ID: 918131482

View in Genome Browser
Species Human (GRCh38)
Location 1:181633445-181633467
Sequence TGGTAGGCAGAGAGGTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 747
Summary {0: 1, 1: 1, 2: 3, 3: 76, 4: 666}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918131482 Original CRISPR TGGTAGGCAGAGAGGTGGAG AGG Intronic
900004369 1:35017-35039 TGAAAGGGAGAGGGGTGGAGGGG + Intergenic
900024094 1:205533-205555 TGAAAGGGAGAGGGGTGGAGGGG + Intergenic
900291140 1:1924125-1924147 GGGTGGGCAGTGAGCTGGAGGGG - Intronic
900408817 1:2503841-2503863 AGGCAGGGAGAGAGGCGGAGAGG - Intronic
900486302 1:2924365-2924387 GAGAAGACAGAGAGGTGGAGGGG - Intergenic
900503128 1:3016371-3016393 AGGAAGGCAGAGAGGGAGAGAGG + Intergenic
900544526 1:3221040-3221062 GGGTGGTCAGTGAGGTGGAGAGG + Intronic
900806956 1:4773836-4773858 TGTTATGCAGGGAGGTGGGGTGG + Intronic
900819606 1:4876476-4876498 TGGTGGGATGAGAGGTGGAGAGG - Intergenic
901004326 1:6164597-6164619 TTGGAGGCAGAGAGGGGCAGAGG + Intronic
901100415 1:6715266-6715288 TGGGAGGGAGGGAGGTGGGGGGG - Intergenic
901438838 1:9265307-9265329 TGGTAGACAGAAGGGTGCAGAGG + Exonic
901769870 1:11524716-11524738 TGGTAGGCACAGGGATGGGGTGG - Intronic
901769885 1:11524757-11524779 TGGTAGGCACAGGGATGGGGTGG - Intronic
901769899 1:11524798-11524820 TGGTAGGCACAGGGATGGGGTGG - Intronic
901805962 1:11738764-11738786 TGGGAGGCAGAGTTGTGCAGCGG - Intronic
901872629 1:12146981-12147003 TGGAAGGCAGGGAGCTGAAGTGG + Intergenic
901895813 1:12310916-12310938 TGGGAGGGAGAGAGGGAGAGAGG - Intronic
902216480 1:14937476-14937498 TGGCAGGGAGAGAGGCGGAGGGG - Intronic
902239707 1:15080417-15080439 TGGTGGGCAGCGAGGTGGCAGGG - Intronic
902374226 1:16022784-16022806 TCCTGGGCAGAGAGGTGGGGTGG - Intronic
902385293 1:16072740-16072762 TGGTACCCAAGGAGGTGGAGGGG - Intronic
902548008 1:17202318-17202340 AGGGAGGCAGAGAGGAAGAGAGG - Intergenic
902670175 1:17967766-17967788 TGGGAGGGAGAGAGGGAGAGGGG + Intergenic
902776876 1:18680481-18680503 TGGGAGACAGAAAGGAGGAGGGG - Intronic
902811904 1:18892714-18892736 TGGGAGGCAGAGTGGGGGTGGGG - Intronic
902827960 1:18990069-18990091 GGGCAGGCAGTGAAGTGGAGCGG + Intergenic
902902294 1:19526485-19526507 TGGTAGGAAGAGCGATGGAGAGG + Intergenic
903338383 1:22639428-22639450 TGGAAGCCAGAGAGGTGGGTGGG - Exonic
903429352 1:23280957-23280979 TGGGAGGCTGAGAGGTGGGAGGG - Intergenic
903691796 1:25179355-25179377 TGGTAAGCAGAGAACTGGCGGGG + Intergenic
903764619 1:25726184-25726206 TGGAATGCAGTGAGGTGGAGAGG + Intronic
903812817 1:26044292-26044314 TGGCTGGCAGAGAGCTGGTGAGG - Exonic
904092536 1:27955477-27955499 TGGCAGGCACAGAGGTGGGAAGG + Intronic
904171319 1:28593669-28593691 GGGGAGGCAGGGAGGTGGAAAGG - Intronic
904346573 1:29875950-29875972 AGGCAGGCAGAGGAGTGGAGAGG - Intergenic
904356891 1:29946176-29946198 TGGGAAGCAGAGAGATGGGGAGG + Intergenic
904447616 1:30587637-30587659 TGGGAGGGAGAGGGGTGGGGAGG - Intergenic
904469794 1:30729269-30729291 AGTCAGGCAGAGATGTGGAGGGG + Intergenic
904764337 1:32831699-32831721 TGATGGGGGGAGAGGTGGAGAGG - Intronic
904869010 1:33604926-33604948 TGGTATGCTGAGAGCTAGAGAGG - Intronic
905278050 1:36831858-36831880 TGGGAGGAAGAGAGATGGGGAGG - Intronic
905302278 1:36993640-36993662 TGTGAGGCAGAGAGGGGGTGTGG + Intronic
905337657 1:37256630-37256652 TGGTAGGGAAAGAGGGAGAGAGG - Intergenic
905780652 1:40706156-40706178 TGGTAAGCAGTGTGGTGCAGCGG + Intronic
906185114 1:43856691-43856713 TGGTGGGCAGAGAAAAGGAGAGG - Intronic
906508658 1:46398292-46398314 TTGTAGGCAGAAGGGAGGAGAGG - Intronic
907524690 1:55047195-55047217 TGGAAGGGAGGGAGGAGGAGCGG + Intronic
907595094 1:55712498-55712520 TGGGAGGCAGAGAAGGGGACAGG - Intergenic
909012800 1:70353940-70353962 GGGGAAGGAGAGAGGTGGAGAGG + Intronic
911001025 1:93165893-93165915 TGGGAGGCTGGGGGGTGGAGGGG - Intronic
911629313 1:100164813-100164835 TGGGAGGCAGAGGGGTGAGGCGG - Intronic
912345156 1:108956874-108956896 TGGGAGGCAGGGAGGCGGGGAGG + Intronic
912381004 1:109248273-109248295 TGGTTGGGGGAGTGGTGGAGAGG + Intergenic
912680331 1:111725280-111725302 TGGGAGGCAGAGAGGGGCAGTGG + Exonic
913395376 1:118364549-118364571 TAGTAGGCAGAAAGGTGCAATGG - Intergenic
914349647 1:146829870-146829892 TGAAAGGCAGAGTGCTGGAGAGG - Intergenic
914380376 1:147110213-147110235 GGGTAGGCAGTGAGCTGGAAAGG + Intergenic
914676077 1:149908508-149908530 TGGGAGTCAGACAGGTGGAGTGG - Intronic
914759374 1:150586149-150586171 TGGTGGGCAAAGAGGTGGGGAGG + Intergenic
916187699 1:162148865-162148887 GTGTAGACAGAGAGGTAGAGGGG + Intronic
916470800 1:165120231-165120253 TGGGAGGCAGAGAGGAGATGAGG - Intergenic
916499807 1:165376796-165376818 AGGGAGGCAGGGAGGTGGAGAGG - Intergenic
916530209 1:165649397-165649419 TGGTGGGGAGAGGGATGGAGAGG - Intronic
917029051 1:170669634-170669656 TGGTAGGCTGATGGATGGAGCGG - Intronic
917513850 1:175690583-175690605 TGGGAGGATGAGAGGTGGTGAGG + Intronic
918078086 1:181185580-181185602 TGGTAGTAGGTGAGGTGGAGAGG + Intergenic
918131482 1:181633445-181633467 TGGTAGGCAGAGAGGTGGAGAGG + Intronic
918393753 1:184093332-184093354 TTGGAGGCAGGGTGGTGGAGTGG + Intergenic
918535848 1:185573629-185573651 TAGAAGGTAAAGAGGTGGAGGGG + Intergenic
919637290 1:200015185-200015207 AGGAAGGAAGAGAGGAGGAGAGG + Intergenic
920440808 1:205979323-205979345 GGGGAGGCTGAGAGGTGGACAGG - Intronic
921407762 1:214799642-214799664 TGCCAGGCACAGATGTGGAGAGG - Intergenic
921426477 1:215007489-215007511 AGGTATGGAGAGAGCTGGAGAGG + Intronic
921462452 1:215444961-215444983 TGGTTAGCACAGGGGTGGAGGGG + Intergenic
922171027 1:223154972-223154994 TCCTGGGCAGTGAGGTGGAGTGG + Intergenic
922526871 1:226310465-226310487 TGGTAGCTAGAGAGGTGCAGCGG + Intergenic
923092479 1:230750854-230750876 TGGGAGGCAGAGAGGGTGATAGG + Intronic
923525485 1:234769415-234769437 TGGTAGGGAGAGAGGAGCAAAGG - Intergenic
923619968 1:235570638-235570660 TGGGAGGCTGAGAGGGGGAGTGG - Intronic
923899651 1:238311876-238311898 TGATAGGCAGAGAATTGTAGAGG + Intergenic
923994812 1:239481788-239481810 TGGTACCCACAGAGATGGAGAGG + Intronic
924633441 1:245763375-245763397 GGGTGGGCAGAGAGCTGTAGGGG + Intronic
924927735 1:248699535-248699557 TGGTAGGAGGAGTGGGGGAGAGG + Intergenic
1062772748 10:116022-116044 GGGTGGGCAGGGGGGTGGAGAGG - Intergenic
1062812901 10:478904-478926 GGGTAGGGAGGGAGGAGGAGAGG + Intronic
1063119134 10:3092395-3092417 GGGGATGCAGAGAGGTGGATGGG + Intronic
1063216751 10:3932265-3932287 TGGTGGGGAGAGAGGTGTGGAGG + Intergenic
1063624792 10:7678856-7678878 TGTTAGCCAGAGAGGGGGAAGGG + Intergenic
1063672546 10:8111116-8111138 TGGCAGGCAGAAAGGAGGTGAGG + Intergenic
1063717817 10:8545987-8546009 TGGTAGCCACATAGGTGGAGAGG - Intergenic
