ID: 918131568

View in Genome Browser
Species Human (GRCh38)
Location 1:181634071-181634093
Sequence ACCGATCATGCCCTTTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 35}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918131560_918131568 10 Left 918131560 1:181634038-181634060 CCCACCAGTTTGCACCCCTTTCC 0: 1
1: 0
2: 1
3: 15
4: 196
Right 918131568 1:181634071-181634093 ACCGATCATGCCCTTTGTTGTGG 0: 1
1: 0
2: 0
3: 0
4: 35
918131565_918131568 -5 Left 918131565 1:181634053-181634075 CCCTTTCCATTAATGTGGACCGA 0: 1
1: 0
2: 0
3: 6
4: 70
Right 918131568 1:181634071-181634093 ACCGATCATGCCCTTTGTTGTGG 0: 1
1: 0
2: 0
3: 0
4: 35
918131561_918131568 9 Left 918131561 1:181634039-181634061 CCACCAGTTTGCACCCCTTTCCA 0: 1
1: 0
2: 1
3: 21
4: 247
Right 918131568 1:181634071-181634093 ACCGATCATGCCCTTTGTTGTGG 0: 1
1: 0
2: 0
3: 0
4: 35
918131559_918131568 27 Left 918131559 1:181634021-181634043 CCTTGGGTAATTGATGGCCCACC 0: 1
1: 0
2: 0
3: 2
4: 55
Right 918131568 1:181634071-181634093 ACCGATCATGCCCTTTGTTGTGG 0: 1
1: 0
2: 0
3: 0
4: 35
918131562_918131568 6 Left 918131562 1:181634042-181634064 CCAGTTTGCACCCCTTTCCATTA 0: 1
1: 0
2: 1
3: 19
4: 256
Right 918131568 1:181634071-181634093 ACCGATCATGCCCTTTGTTGTGG 0: 1
1: 0
2: 0
3: 0
4: 35
918131564_918131568 -4 Left 918131564 1:181634052-181634074 CCCCTTTCCATTAATGTGGACCG 0: 1
1: 0
2: 0
3: 4
4: 112
Right 918131568 1:181634071-181634093 ACCGATCATGCCCTTTGTTGTGG 0: 1
1: 0
2: 0
3: 0
4: 35
918131566_918131568 -6 Left 918131566 1:181634054-181634076 CCTTTCCATTAATGTGGACCGAT 0: 1
1: 0
2: 0
3: 5
4: 46
Right 918131568 1:181634071-181634093 ACCGATCATGCCCTTTGTTGTGG 0: 1
1: 0
2: 0
3: 0
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918131568 Original CRISPR ACCGATCATGCCCTTTGTTG TGG Intronic
902708120 1:18220575-18220597 ACAGTTCATGGCCTGTGTTGAGG + Intronic
911413149 1:97536562-97536584 ATCGATGATGCCCTTTCTTCAGG + Intronic
913016358 1:114739845-114739867 ACCCATTATGTCCATTGTTGTGG + Exonic
918131568 1:181634071-181634093 ACCGATCATGCCCTTTGTTGTGG + Intronic
1065693954 10:28362396-28362418 ACCGACCATGCCAAGTGTTGGGG + Intergenic
1073451480 10:103612181-103612203 CCCAATAATGCCTTTTGTTGAGG - Intronic
1074088056 10:110223677-110223699 ACCCAACATGGCCCTTGTTGAGG + Intronic
1078492362 11:11781303-11781325 CCCGCTCATGCCCATTATTGGGG + Intergenic
1088896323 11:114081311-114081333 ACAGACAATGCCCTATGTTGGGG + Intronic
1094676201 12:32622591-32622613 ATCTATCATGCTCTTTTTTGAGG + Intronic
1114139390 14:19893918-19893940 CCCTATCATGCCCTTTCCTGGGG + Intergenic
1135660604 16:24293251-24293273 ATAAATCATGCCCTTTGCTGGGG + Intronic
1135805715 16:25540726-25540748 ACCCATCATGGCCTGTGTTTTGG - Intergenic
1140137341 16:72218894-72218916 ACATGCCATGCCCTTTGTTGGGG - Intergenic
1141536882 16:84687820-84687842 AGGGATCATGCCTTGTGTTGAGG + Intergenic
1164545160 19:29154576-29154598 ACTGATTTTACCCTTTGTTGAGG + Intergenic
1165935859 19:39388664-39388686 ATCCATCATGCCCCTGGTTGGGG + Exonic
1166669971 19:44703931-44703953 TCCGGCCATGCCCCTTGTTGGGG + Intronic
1168630655 19:57953707-57953729 ACCTCTCATGTCCTTTGCTGTGG - Intergenic
931526994 2:63167553-63167575 AACCAACATGCCCTTTCTTGTGG - Intronic
947911850 2:233806606-233806628 ACTGATCATGACGTATGTTGGGG + Intronic
1182459277 22:30472466-30472488 ACAGTTCATTCACTTTGTTGGGG + Intergenic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
953925023 3:46978465-46978487 AGGGATCAGGCTCTTTGTTGGGG - Intronic
962240108 3:133744988-133745010 GCCGACCCTGCCCTTTGTTTTGG + Intergenic
978503958 4:109436730-109436752 ACCCATCATCCCCTTTGAAGGGG + Intronic
980603768 4:135061981-135062003 CCCAATCATGCACTGTGTTGTGG + Intergenic
994006465 5:94843405-94843427 ACCTCTGATGCCCTTTCTTGTGG - Intronic
1004285400 6:14316554-14316576 ACCCAGGATGCCCTTTCTTGGGG + Intergenic
1004971885 6:20919697-20919719 ACCAATCATGCCCATTGTACAGG - Intronic
1008048108 6:46872376-46872398 ATCGCTCATGGTCTTTGTTGGGG - Intronic
1026353903 7:69540834-69540856 TCCCATCATGCCCTGTGTTATGG + Intergenic
1038857368 8:31348392-31348414 ACAGATCATGACTTTTATTGAGG - Intergenic
1061748228 9:132755570-132755592 ACCGATTAAGCCCTGTGATGAGG - Intronic
1188750864 X:33904589-33904611 ACCACTAATCCCCTTTGTTGTGG + Intergenic
1191845860 X:65547517-65547539 CCCTTTCAGGCCCTTTGTTGAGG + Intergenic