGAGCTGCCTTGTGAAGGG - Intronic
1188413084 X:29898278-29898300 TGCTATAGCTGCCGTGGGCATGG + Intronic
1189386321 X:40539705-40539727 TGCCAGTGCTGTCTTGGAGTGGG - Intergenic
1189702987 X:43730960-43730982 TGCCAATGCTGCCCTGACCAAGG - Intronic
1190840668 X:54141054-54141076 TGCCAGTGATGTGTTTGGCATGG - Intronic
1192261108 X:69506254-69506276 TGGTAGTGCTGCACTGGGCACGG - Intronic
1193865599 X:86726560-86726582 TGTCAGTGCTGCCTTGGGGCAGG + Intronic
1195703089 X:107719547-107719569 TACCTTTGCCGCCTTGGGCAAGG - Intronic
1196158495 X:112456581-112456603 TGTCCTTGCTGCCTTGGACAAGG + Exonic
1196920056 X:120576003-120576025 CGCCATTGCTGGCTTGGGTAAGG + Intergenic
1198200975 X:134418358-134418380 TACCTGTGCTGCCTTGTGCTAGG + Intronic
1198540285 X:137631365-137631387 TGCCAGTGCTGTCTTCTCCAGGG + Intergenic
1200137994 X:153884198-153884220 GGCCAGTGCTCCTTTGGGCCGGG - Intronic
1200409060 Y:2843797-2843819 TGGCAGTGGTGCTTGGGGCAGGG + Intronic
1201303281 Y:12528713-12528735 TGCCAGTGCTGCCAAAGCCAAGG - Intergenic