1063972742 10:11392894-11392916 TGGTGGGTAAAGAGCTGGAGGGG + Intergenic
1064506521 10:16036501-16036523 TGTTTGGCAGAGAGGAAGAGAGG + Intergenic
1065371411 10:24990851-24990873 TGGGAGGCTGAGGGGTGGGGGGG + Intronic
1065580977 10:27171748-27171770 TGGAAGGCAGTAAGGTAGAGCGG - Intronic
1066490848 10:35893221-35893243 TGGGAGGCAGGGAGTGGGAGAGG - Intergenic
1067203766 10:44196477-44196499 CTGAAGGCAGAGAGGAGGAGAGG + Intergenic
1067283435 10:44890386-44890408 TGGTAGCCAGGGAGGTGGAAAGG + Intergenic
1067285492 10:44904771-44904793 TGGAAGATAGAGAGGTGGTGCGG + Intergenic
1067684234 10:48457478-48457500 TGGGAGGCCTAGGGGTGGAGGGG - Intronic
1069026580 10:63549242-63549264 TAGAAGGCAGAGGTGTGGAGTGG + Intronic
1069844282 10:71359884-71359906 TGGGACCCAGAGAGGTTGAGTGG + Intronic
1070351115 10:75592996-75593018 TGTTCAGCAGAGAGGAGGAGGGG - Intronic
1070565477 10:77600897-77600919 TGGGAGGGGGAGTGGTGGAGTGG - Intronic
1070607632 10:77910165-77910187 TGTGACGAAGAGAGGTGGAGAGG + Intronic
1071492885 10:86148012-86148034 AGGGAGGCAGAAAGGAGGAGGGG - Intronic
1071629121 10:87203981-87204003 TGGTAGGGAGAGACGTGCGGGGG + Intergenic
1071910333 10:90224577-90224599 TGGTATGGGAAGAGGTGGAGCGG + Intergenic
1072552639 10:96490982-96491004 TCGAACACAGAGAGGTGGAGGGG - Intronic
1072623815 10:97098370-97098392 TGCTAGGCAGAGAGGGGCAGGGG + Intronic
1073446218 10:103582189-103582211 TGGGAGACAGAGAGGGGAAGGGG - Intronic
1073509806 10:104035683-104035705 TGGCAGGAAGAGAGGCAGAGAGG + Intronic
1073600072 10:104838222-104838244 TGGCAGGCAGGATGGTGGAGGGG - Intronic
1074370549 10:112897738-112897760 GGGGACTCAGAGAGGTGGAGGGG + Intergenic
1074846973 10:117406964-117406986 TCTTAGGGAGAGAGGAGGAGGGG + Intergenic
1074920635 10:118005805-118005827 TGGTAGGCAGGGAGGCGTGGTGG + Exonic
1075136977 10:119794799-119794821 TGGGAGGGAGGGAGGTGGGGGGG - Intronic
1075155523 10:119973511-119973533 TGCAAGGCAGAAAAGTGGAGGGG + Intergenic
1075587054 10:123665895-123665917 GGAGAGGGAGAGAGGTGGAGGGG + Intergenic
1075685763 10:124364247-124364269 GGGTTTGCTGAGAGGTGGAGTGG - Intergenic
1076336317 10:129709212-129709234 TGGTGGGCAGAGATGATGAGAGG - Intronic
1076837444 10:133028327-133028349 GGGTAGGCAGATGGGTGGATGGG + Intergenic
1076983633 11:219368-219390 TGGGAGACAGCGAGGTGGGGAGG - Intronic
1077375972 11:2205316-2205338 TGGGAGGGAGGGAGGTGGGGAGG - Intergenic
1077375985 11:2205347-2205369 TGGGAGGGAGGGAGGTGGGGAGG - Intergenic
1077376050 11:2205529-2205551 GGGGAGGCTGAGAGGTGGGGAGG - Intergenic
1077376188 11:2205951-2205973 TGGGAGGTAGGGAGGTGGGGAGG - Intergenic
1078436798 11:11332158-11332180 TGGGAGGGAGAAAGATGGAGGGG - Intronic
1079354585 11:19719653-19719675 TGGGAGGCAGAGAGGTAGGGTGG - Intronic
1079551990 11:21711209-21711231 TGTTAGGAAGAGCAGTGGAGAGG + Intergenic
1080893678 11:36431128-36431150 TGGAAGGCAGCGAAGTGGAGTGG + Intronic
1080953865 11:37069188-37069210 TAGAAGGAAGAGAGATGGAGAGG + Intergenic
1081593605 11:44444221-44444243 TGGGAGGCGGGGAGGTGGGGAGG + Intergenic
1081625650 11:44653718-44653740 TGCTAGGGTGAGAGGGGGAGGGG - Intergenic
1081826013 11:46052483-46052505 TGATAGGCAGTGAGGTTGAATGG - Intronic
1082005220 11:47415435-47415457 TGAGAGGCAGAGAGGGCGAGTGG + Exonic
1082080118 11:48006313-48006335 TGGAGGCGAGAGAGGTGGAGTGG + Intronic
1084021195 11:66419368-66419390 TGGTAGTAAGAGAGGTAGAGTGG - Intergenic
1084114978 11:67037421-67037443 TGGTAAGCAGCCAGGTGCAGTGG + Intronic
1084303293 11:68265106-68265128 GGGTGGGCAGGCAGGTGGAGAGG + Intronic
1084693612 11:70740963-70740985 TGATGGGCAGCAAGGTGGAGGGG + Intronic
1084960590 11:72714192-72714214 CGGGGGGCAGGGAGGTGGAGAGG + Exonic
1085196168 11:74673095-74673117 TCAGAGCCAGAGAGGTGGAGGGG - Intergenic
1085238797 11:75034823-75034845 TGGTTGGCTGGGAGGTGGAGAGG - Intergenic
1085359573 11:75874853-75874875 TGACAGGCAGAGTGGTAGAGAGG - Intronic
1085519991 11:77132086-77132108 TGGCAGGAAGAGAGGAGGAGAGG - Intronic
1087664824 11:101031984-101032006 AGGTAGGGATATAGGTGGAGTGG + Exonic
1088065236 11:105709700-105709722 TGGGAGGCAGACAGGAAGAGAGG + Intronic
1088694807 11:112357563-112357585 CTCTAGGCAGAGAGGTGGAGTGG + Intergenic
1088952016 11:114581393-114581415 TGGTATGAAGAGAGGTGTTGTGG + Intronic
1089176859 11:116554880-116554902 TGGAAGGGGCAGAGGTGGAGAGG + Intergenic
1089183033 11:116595950-116595972 TGGGAGGAGGAGAGGAGGAGGGG + Intergenic
1090383953 11:126345771-126345793 TGGGAGGCAGACAGATGGTGGGG + Intergenic
1090568452 11:128021430-128021452 AGGAAGGCAGAGAGGCTGAGAGG + Intergenic
1090715371 11:129425833-129425855 TAAAGGGCAGAGAGGTGGAGTGG - Intronic
1090764376 11:129864080-129864102 TCGTAGGCAGCGAGGTAGAGTGG - Intronic
1090858382 11:130631537-130631559 TGACAGACAGAGAGATGGAGTGG - Intergenic
1091013683 11:132029794-132029816 AGGTAGTCAGAGACGAGGAGTGG + Intronic
1091119172 11:133042448-133042470 GGGCAGGCAGAGAGGCAGAGCGG + Intronic
1091165012 11:133467860-133467882 TGGAAAGCAGTGTGGTGGAGGGG + Intronic
1091377790 12:37065-37087 TGAAAGGGAGAGGGGTGGAGGGG + Intergenic
1091813580 12:3419627-3419649 TGGTAGACAGAGAGTGGTAGCGG - Intronic
1092114082 12:5986052-5986074 GGGTAGGAAGAGCGGTGGGGAGG + Intronic
1092213867 12:6667005-6667027 TTGTAGGCAGAGAAGGAGAGAGG + Exonic
1092242743 12:6845511-6845533 TGGGAGGCAGAGGGCGGGAGAGG + Intronic
1092968569 12:13669677-13669699 TGCTAGGCACAGAGGTATAGTGG + Intronic
1093262068 12:16950639-16950661 TGGTAGGCAGAAAGGAGGTGGGG - Intergenic
1093379090 12:18469663-18469685 TGGAGGGAAGAGAAGTGGAGGGG - Intronic
1093596717 12:20971487-20971509 TGGTAGGCAGAAAGTGGGGGAGG - Intergenic
1093702937 12:22243261-22243283 TGTTGGGCAGAGATGTGCAGTGG - Intronic
1094042850 12:26135417-26135439 TGGTAGGCACAGAGGAGGCAAGG + Intronic
1095472596 12:42552830-42552852 TGGAAGACACGGAGGTGGAGTGG + Intronic
1095907611 12:47394089-47394111 AGGTAGGTAGGGAGGTGGTGGGG - Intergenic
1096093958 12:48922204-48922226 GGAGAGGCAGAGGGGTGGAGAGG + Intronic
1096311407 12:50524531-50524553 AGGCAGGGAGACAGGTGGAGAGG - Intronic
1096478047 12:51920732-51920754 GGGTTGGGAGAGAGGTGCAGAGG - Intronic
1096587108 12:52629938-52629960 TGGAAGGCATACAGGTTGAGGGG - Intergenic
1096779709 12:53984887-53984909 GGGGAGGTAGAGGGGTGGAGGGG - Intergenic
1096882583 12:54684854-54684876 TGGGAGGCAGGGAGAGGGAGAGG + Intergenic
1097113011 12:56676118-56676140 TGGGAGGCTGGGAGGGGGAGGGG + Intronic
1097728787 12:63104564-63104586 TGGGGGTTAGAGAGGTGGAGAGG - Intergenic
1100504311 12:95204762-95204784 GGGTAGGGAGAGGAGTGGAGGGG + Intronic
1102700140 12:114832001-114832023 TGGTGGGCAGAGGAGTGGAGCGG + Intergenic
1103184928 12:118948488-118948510 AGGTAGGCAGATGGGTGGATGGG + Intergenic
1103584883 12:121945175-121945197 TGGTAGCAACAGAGGTGGAAAGG - Intronic
1103602631 12:122063871-122063893 CAGTAGGCAGGGAGGTGGGGTGG + Intergenic
1103663694 12:122543378-122543400 TAGTAGGAAGAGAGGTGGTAAGG + Intronic
1104097361 12:125569759-125569781 TGGCAAGCAGAGAGATGGGGGGG - Intronic
1104134288 12:125922808-125922830 GGAGAGGGAGAGAGGTGGAGAGG + Intergenic
1104517751 12:129443511-129443533 TGGGAGGGAGGGAGATGGAGAGG - Intronic
1104519665 12:129461711-129461733 AGGTAGGTAGAGAGGTGGGTGGG + Intronic
1104731246 12:131106662-131106684 TGCTGGGCAGTGAGGAGGAGAGG - Intronic
1104791530 12:131485291-131485313 TGGTAGGAAGAGACGTGGCTGGG + Intergenic
1104937945 12:132376544-132376566 TGGTAAGAAGCGAGGTAGAGGGG + Intergenic
1104953744 12:132453940-132453962 TGGCAGGCCCTGAGGTGGAGGGG + Intergenic
1105941459 13:25151747-25151769 AGGAAGGTAGAGAGGAGGAGGGG - Intergenic
1106096041 13:26644746-26644768 GGTTAGGCAGAGTTGTGGAGGGG + Intronic
1106584863 13:31048281-31048303 TGGCAGGCAGAGAAGAGGTGGGG + Intergenic
1107025262 13:35795198-35795220 TGACAGGCAGAGAGGAGGTGTGG + Intronic
1107389146 13:39945319-39945341 TGGTGGGCAGAGAGGTGGGTGGG - Intergenic
1107690488 13:42948214-42948236 TGATGGTCAAAGAGGTGGAGTGG + Intronic
1107741401 13:43454207-43454229 TGGTAGGCAAAGTGGGGGAAGGG - Intronic
1107782688 13:43921564-43921586 TGGTAGGCAGAGAAGAGTGGAGG + Intergenic
1108529956 13:51319526-51319548 CTGTAGGCAGTGGGGTGGAGAGG - Intergenic
1108538664 13:51414246-51414268 TAGTAGTCAGGGAAGTGGAGTGG - Intronic
1108716178 13:53080373-53080395 TGGGAAGCAGTGAGTTGGAGTGG + Intergenic
1108755062 13:53490399-53490421 TGGTGGTCAGTGGGGTGGAGGGG + Intergenic
1110275696 13:73639807-73639829 TGGGAGGGAGAGAGGAGAAGAGG + Intergenic
1111029286 13:82574794-82574816 TCATAGGCAGATAGGTGGAAGGG - Intergenic
1111128772 13:83947174-83947196 TGGTATGCAGAGAGTTTGAATGG + Intergenic
1111174171 13:84571670-84571692 AGGTAGGCAGAGAGAGAGAGAGG - Intergenic
1111993171 13:95137031-95137053 TGGTAGGCATAAAGGTAGATAGG + Intronic
1114258142 14:21019555-21019577 GGGGAGGCACAGAGGAGGAGAGG - Intronic
1114624108 14:24117399-24117421 TGCCAGGCTGGGAGGTGGAGAGG - Intronic
1115353868 14:32426287-32426309 GGTTAGGGAGAGAGGGGGAGAGG + Intronic
1115443836 14:33466680-33466702 TGGAAGGCAAAGAGGGAGAGAGG + Intronic
1116666050 14:47776968-47776990 TGGGAGGGAGAGAGGAGGAAAGG + Intergenic
1117049596 14:51847011-51847033 TGGTAACCAGAGGGGGGGAGGGG + Intronic
1117075047 14:52093812-52093834 TGGTAGGAAAGGAGGTGGGGTGG - Intergenic
1118171802 14:63395788-63395810 TGGGGGGAAGAGAGGAGGAGAGG + Intronic
1118444177 14:65836956-65836978 TGGCAGGCCGAGAGGTGGGGTGG + Intergenic
1118546676 14:66897471-66897493 TGGGTGACAGAGAGGTGGTGTGG - Intronic
1118702746 14:68450135-68450157 TGGTAGGCGGATAGGAGCAGAGG + Intronic
1119380400 14:74224636-74224658 TGGTAGGCGCAGAGGTGAGGAGG - Intergenic
1119663098 14:76465436-76465458 TGGCAGGGAGGGAGGTGGTGAGG + Intronic
1119866215 14:77977318-77977340 TGTTATGCAGAGAAGTGGATAGG - Intergenic
1119905862 14:78301363-78301385 AGGTAGGCAGAGAAAAGGAGAGG + Intronic
1120664094 14:87285395-87285417 TGATAGGTAGAGATTTGGAGTGG + Intergenic
1121254916 14:92524393-92524415 GGCTAGGCAAAGAGGTGAAGTGG - Intronic
1121410825 14:93747104-93747126 GGGTAGGCAGAGGGGAGAAGAGG + Intronic
1121539010 14:94711228-94711250 TGCCAGGCGGAGGGGTGGAGAGG - Intergenic
1121598540 14:95185393-95185415 TGGAAGGCTGGGAGCTGGAGTGG - Exonic
1122040257 14:98982660-98982682 TGAAATGCAGAGAGGTGGAATGG + Intergenic
1122338575 14:101009601-101009623 TGGAAGGAAGCGAGGAGGAGAGG - Intergenic
1122406191 14:101502491-101502513 TGGCAGGGAGACAGGTGGGGAGG - Intergenic
1122974122 14:105164102-105164124 AGGAAGGCTGGGAGGTGGAGGGG - Intronic
1123998323 15:25734045-25734067 TGGGAGGCAGTGAGGTGCTGGGG + Intronic
1124849826 15:33325694-33325716 GGGAAGGCAGAGAGGGGAAGGGG - Intronic
1124939871 15:34208244-34208266 TGGTAGAAAGAGAGTGGGAGGGG - Intronic
1125064957 15:35471497-35471519 TGGTAGGTAGGGAGGTGTGGAGG - Intronic
1125318483 15:38457688-38457710 TGGCAAGAATAGAGGTGGAGAGG + Intronic
1125346824 15:38726906-38726928 TGCTAGGCATAAAGGTGCAGAGG + Intergenic
1125426475 15:39554166-39554188 TGGGAAGCAGATGGGTGGAGGGG + Intergenic
1126105475 15:45144280-45144302 AGGGAGGCAGCCAGGTGGAGGGG + Intronic
1126959285 15:53972500-53972522 TAGTAGGCAGTTAGGTGGAAAGG + Intergenic
1127284174 15:57518057-57518079 TGGGAGGCTGAGAGGTGGGAGGG + Intronic
1127385579 15:58463768-58463790 TGATGAGCAGAGAGGTTGAGGGG - Intronic
1127477670 15:59349976-59349998 TGGTAGTCAGAAAGGAGGGGTGG + Intronic
1128216360 15:65936967-65936989 TGGTAGGCAGAGTTGGGCAGGGG - Intronic
1128665321 15:69533305-69533327 TGGTGGGCGGGGAGGTGGGGTGG + Intergenic
1128736897 15:70058572-70058594 TGGCAGGCAGAGGGGTGGAGTGG - Intronic
1128748580 15:70132372-70132394 TGGGAGGTAGGGAGGAGGAGAGG + Intergenic
1129215827 15:74097940-74097962 AGGTACCCAGAGAGGTTGAGAGG + Intergenic
1129350200 15:74951600-74951622 TGGGAGGCAGAGACGGGGGGGGG - Intergenic
1129682192 15:77664202-77664224 TGGCAGGCGGAGGGGTGGAAAGG + Intronic
1129975101 15:79815455-79815477 AGGCAGGCTGAGGGGTGGAGAGG - Intergenic
1130973740 15:88756746-88756768 TGGAAGGCAGAGTTGTGCAGAGG + Intergenic
1131064385 15:89424462-89424484 TGGTTGGCAGAGGCTTGGAGAGG + Intergenic
1131376245 15:91926238-91926260 AGGTAGGGAGAAAGGTGGAGAGG - Intronic
1131467622 15:92668097-92668119 TGGGAGGGAGGGAGGGGGAGCGG + Intronic
1132156650 15:99500491-99500513 CAGTAGGCAGGGAGCTGGAGTGG + Intergenic
1132449136 15:101955927-101955949 TGAAAGGGAGAGGGGTGGAGGGG - Intergenic
1132746304 16:1437746-1437768 TGGTGGGCTGAGAGCTGGAGGGG + Intronic
1132933904 16:2471614-2471636 TGGTGGGCAGAGCCGCGGAGAGG + Exonic
1133459748 16:5977245-5977267 GGGCAGGCAGAGAGGTGGTGAGG - Intergenic
1133607962 16:7406610-7406632 TGGAAGGCAGAGAGTTTTAGAGG - Intronic
1134450349 16:14359573-14359595 GGGTAGGCAGAGAAGTAGAGAGG - Intergenic
1135467387 16:22698955-22698977 TGGGAGAGAGAAAGGTGGAGGGG - Intergenic
1135498723 16:22975321-22975343 AGGTAGGCAGAGGAGTGGGGAGG - Intergenic
1135965137 16:27029231-27029253 TGCCAGGCAGACAGGTGCAGGGG + Intergenic
1136076800 16:27822888-27822910 TGGTACAGAGAGAGGTGCAGGGG + Intronic
1136297399 16:29311538-29311560 AGGGAGGCAGAGAGGTGTGGAGG + Intergenic
1136403126 16:30029129-30029151 TGGAAGGCAGGGAGGAGGTGGGG + Intronic
1137449009 16:48553005-48553027 TGATAGGAAGATAGGTGAAGGGG - Intronic
1137559766 16:49495106-49495128 TGGCAGGCAGCGAGGCCGAGTGG - Intronic
1138195320 16:55047722-55047744 TGGTGGGCGGAGAGGGGTAGAGG - Intergenic
1138231021 16:55336353-55336375 GGATGGGCAGAGGGGTGGAGAGG + Intergenic
1138356378 16:56384233-56384255 AGGTAGGCAGTGTGGTGGAGTGG - Intronic
1138411498 16:56844021-56844043 TGGGAGGAAGAGAGCTGGATTGG + Intronic
1139136077 16:64206219-64206241 TGGGGGGCGGAGTGGTGGAGGGG + Intergenic
1139842526 16:69892997-69893019 GCTTAGGCAGAGATGTGGAGTGG - Intronic
1139877604 16:70158674-70158696 CTCTAGGCAGAGAGGAGGAGAGG + Exonic
1139984388 16:70885676-70885698 TGAAAGGCAGAGTGCTGGAGAGG + Intronic
1140553242 16:75890910-75890932 TGTCAGGCAGAGGGGTGCAGGGG - Intergenic
1141519976 16:84572062-84572084 TGGAAGGCGTGGAGGTGGAGAGG - Intronic
1141775778 16:86121817-86121839 AGGAAGGGAGAGAGGTGGGGAGG - Intergenic
1141882424 16:86868797-86868819 GGTAAGGCAGAGAGGTAGAGGGG + Intergenic
1141992865 16:87620413-87620435 TGGTTAGCAGAGAGGTGGGAGGG + Intronic
1142058952 16:88017607-88017629 TGGGAGGGAGGGAGGCGGAGAGG + Intronic
1142222109 16:88860643-88860665 GGGCAGGCAGAGCGGTGGTGTGG - Intronic
1142893179 17:2958157-2958179 AGGGAGGCAGAGGGGTGGGGTGG + Intronic
1143068144 17:4265983-4266005 TAGTGGGTAGTGAGGTGGAGTGG + Intergenic
1143289954 17:5820945-5820967 TTCTAGGCAGAGTGGGGGAGTGG + Intronic
1143527025 17:7479026-7479048 AGCCAGGCAGAGAGGGGGAGGGG - Intronic
1144441430 17:15286155-15286177 TTGTAGGCATAGAGGGGTAGGGG + Intergenic
1144647825 17:16987450-16987472 AGGGAGGGAGGGAGGTGGAGAGG + Intergenic
1144757160 17:17686652-17686674 ATGAGGGCAGAGAGGTGGAGTGG + Intronic
1145741540 17:27279055-27279077 GAGAAGGCAGAGAGGTGGAGAGG - Intergenic
1146499334 17:33351228-33351250 GGGCAGTCAGAGAGGAGGAGGGG - Intronic
1146687493 17:34851064-34851086 TGATAGGGGGAGAGGTGGGGAGG + Intergenic
1146845590 17:36179689-36179711 TGGCAGGCAGAGAGATGAGGAGG + Intronic
1146873807 17:36391530-36391552 TGGCAGGCAGAGAGATGAGGAGG + Intronic
1146881164 17:36442620-36442642 TGGCAGGCAGAGAGATGAGGAGG + Intergenic
1147065583 17:37921341-37921363 TGGCAGGCAGAGAGATGAGGAGG - Intergenic
1147744518 17:42687092-42687114 TGGAAAGCAAAGAGGTGGAGCGG + Intronic
1147946375 17:44082564-44082586 GGGTAGGCAGTGAGCTGGTGGGG - Exonic
1148016756 17:44527469-44527491 TGGTTGCCAGAGAGGGGGGGAGG + Intergenic
1148191404 17:45681219-45681241 TGGTTGGGAGAGAGGTGGCAGGG - Intergenic
1148577676 17:48723052-48723074 TGGTAGGGAGAGAGGAAGAAAGG + Intergenic
1148644633 17:49212282-49212304 AGGGAGGCAGAAAGATGGAGAGG - Intronic
1149596041 17:57865317-57865339 TGGTAGGGAGTCAGGTGGAGTGG + Intronic
1151126644 17:71852534-71852556 GGGTTGGCAGTGATGTGGAGAGG - Intergenic
1151351820 17:73536443-73536465 TAGATGGCAGAGAGGTGCAGGGG - Intronic
1151716397 17:75833184-75833206 GGGAAGGCAGAGAGGTGGGCAGG - Intronic
1151718517 17:75843445-75843467 TGGGGTGCAGAGAGGTGGGGAGG - Intronic
1152315414 17:79577765-79577787 GGGGAGGGAGAGAGGTGGAGGGG + Intergenic
1203211852 17_KI270730v1_random:85458-85480 TGGAATGCAGTGAAGTGGAGTGG + Intergenic
1203214494 17_KI270730v1_random:109447-109469 TGGAATGCAGTGAAGTGGAGTGG + Intergenic
1154170598 18:12047815-12047837 TGGCAGGCAGGGTGGTGGGGTGG - Intergenic
1155304070 18:24462208-24462230 TGGTGTGCAGATAGGTGCAGGGG + Intronic
1157567924 18:48692416-48692438 TTAGAGGCAGAGAGGTGGAGAGG - Intronic
1158379719 18:56915916-56915938 TGGTACACAGAAAGGAGGAGGGG - Intronic
1158450515 18:57559902-57559924 TGGTGGACAGAGATTTGGAGGGG - Intronic
1158998230 18:62945651-62945673 TGGTAGGGAGCGATGTGTAGTGG - Intronic
1159309840 18:66692478-66692500 TGGGAGGCAGAGAGATGGTTGGG - Intergenic
1159384868 18:67710367-67710389 TGGTAGTTAGTGAGGTGGAGAGG - Intergenic
1159529888 18:69642102-69642124 AGGTAGACAGAGACATGGAGAGG - Intronic
1159989110 18:74881562-74881584 AGGTAGGCAGAGAGAGAGAGAGG - Intronic
1160587870 18:79922775-79922797 TGGGAGGCGGTGAGGTCGAGGGG + Intronic
1160636121 19:76626-76648 TGAAAGGGAGAGGGGTGGAGGGG + Intergenic
1161518632 19:4711106-4711128 AGGTGGGCAGCGAGGTGGGGTGG + Intronic
1161526958 19:4762084-4762106 TGGCAGCCACAGTGGTGGAGGGG - Intergenic
1162159185 19:8698784-8698806 GGGCAGGCAGACAGGGGGAGGGG + Exonic
1162392005 19:10395547-10395569 TGGTAGGGTGAGAGGGGGAGTGG + Intronic
1162856648 19:13473748-13473770 TGGGAGGCAGGGGGGTGGGGGGG - Intronic
1162857008 19:13476473-13476495 TTCTAGGCAGACAGGTGGTGAGG - Intronic
1162959423 19:14117391-14117413 GGGTAGGCAGAGAGGATGAGGGG + Intronic
1162968728 19:14167751-14167773 ACGGAGGCAGAGAGGTGGCGGGG + Intronic
1163167087 19:15506017-15506039 AGGTGGGCAGAGAAGAGGAGGGG - Intergenic
1164426711 19:28148051-28148073 TTGTAGGCAGACAGGCGGATGGG + Intergenic
1164441956 19:28285311-28285333 TGGAGGGGAAAGAGGTGGAGGGG + Intergenic
1166316679 19:41993408-41993430 TGGGAGGCTGGGAGGAGGAGAGG - Intronic
1166603533 19:44119187-44119209 ATGTAGTCAGAGAGGTGGTGGGG - Intronic
1166983771 19:46648104-46648126 TGAGAGGGAGAGCGGTGGAGGGG + Exonic
1167200562 19:48062215-48062237 TGGAAGGCAGAGAGGGGGATGGG + Intronic
1167248866 19:48390392-48390414 TGGGGGCCAGAGAGGTGGGGTGG + Intronic
1167525728 19:49982864-49982886 GGCCAGGCAGAGAAGTGGAGGGG - Intronic
1167792519 19:51690590-51690612 GGGTCCGCAGAGAGGGGGAGGGG + Intergenic
1168586662 19:57599702-57599724 TGCTATGGAGAAAGGTGGAGGGG - Intergenic
924984858 2:261784-261806 TGGTAAGGAAAGTGGTGGAGAGG - Intronic
925356656 2:3246738-3246760 TGGGAGGGAGAGAGGAAGAGAGG + Intronic
925507603 2:4585325-4585347 AGGGAGGGAGAGAGGAGGAGGGG - Intergenic
925731943 2:6925340-6925362 TGGCCGGCAGAGTGGTGGATAGG + Intronic
927873642 2:26640114-26640136 AGGGAGGGAGGGAGGTGGAGAGG + Intronic
928225882 2:29447658-29447680 TGGCTGGGGGAGAGGTGGAGGGG + Intronic
929571408 2:43025410-43025432 TGGGAGGCAGAGAGCTGCAGTGG + Intergenic
930035623 2:47083570-47083592 TGGGAGGCTGGGAGGTGGTGGGG - Intronic
930864640 2:56110571-56110593 TGGTAGGGAGAGATGTTGAGGGG - Intergenic
931127322 2:59292540-59292562 TGCAAGGCAGTGAGATGGAGAGG - Intergenic
931376456 2:61712717-61712739 TGGGAGGCAGACATGTGGATTGG + Intergenic
932112234 2:69012184-69012206 TGGGAGGCACACAAGTGGAGGGG + Intergenic
932734838 2:74247309-74247331 TGGAAGGCAGAGGGGAGGTGAGG + Intronic
933192179 2:79346947-79346969 GGGAAGGCAGAGTGGAGGAGAGG + Intronic
933472343 2:82742069-82742091 TGGGAGGGAGAGAGGTGAGGTGG - Intergenic
934060372 2:88286795-88286817 TGGTAGGGAGAAAGAGGGAGAGG - Intergenic
934061676 2:88300141-88300163 TGATAGGGAGAGAGTTTGAGTGG + Intergenic
934121776 2:88847338-88847360 TGGGAGGTAGAGAAGAGGAGGGG - Intergenic
934735722 2:96688931-96688953 TTGGAGGCACAGAGGTGGAGAGG - Intergenic
935717634 2:105952995-105953017 TGGAAGGGAGAGAGGAGGAAAGG - Intergenic
935769261 2:106401302-106401324 TGCTAGGCAGACATCTGGAGTGG + Intronic
935778090 2:106489491-106489513 GGGTAGGCAGAGGGGGGCAGAGG - Intergenic
935910831 2:107894621-107894643 TGCTAGGCAGACATCTGGAGTGG - Intergenic
935968957 2:108511460-108511482 TGCTAGGCAGACATCTGGAGTGG - Intergenic
936132618 2:109859661-109859683 TGCTAGGCAGACATCTGGAGTGG - Intergenic
936212079 2:110511824-110511846 TGCTAGGCAGACATCTGGAGTGG + Intergenic
936421219 2:112366386-112366408 TGCTAGGCAGACATCTGGAGTGG + Intergenic
936565360 2:113578424-113578446 TGAAAGGGAGAGGGGTGGAGGGG - Intergenic
936792439 2:116165416-116165438 TGACAGGCTTAGAGGTGGAGGGG + Intergenic
937262577 2:120595893-120595915 TTGTAGGCAGGGAGGTGGTCAGG + Intergenic
937909247 2:127067555-127067577 TGGGATGCTGAGACGTGGAGGGG - Intronic
938187037 2:129240765-129240787 TGCCAGGCAGTGAGGTGGATGGG + Intergenic
940071059 2:149688435-149688457 TGGGAGGCAGAGTGGTTGTGGGG - Intergenic
940256867 2:151740259-151740281 TGGTATGAAGAGAGGTGGTGGGG - Intergenic
940967261 2:159852926-159852948 AGGTAGGAAGAGAGTTGAAGGGG + Intronic
942437893 2:176001542-176001564 TGGTGGGCTGTGGGGTGGAGGGG - Intronic
943281263 2:185936447-185936469 TGGGAGGGAGAGAGGAAGAGAGG - Intergenic
943665519 2:190604682-190604704 TGGGAGGCAGAGTGGTGCAGTGG - Intergenic
946075946 2:217073637-217073659 TGGTAGGCCAAGAGCTGGAAAGG + Intergenic
946199639 2:218064363-218064385 TGGAGGGCAGGGAGTTGGAGAGG - Intronic
946381642 2:219352933-219352955 AGGGAGGCAGAGTGATGGAGGGG - Intergenic
946558774 2:220889535-220889557 TGGAAGACAGTGAGGAGGAGGGG - Intergenic
947922928 2:233893899-233893921 TGGATGGCAGAGCGGTGGAAGGG + Intergenic
948207515 2:236170023-236170045 TGGTAGGGAGGGAGGAGGCGAGG - Intergenic
948375349 2:237517233-237517255 AGGTAGGCGGAGGGGTGGATGGG + Intronic
948472165 2:238190122-238190144 TGGTTGGCGGGGAGGGGGAGGGG + Intronic
948650629 2:239441301-239441323 TGGGGGGCAGGGAGGTGGGGGGG - Intergenic
1168728858 20:60056-60078 TGAAAGGGAGAGGGGTGGAGGGG + Intergenic
1168893876 20:1310731-1310753 TGGGAGGCCGGGAGGTGAAGGGG + Intronic
1169052476 20:2592638-2592660 TGGCAGACAGAGAGGTGCAGTGG - Intronic
1169336398 20:4760688-4760710 TGCTAGGAAGAGCGGGGGAGCGG + Intergenic
1170104725 20:12741320-12741342 TAGTAGGAAGAGAAGAGGAGGGG + Intergenic
1170743413 20:19077787-19077809 GGGAGGACAGAGAGGTGGAGAGG + Intergenic
1170918757 20:20655577-20655599 TGGTAGGCAGTGAGAAGGGGAGG + Intronic
1171297003 20:24026131-24026153 TGGTATGGAGAGAGGGCGAGAGG - Intergenic
1171937607 20:31290129-31290151 TGGTTGGTAGAGTGGTAGAGAGG - Intergenic
1172441707 20:34970808-34970830 TGGAAGGCAGAGAGTGGGACAGG + Intergenic
1172793756 20:37523341-37523363 TGGGAGGCAGTGAGGAGGAAAGG - Exonic
1172831481 20:37838914-37838936 TGTTAGGCAGCCAAGTGGAGAGG + Intronic
1173719951 20:45248348-45248370 TGGGAGGCAGAGAGATGATGAGG - Intergenic
1173988508 20:47281465-47281487 AGGTAGGCAGAGATGAGCAGCGG - Intronic
1174550333 20:51357311-51357333 AGGGAGGCAGAGAGCAGGAGGGG - Intergenic
1174554230 20:51382565-51382587 TGGGGGGCAGTGAGGTGCAGAGG + Intergenic
1174571915 20:51508257-51508279 GCGCAGGCAGAGAGGTGGCGTGG - Intronic
1175073989 20:56358747-56358769 TGGTGGGCGGAGAGGAGGCGGGG + Intergenic
1175172030 20:57087352-57087374 TGGTTGGCAGGTAGGTGGCGTGG - Intergenic
1175248690 20:57596434-57596456 TGGGAGGTAGGGAGGTGGGGCGG - Intergenic
1175606481 20:60315791-60315813 TGGGAAGCAGAGAGGTGGAGAGG - Intergenic
1175748319 20:61477138-61477160 TGGCAGGCAGAGGCGTGGGGAGG - Intronic
1175935068 20:62510465-62510487 TGGAAGGTGGAGGGGTGGAGAGG - Intergenic
1176056747 20:63152904-63152926 TGGCAAGCAGGGAGGTGGTGTGG - Intergenic
1176302714 21:5106216-5106238 TGGTGGGCAGAGGGGAGGATTGG - Intergenic
1176753828 21:10711007-10711029 TGGAATGCAGTGAAGTGGAGTGG - Intergenic
1176755254 21:10721083-10721105 TGGAATGGAGTGAGGTGGAGTGG - Intergenic
1176755715 21:10724164-10724186 TGTTATGCAGTGAAGTGGAGTGG - Intergenic
1177521666 21:22235186-22235208 TGGTATGGAAAGAGGTTGAGTGG - Intergenic
1179854310 21:44155707-44155729 TGGTGGGCAGAGGGGAGGATTGG + Intergenic
1180012244 21:45058700-45058722 TGGGAGGCAGGGAGGGGGAAGGG + Intergenic
1181829289 22:25546511-25546533 GGGAAGGAAGAGAGGGGGAGAGG - Intergenic
1181963768 22:26642420-26642442 AGGGAGGCAGAGAGGGAGAGAGG + Intergenic
1182765080 22:32752881-32752903 TGGGAAGCAGAGAAATGGAGCGG + Intronic
1182895394 22:33855379-33855401 TGGAAGGTAGAGGGGTGGAGTGG + Intronic
1183379339 22:37483146-37483168 TGAGAGGAAGAGAGGAGGAGCGG - Intronic
1183454993 22:37917794-37917816 AGGTAGGCAGATACCTGGAGAGG + Exonic
1183576452 22:38693308-38693330 TGGTTAGGAGAGAGATGGAGTGG - Intronic
1184017167 22:41795037-41795059 TAATAGGCAGAGAGGAGGAAAGG + Intronic
1184320785 22:43740750-43740772 TTTCAGGCAGAGCGGTGGAGTGG - Intronic
1184401572 22:44277564-44277586 TCCTAGGCAGGGATGTGGAGGGG + Intronic
1185329818 22:50247454-50247476 TCTTTGGCAGAGAGGTGAAGGGG - Intronic
1185344251 22:50304488-50304510 TGGTAGGCAGAGAAAGGCAGGGG + Intronic
1203298246 22_KI270736v1_random:59001-59023 TGGAATGGAGTGAGGTGGAGAGG + Intergenic
1203304071 22_KI270736v1_random:97083-97105 TGGTATAGAGAGATGTGGAGTGG + Intergenic
1203315055 22_KI270736v1_random:181043-181065 TGGAAGGCAGTGGAGTGGAGTGG + Intergenic
949538933 3:5017296-5017318 TGGGAGGCAGGAAGGTGGACAGG + Intergenic
949893018 3:8747168-8747190 TGGGAGGCAGTGTGGTGAAGTGG + Intronic
949954724 3:9258358-9258380 TGCCAGGCAGAGAGTGGGAGAGG + Intronic
950534089 3:13569411-13569433 TGGTGGGCAGGGAGGTGGCGGGG + Intronic
950646958 3:14383025-14383047 TGGGAGGTAGAGAGGAGGTGAGG + Intergenic
950706523 3:14785850-14785872 GGGAAGGCTGAGGGGTGGAGTGG - Intergenic
951961974 3:28335848-28335870 TGGTAGGCAAAATGGTTGAGTGG + Intronic
952314985 3:32224811-32224833 GGGCAGGAAGAGAAGTGGAGTGG + Intergenic
952849049 3:37712817-37712839 GGGTTGGGAGTGAGGTGGAGTGG + Intronic
952952990 3:38539176-38539198 TGGGAGGTAGAGGGCTGGAGTGG + Intronic
953005281 3:38971955-38971977 AGGGAGGCAGAGAGGTAGGGAGG + Intergenic
953331228 3:42054348-42054370 TGGTAGGCAGAGGCAAGGAGAGG + Intronic
953561940 3:43998761-43998783 TGGTGTGCAGAGAGGAGGAAAGG + Intergenic
953706509 3:45235065-45235087 TGGTGGGCAGAGAGATGGCTGGG - Intergenic
954089371 3:48272305-48272327 TGGCTGGCAGAGAGGTGTGGAGG - Intronic
954715817 3:52526276-52526298 TGGGAGGCAGAGAAGTGGGCAGG + Intronic
954795117 3:53157385-53157407 TGCCAGGCAGAGAGTTGGTGAGG - Intronic
954961166 3:54566245-54566267 TGGTGGGCAGTGGGGTGGAAAGG - Intronic
955233962 3:57123462-57123484 TGATAGGAAGAGAAGAGGAGGGG - Intronic
955950372 3:64237544-64237566 AGCAGGGCAGAGAGGTGGAGTGG - Intronic
956141509 3:66151244-66151266 TGGTAGGCAGAATGGAGTAGTGG - Intronic
956240172 3:67121068-67121090 TGAGAGCCAGAGAGGTGGAATGG - Intergenic
956398724 3:68853429-68853451 CAGTAGGCAGAGAGGAGGAAAGG - Intronic
956637927 3:71384726-71384748 TGGCAGTCTGAGTGGTGGAGTGG + Intronic
956746017 3:72311479-72311501 GGGAAGGAAGAGAGATGGAGGGG - Intergenic
957191020 3:77010256-77010278 TGGTAGGTAGAGAGAATGAGGGG - Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
957558079 3:81785643-81785665 TGGAAGGAAGAGAGGTGGGAGGG + Intergenic
957781285 3:84821037-84821059 TGGTAGGCAGTGGGGTGGGTGGG - Intergenic
958177617 3:90016658-90016680 TGGAAACCAGAGAGCTGGAGAGG - Intergenic
959765520 3:110022530-110022552 TGCTAGGTAGAAAGGTGGAATGG + Intergenic
960577316 3:119241927-119241949 AGGGAGACAGAGAGGGGGAGGGG - Intergenic
960864942 3:122190051-122190073 GGGTAGGAAGAGAAGTGGGGTGG + Intronic
960944173 3:122954643-122954665 TGGTTGGCAGATAGGAGGAATGG + Intronic
960992916 3:123323506-123323528 GGGAAGGCAGAGAGGTGGCCAGG - Intronic
961173361 3:124814986-124815008 TGGTAGGCAGAGGCCAGGAGAGG - Intronic
961513317 3:127417842-127417864 TGTTAGAAAGAAAGGTGGAGAGG + Intergenic
961602913 3:128074984-128075006 TGGCAGGCAGACAGGGGGATGGG + Intronic
961630688 3:128296279-128296301 TGGTATGCAGAAAGGGTGAGTGG + Intronic
961826551 3:129602201-129602223 TTTTAGCCAGAGAAGTGGAGTGG - Intronic
961888434 3:130111556-130111578 GCGGAGGCAGAGAGGTGGCGGGG + Intronic
962192954 3:133330296-133330318 GGAGAGGCAAAGAGGTGGAGAGG + Intronic
962474881 3:135746782-135746804 TGCTATGCAGTGGGGTGGAGGGG - Intergenic
962493224 3:135914222-135914244 TGGTTGGCAGTGAGGTGTAATGG + Intergenic
963379641 3:144511643-144511665 TGGTAGCCAGTGAGAAGGAGGGG - Intergenic
964421251 3:156505795-156505817 TGGAAGGCTAAGAGGGGGAGAGG + Intronic
964606929 3:158570287-158570309 GGGTAGGCAGAGCAGGGGAGAGG - Intergenic
965280194 3:166740854-166740876 TGGTAGGCAGACTGGGTGAGAGG - Intergenic
966739419 3:183218393-183218415 TGGGAGGCCGAGGGGGGGAGTGG + Intronic
966909044 3:184548008-184548030 TGGAGGGGAGAGAGGTGAAGAGG - Intronic
967727276 3:192873452-192873474 ATGTAGGTAGAGAGGTGGAATGG - Intronic
968312950 3:197699236-197699258 CGGTAGACAGACAGGTGCAGAGG + Intronic
968452875 4:683383-683405 CGGCAGGCAGACAGGTGGAGGGG + Intronic
968662519 4:1804638-1804660 TGGTGAGCAGAGACGAGGAGAGG - Intronic
969275954 4:6135893-6135915 TGGTGGGGGGAGAGGTGGGGGGG + Intronic
969682376 4:8650429-8650451 CGGTGGGCACACAGGTGGAGGGG - Intergenic
970326374 4:14928992-14929014 AGGTAGGCAAAGAGTTGGCGGGG + Intergenic
970573990 4:17409669-17409691 TGGTGAGCAGAGGGATGGAGGGG - Intergenic
971813044 4:31452596-31452618 TGGCAGGAGCAGAGGTGGAGAGG - Intergenic
972302907 4:37802288-37802310 TGGGAGGCAGTGTGGTGCAGTGG - Intergenic
973730354 4:53816792-53816814 TGGTATGGAGGGAGGTGGAGTGG + Intronic
974161216 4:58142592-58142614 GGGAAGGTAGAGAGATGGAGAGG - Intergenic
975455381 4:74584384-74584406 TAGTAGGCAGAGGGAGGGAGGGG + Intergenic
975860649 4:78673077-78673099 TGGTAGGGAGAGTGGTTGAAGGG + Intergenic
976190394 4:82481278-82481300 TTTTAAGCAGAGAGGTGGCGAGG + Intergenic
976213615 4:82694766-82694788 GAGTAGGCTGAGAGGAGGAGGGG + Intronic
976416257 4:84779670-84779692 TGGTGGGGTGTGAGGTGGAGGGG + Intronic
977540692 4:98315366-98315388 TGGTAGTCAAAGACATGGAGTGG - Intronic
978268371 4:106857003-106857025 TGGCAGGAAGAGAGGGGGTGTGG - Intergenic
978462299 4:108969623-108969645 GGTTAGGGAGAGAGGTGGAGTGG - Intronic
979570768 4:122221739-122221761 TGGGAGGCAGGTATGTGGAGAGG + Intronic
979685471 4:123506529-123506551 TTGTAAGCAGAGAGGTTGATGGG + Intergenic
980075212 4:128287499-128287521 TGCGAGGCAGAGAGGTGGCGGGG + Exonic
980540860 4:134192876-134192898 TGCTTGGGAGAGAGTTGGAGGGG + Intergenic
980807999 4:137838106-137838128 TGGTGGGCTGAGTGGTTGAGTGG - Intergenic
981710276 4:147701998-147702020 GGGTAGGAAGAGAGGAGGAGGGG + Intergenic
981788424 4:148507098-148507120 TGTGTGTCAGAGAGGTGGAGTGG - Intergenic
982460815 4:155667290-155667312 TGGCAGGCAGTGAGCGGGAGAGG - Intronic
982753769 4:159194178-159194200 TGGGACGCAGAGAGGTGACGGGG + Intronic
982877877 4:160671011-160671033 AGGCAGGCAGAGAGGGAGAGAGG - Intergenic
983345030 4:166517931-166517953 TGGGAGGAAGTGACGTGGAGTGG + Intergenic
984539974 4:181024950-181024972 TGGCAGGAAGAGAGGTGGAAAGG + Intergenic
984862315 4:184252079-184252101 TTTTAGGCAGAGAGGAAGAGGGG - Intergenic
984884529 4:184438577-184438599 TGGACGGCAGAGAGAGGGAGGGG + Intronic
985070538 4:186163141-186163163 TGGTAGGGAGAGATGGGGAAAGG + Intronic
985138606 4:186814973-186814995 TGGAAGGGAGAAAGGAGGAGTGG + Intergenic
985140500 4:186834663-186834685 TGGAAGTCAGAGAGATGGAAGGG - Intergenic
985355542 4:189115643-189115665 TGGTAGCAGGAGCGGTGGAGAGG - Intergenic
985792309 5:1936473-1936495 TGGTGGGGAGAGAGTTGGAATGG - Intergenic
985883071 5:2655379-2655401 TGGGATGCAGAGAGGAGGAAAGG + Intergenic
986839382 5:11678893-11678915 TGGAAGTAAGAGATGTGGAGTGG - Intronic
986987022 5:13511789-13511811 TGGTAGGCACAGGGATAGAGAGG + Intergenic
987221811 5:15798257-15798279 AGGTCAGCAGAGCGGTGGAGGGG - Intronic
987418704 5:17692704-17692726 TGGTATGAAAAGAGGTGGAGAGG + Intergenic
988528744 5:32008992-32009014 TGGTGGGGAGACAGGAGGAGGGG + Intronic
991021925 5:61988263-61988285 TGGTGGGGAGAGAGGACGAGGGG - Intergenic
991322962 5:65396527-65396549 AGGTAGCCAGAGGGTTGGAGTGG - Intronic
992758368 5:79930419-79930441 TGGTAGGCAGGGAAGAGAAGAGG + Intergenic
992864922 5:80948461-80948483 CCTTAGGCAGAGAGGTGGAAAGG - Intergenic
993618632 5:90142523-90142545 TGCTAGGCAGAGATGAGGACAGG + Intergenic
993902686 5:93595335-93595357 TGGGAGTCAGAGGGCTGGAGCGG + Intergenic
995088819 5:108147440-108147462 TGGGAGGCAGAGATGGTGAGAGG + Intronic
995387285 5:111601963-111601985 TGGTAGGCAATGAGGATGAGTGG - Intergenic
995632740 5:114151390-114151412 TGGAAGGAAGGGAGCTGGAGTGG - Intergenic
995747544 5:115419310-115419332 TGGGAGTGAGAGAGATGGAGAGG + Intergenic
996143488 5:119944367-119944389 TGACAGGTAGAGAGGTGAAGAGG - Intergenic
996818535 5:127599757-127599779 TGGAATGGAGAGAAGTGGAGGGG + Intergenic
997467664 5:134099095-134099117 AGGCGGGCAGAGAGGTGGACAGG + Intergenic
997490415 5:134271091-134271113 TGATAGTAAGAGAGTTGGAGTGG - Intergenic
998003279 5:138640886-138640908 TGGAAGGCTGAGGGGTGGGGAGG + Intronic
998261214 5:140633252-140633274 TCGGAGGAAGAGAGGTGGGGAGG - Exonic
998390563 5:141784560-141784582 GGAAAGGCAGAGAGGAGGAGCGG - Intergenic
998518961 5:142782605-142782627 TGGGTAGCAGAGAGTTGGAGAGG + Intronic
999289402 5:150413888-150413910 AAGGAGGCAGAGGGGTGGAGTGG - Intergenic
1001082267 5:168676118-168676140 GGGTAGGTAGAGAGATGGATAGG - Intronic
1001115124 5:168933105-168933127 TGCAAGGCAGAGATGTGCAGGGG + Intronic
1001411037 5:171512010-171512032 GGGTGGGCAGATAGGTAGAGAGG + Intergenic
1001626634 5:173141388-173141410 TGGTAGGCAGTGGGGCTGAGGGG + Intergenic
1001659211 5:173378170-173378192 AGGCAGGCAGAAAGGTGGCGAGG - Intergenic
1002303717 5:178271706-178271728 GGGAAGGCGGAGAGGTGGAGAGG + Intronic
1002594241 5:180311980-180312002 AGGGAGGCAGGGAGGTGGGGAGG + Intronic
1002836685 6:870543-870565 TGGGAGGGAGAAAGGCGGAGTGG - Intergenic
1003545494 6:7054789-7054811 GGGTAGGCAGAAAGGATGAGAGG - Intergenic
1003662688 6:8077714-8077736 TGGTAGGGAGAAAGTTTGAGTGG - Intronic
1005081961 6:21965422-21965444 TGGTGGGGGGAGAGGAGGAGAGG - Intergenic
1005290957 6:24378387-24378409 TGGTAGGGAGAGTGGTGGGGAGG - Intergenic
1006361995 6:33591752-33591774 TGGAAAGCAGAGAGGCAGAGGGG + Intergenic
1006866960 6:37216448-37216470 AGGTAGGCAGAGCAGTTGAGAGG + Intronic
1007275971 6:40674039-40674061 TGGGAGGCATAGGGGTGGACAGG + Intergenic
1007315675 6:40986729-40986751 TGGTAGGCAGGGAGGGACAGAGG + Intergenic
1008663996 6:53697819-53697841 TGGGAGGCAGAGAGATGGTAAGG + Intergenic
1008774437 6:55019291-55019313 TGGTTGCCAGAGATTTGGAGAGG - Intergenic
1008881586 6:56385712-56385734 TGGGAGGAAGGGAGGGGGAGTGG - Intronic
1011243751 6:85300133-85300155 TGGGATGCAGGGAGGTGGAAAGG + Intergenic
1012005103 6:93704058-93704080 GGGCAGGCAGACAGGAGGAGAGG - Intergenic
1012318733 6:97815432-97815454 TGGTAGGGGGTGGGGTGGAGAGG - Intergenic
1012789426 6:103674889-103674911 TGATAGGCAGAGAGGGGGCATGG - Intergenic
1013226748 6:108124512-108124534 TGGGGTGCAGAGAGGTGGAGGGG + Intronic
1014302801 6:119704442-119704464 AGGTAGGCAGAGGGTTAGAGAGG - Intergenic
1015204153 6:130616201-130616223 AGATGGGCAGAGAGGCGGAGAGG - Intergenic
1015311338 6:131770460-131770482 TGGCAGGCAGGGTAGTGGAGTGG - Intergenic
1015351328 6:132223864-132223886 GGGCAGGGAGAGAGGTGGATGGG - Intergenic
1017753538 6:157510697-157510719 TGGTGGGCAGAGAGGAAGCGCGG + Intronic
1017814393 6:158006159-158006181 TGGCAAGCAGAGAAATGGAGAGG - Intronic
1018152954 6:160957041-160957063 TGGCAGGAAGAGAGCTGGGGAGG + Intergenic
1018850591 6:167587723-167587745 TGGAAGAGGGAGAGGTGGAGGGG + Intergenic
1019223563 6:170493412-170493434 GGGGAGGAAGAGAGGAGGAGAGG + Intergenic
1019286662 7:226626-226648 TCGTGGGCAGTGGGGTGGAGCGG - Intronic
1019313732 7:375175-375197 TGGGGGTCAGAGAGGTCGAGCGG - Intergenic
1019585610 7:1800924-1800946 TGGTGGGCAGTGACTTGGAGGGG - Intergenic
1021315558 7:19144252-19144274 TGGAAGGCAGAGCAGTCGAGAGG - Intergenic
1021962513 7:25887012-25887034 TGGGTGGCAGGCAGGTGGAGGGG + Intergenic
1022246020 7:28560208-28560230 AGCTAGGCAGAGAGAAGGAGAGG + Intronic
1022642717 7:32203438-32203460 TGGAAGGCAGAGATGTGCAGTGG - Intronic
1023160615 7:37292774-37292796 TGGGAGGGAGGGAGGTGGGGGGG + Intronic
1023766401 7:43515110-43515132 TGGCTGGCAGAGAAGAGGAGTGG + Intronic
1023874276 7:44278279-44278301 AGGGAGGCAGCGATGTGGAGAGG + Intronic
1023937629 7:44750590-44750612 AGGCAGGCAGAGAGGTGGCATGG + Intronic
1025611725 7:63080618-63080640 TGGTGGGCAGGGATGTGGGGTGG - Intergenic
1026015355 7:66667284-66667306 TGGTGGGCAGGCAGGTGGGGTGG + Intronic
1026847540 7:73706233-73706255 TGGAATGCAGTGAGGTGGAGCGG + Intronic
1027129872 7:75583161-75583183 AGGCAGGCAGAGAGATGGGGAGG - Intronic
1027870566 7:83701680-83701702 TGGTACCCAGAGAGATGAAGAGG - Intergenic
1030711745 7:112757877-112757899 GGGATGGAAGAGAGGTGGAGGGG - Intergenic
1030756944 7:113297475-113297497 TGGGAGGCAGAGATGAAGAGAGG + Intergenic
1031042575 7:116854400-116854422 TGCAAAGCAGAGAGGTGGAGTGG - Intronic
1031072964 7:117182681-117182703 TGGTATTCAGAGACGTAGAGTGG + Intronic
1032273527 7:130433399-130433421 TGGTATGGAGAGAGTGGGAGAGG + Intronic
1032398479 7:131607650-131607672 TGGTCGGCAGAGGGGTAGACAGG + Intergenic
1032970108 7:137151306-137151328 AGGTAGCCAGAGAGGAGAAGAGG + Intergenic
1034134127 7:148749945-148749967 TGGTAAGGAGAAAGTTGGAGTGG + Intronic
1034413275 7:150952348-150952370 TGGGAGGTAGTGGGGTGGAGGGG - Intronic
1035638611 8:1165135-1165157 AGGAAGACAGAGAGGGGGAGAGG + Intergenic
1036149297 8:6283236-6283258 TGGCAGTGACAGAGGTGGAGAGG + Intergenic
1037222463 8:16541314-16541336 AGGTAGGAAGGGAGGAGGAGAGG + Intronic
1037791989 8:21953012-21953034 GGGTGGGGAGAGAGGGGGAGGGG - Intronic
1037982366 8:23263319-23263341 TGGTATGCAGAGAGGAGGTGTGG + Intergenic
1038017630 8:23528947-23528969 AGGTGGGCAGGGAGGGGGAGGGG - Exonic
1038046918 8:23773372-23773394 AGGTAGGGAAAGAGATGGAGGGG - Intergenic
1039201903 8:35104444-35104466 GGATAGGCAAAGAGGGGGAGAGG + Intergenic
1039408924 8:37335654-37335676 GGCTAGGCAGAGATGTGCAGAGG + Intergenic
1039966566 8:42288429-42288451 AGGTTGGGTGAGAGGTGGAGTGG + Intronic
1040284732 8:46093955-46093977 AGGTAGGCAGAGGGGAGAAGCGG + Intergenic
1040286110 8:46101251-46101273 AGGCAGGCAGAGAGGAGAAGCGG - Intergenic
1040288225 8:46111206-46111228 AGGTAGGCAGAGAGGAGAAGTGG - Intergenic
1040289136 8:46115477-46115499 AGGTAGGCAGAGGGGAGAAGCGG - Intergenic
1040289433 8:46116783-46116805 TGGCAGGCAGAGGGGAGAAGTGG - Intergenic
1040291816 8:46129459-46129481 TGGCAGGCAGAGGGGAGAAGCGG - Intergenic
1040295473 8:46146816-46146838 AGGCAGGCAGAGGGGTGAAGCGG - Intergenic
1040300183 8:46183925-46183947 AGGCAGGCAGAGAGGGGAAGTGG - Intergenic
1040305931 8:46211745-46211767 AGGCAGGCAGAGAGGAGAAGCGG + Intergenic
1040311088 8:46237215-46237237 AGGCAGGCAGAGGGGTGAAGCGG + Intergenic
1040319752 8:46286588-46286610 AGGCAGGCAGAGAGGAGAAGTGG - Intergenic
1040330991 8:46385676-46385698 AGGTAGGCAGAGGGGTTAAGCGG + Intergenic
1041436607 8:57848719-57848741 AGGTAGGCAGCAAGGTGTAGAGG - Intergenic
1041746317 8:61212310-61212332 AGGTAGGCAGTGAGGTGGCGGGG + Intronic
1043492398 8:80762794-80762816 TGATAGGCTGATAGGTGGAAAGG - Intronic
1043647595 8:82540326-82540348 TGGTGGACAGACAGGTGGTGAGG - Intergenic
1044132220 8:88538219-88538241 TGGGAGGCAAAGAAGTGGAAAGG - Intergenic
1045103111 8:98865306-98865328 TGGGAGGCTGAGAGGTATAGGGG - Intronic
1045947268 8:107810749-107810771 TGGCAGGCAGAGTGCTGGAATGG - Intergenic
1046031089 8:108784879-108784901 TGTTTTGCAGAGAGGAGGAGGGG + Exonic
1046463040 8:114567960-114567982 TGGCAGGCAGAGATGAGGGGTGG + Intergenic
1046622838 8:116546284-116546306 TGGTAGGCAAAGGCGTGAAGGGG + Intergenic
1047132529 8:122037109-122037131 TGGTAGACAGAGAGATGTAAAGG - Intergenic
1047326658 8:123845075-123845097 TGGCAGGTAGAGATGTGAAGTGG + Intergenic
1047684910 8:127295160-127295182 TGGGAGGCAGAGAGGTGGAGGGG + Intergenic
1048172761 8:132123294-132123316 TGGAGGGCAGAGAGGTGGAGGGG + Exonic
1049014257 8:139908399-139908421 TGATAGGCTGAGGGTTGGAGAGG - Intronic
1049021538 8:139960693-139960715 TGTTAGCCAGAGTTGTGGAGAGG + Intronic
1049079022 8:140426875-140426897 GGGAAGGCAGAGAGGTGAGGAGG - Intronic
1049230057 8:141477312-141477334 TGGCAGGCAGCAAGGTGGAGAGG - Intergenic
1049266751 8:141671652-141671674 TGGGAGGGACAGAGGTGAAGAGG + Intergenic
1049707131 8:144048183-144048205 TGGCTGGCAGGGAGGTGGAGGGG - Intergenic
1049887064 9:34800-34822 TGAAAGGGAGAGGGGTGGAGGGG + Intergenic
1050094658 9:2051475-2051497 TGGGAAGCAGGGAAGTGGAGCGG - Intronic
1050191263 9:3029038-3029060 GGGTAGGCAGAAAGGAGGAAGGG + Intergenic
1050243428 9:3661489-3661511 TGGCAGGCAGAGGACTGGAGAGG - Intergenic
1050694240 9:8261206-8261228 GGATGGGCAGGGAGGTGGAGGGG + Intergenic
1051015005 9:12463379-12463401 TGGGAGGGAGAGAGGGAGAGAGG - Intergenic
1052361758 9:27568979-27569001 TGGAAGGCAGTGAGGTGGAAGGG + Intronic
1052788693 9:32853888-32853910 TGAAAGGGAGAGTGGTGGAGTGG - Intergenic
1053123419 9:35561932-35561954 TGGAAGGGAGAGAGGTGGGTGGG - Exonic
1056419216 9:86407434-86407456 TGGATGGCAGGGAAGTGGAGTGG + Intergenic
1057152113 9:92805795-92805817 TGGTAGACATTGGGGTGGAGTGG - Intergenic
1057303475 9:93899617-93899639 TGGGAGACTGAGATGTGGAGAGG - Intergenic
1057307200 9:93919340-93919362 TGCTGGGCAGAGAGCTGGGGAGG - Intergenic
1057905494 9:98980050-98980072 TGGGAGGCTGAGAGGTGGAAGGG + Intronic
1057950520 9:99365966-99365988 TTGGGGGTAGAGAGGTGGAGTGG + Intergenic
1058236831 9:102500411-102500433 TGGGAGGCCGAGGGGTGGGGGGG + Intergenic
1058628976 9:106966493-106966515 TGGGAGTGAGAGAGATGGAGAGG - Intronic
1059191371 9:112330092-112330114 TGGGAGGCTGAGAGGTGGGCGGG - Intronic
1059941902 9:119367863-119367885 GAGAAGGCAGAGAGGTGGAGAGG - Intronic
1060010926 9:120042195-120042217 TGGTTGGTAGAGATGTAGAGAGG + Intergenic
1060394496 9:123305975-123305997 TGGAAGGCAGCCAGGTGCAGTGG - Intergenic
1060434886 9:123584835-123584857 AGGCAGGCAGAGAGGTGCTGGGG - Intronic
1060459735 9:123839321-123839343 GGGCAGGGATAGAGGTGGAGAGG - Intronic
1060985870 9:127818645-127818667 TGGTGGGAAGAAAGGCGGAGAGG + Intronic
1061120017 9:128636492-128636514 TAGTGGGGAGAGAGGTGGGGTGG - Intronic
1061869256 9:133511444-133511466 TGGTGGGGAGGGAGGTGGGGCGG + Intergenic
1061986158 9:134131494-134131516 TGGCAGGCACCGAGGTGGACAGG + Intergenic
1062243749 9:135552958-135552980 TGGGAGGCAGAGGCGTGGGGTGG - Intergenic
1062579668 9:137223660-137223682 TGGCAGGCAGGGAGGTGGGCGGG + Intergenic
1062597463 9:137305725-137305747 AGGGAGGCAGAGTGGTGCAGAGG - Intergenic
1203343935 Un_KI270442v1:18190-18212 TGGAATGCAGTGAAGTGGAGTGG + Intergenic
1203344234 Un_KI270442v1:20294-20316 TGGAATGCAGTGAAGTGGAGTGG + Intergenic
1185933520 X:4229960-4229982 AGGTAGGTAGATAGGTGGATAGG - Intergenic
1185933526 X:4229988-4230010 AGGTAGGTAGATAGGTGGATAGG - Intergenic
1186218333 X:7323918-7323940 AGGGAGTCAGAGAAGTGGAGGGG - Intronic
1186236203 X:7513620-7513642 TGCAAGGCACAGTGGTGGAGGGG + Intergenic
1186515398 X:10163170-10163192 TGCAAGGCTGACAGGTGGAGAGG - Intronic
1186559124 X:10591687-10591709 TGATAGGCAGGGAGGTGAAGGGG - Intronic
1187247047 X:17562191-17562213 TGGTAGGAAGAGAGGAGAAGGGG + Intronic
1187387528 X:18862170-18862192 TGGTTGGCAGGGAAGGGGAGGGG - Intergenic
1187554121 X:20335022-20335044 TGGGAGGCAGAGAGGTAGACTGG - Intergenic
1189304349 X:39975449-39975471 TGGCAGGCACAGAGGTAGAAAGG + Intergenic
1189380559 X:40499766-40499788 CGGTGGGCAGAGATGTGGAGGGG - Intergenic
1190107037 X:47568435-47568457 CTGTAGGCAGGGAGGGGGAGGGG + Intronic
1190326443 X:49209814-49209836 TGGTGGGTAGAGAGGCGGCGAGG - Intronic
1190427432 X:50346162-50346184 TGGCAGTGAGAGAAGTGGAGAGG - Intronic
1190484519 X:50911139-50911161 TGGAAGGGAGAGAAGTGGAGAGG + Intronic
1190741799 X:53293601-53293623 TGTTAGGGAGAGAGGCTGAGAGG - Intronic
1190743494 X:53306307-53306329 GGGCACCCAGAGAGGTGGAGGGG + Intronic
1190816137 X:53931473-53931495 TAGTAGGGAGAGAGGTGGAAGGG + Intergenic
1192082010 X:68057416-68057438 TGGGAGGCGGAGTTGTGGAGGGG + Intronic
1194686381 X:96922942-96922964 TGGTAGGATGAGAGGTGAAAAGG + Intronic
1196184518 X:112731614-112731636 TGGGGGGAAGAGAGGTGGGGTGG - Intergenic
1197253577 X:124239492-124239514 TGGGAGGTAGAGAGGCGGTGAGG - Intronic
1197735407 X:129847084-129847106 TGCAAGTCAGAGAGGTGGGGTGG - Intergenic
1197762216 X:130036000-130036022 TGTCAGACAGAAAGGTGGAGTGG + Intronic
1198017953 X:132630941-132630963 GGGGAGGCAGTGGGGTGGAGGGG - Intronic
1198507321 X:137313648-137313670 TTGAAGGCACAGAGATGGAGTGG - Intergenic
1199601703 X:149544999-149545021 TGGCACCCAGAGGGGTGGAGAGG + Intronic
1199648672 X:149934484-149934506 TGGCACCCAGAGGGGTGGAGAGG - Intronic
1199871245 X:151900803-151900825 TGCTTGGCACAGAGGAGGAGTGG - Intergenic
1199991900 X:152992131-152992153 TGGCAGCAAGAGAGGTAGAGTGG + Exonic
1200139714 X:153893679-153893701 TGGTAGGGGCAGTGGTGGAGGGG - Intronic
1200666272 Y:6029086-6029108 TGGAAGGCAGAGTAGTGGTGAGG - Intergenic
1201098227 Y:10651482-10651504 TGGAGTGCAGAGAAGTGGAGTGG - Intergenic
1201111556 Y:10803125-10803147 TGGAAAGGAGAGAAGTGGAGTGG - Intergenic
1201121513 Y:10877072-10877094 TGGAGGGCAGTGGGGTGGAGTGG - Intergenic
1201124526 Y:10901043-10901065 TGGAATGCAGTGGGGTGGAGTGG - Intergenic
1201129779 Y:10943884-10943906 TGGTAGGGAGTGAAGTGGAGTGG - Intergenic
1201135175 Y:10985038-10985060 TGGAATGGAGTGAGGTGGAGTGG - Intergenic
1201139476 Y:11016356-11016378 TGGAAGGCAGTGGAGTGGAGTGG - Intergenic
1201139918 Y:11019730-11019752 TGGTGTGCAGTGGGGTGGAGAGG - Intergenic
1201140246 Y:11021975-11021997 TGGAAGGGAGTGGGGTGGAGTGG - Intergenic
1201140955 Y:11027575-11027597 TGGAAGGGAAAGAAGTGGAGTGG - Intergenic
1201142018 Y:11036224-11036246 TGGAATGGAGAGAAGTGGAGTGG - Intergenic
1201142038 Y:11037122-11037144 TGGAATGGAGAGAAGTGGAGTGG - Intergenic
1201548830 Y:15197403-15197425 TGGTAGACAGAAATGTGCAGAGG + Intergenic
1201640641 Y:16172804-16172826 GGGAAGGCAGAGAGGGAGAGAGG + Intergenic
1201662174 Y:16412522-16412544 GGGAAGGCAGAGAGGGAGAGAGG - Intergenic
1202063393 Y:20911926-20911948 TGGTAGGCATAGAGGGGGACTGG - Intergenic
1202605753 Y:26638491-26638513 TGGAATGCGGAGAAGTGGAGTGG + Intergenic
1202606070 Y:26640719-26640741 TGGAAGGCGGTGAAGTGGAGTGG + Intergenic
1202606111 Y:26641055-26641077 TGGAATGCAGAGAAGTGGAGTGG + Intergenic
1202607091 Y:26648367-26648389 TGGAAGGCAGTGAATTGGAGTGG + Intergenic
1202607463 Y:26651240-26651262 TGGAAGGCAGTGAATTGGAGTGG + Intergenic
1202608304 Y:26657750-26657772 TGGAAGGCAGTGAATTGGAGTGG + Intergenic
1202608674 Y:26660643-26660665 TGGAAGGCAGTGAATTGGAGTGG + Intergenic
1202609040 Y:26663491-26663513 TGGAAGGCAGTGAATTGGAGTGG + Intergenic
1202609416 Y:26666344-26666366 TGGAAGGCAGTGAATTGGAGTGG + Intergenic
1202609925 Y:26670195-26670217 TGGAAGGCAGTGAATTGGAGTGG + Intergenic
1202610310 Y:26673067-26673089 TGGAAGGCAGTGAATTGGAGTGG + Intergenic