ID: 918132556

View in Genome Browser
Species Human (GRCh38)
Location 1:181642573-181642595
Sequence AAGAGTGGCAAGCACCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 205}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918132556_918132562 26 Left 918132556 1:181642573-181642595 CCTTTCTGGTGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 9
4: 205
Right 918132562 1:181642622-181642644 AGCCCTGTAGAAGGGGCAAAGGG No data
918132556_918132559 18 Left 918132556 1:181642573-181642595 CCTTTCTGGTGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 9
4: 205
Right 918132559 1:181642614-181642636 CATCAGCAAGCCCTGTAGAAGGG 0: 1
1: 0
2: 0
3: 21
4: 237
918132556_918132560 19 Left 918132556 1:181642573-181642595 CCTTTCTGGTGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 9
4: 205
Right 918132560 1:181642615-181642637 ATCAGCAAGCCCTGTAGAAGGGG 0: 1
1: 0
2: 4
3: 19
4: 175
918132556_918132558 17 Left 918132556 1:181642573-181642595 CCTTTCTGGTGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 9
4: 205
Right 918132558 1:181642613-181642635 TCATCAGCAAGCCCTGTAGAAGG 0: 1
1: 0
2: 1
3: 12
4: 127
918132556_918132561 25 Left 918132556 1:181642573-181642595 CCTTTCTGGTGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 9
4: 205
Right 918132561 1:181642621-181642643 AAGCCCTGTAGAAGGGGCAAAGG 0: 1
1: 0
2: 1
3: 14
4: 225
918132556_918132563 27 Left 918132556 1:181642573-181642595 CCTTTCTGGTGCTTGCCACTCTT 0: 1
1: 0
2: 0
3: 9
4: 205
Right 918132563 1:181642623-181642645 GCCCTGTAGAAGGGGCAAAGGGG 0: 1
1: 0
2: 0
3: 14
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918132556 Original CRISPR AAGAGTGGCAAGCACCAGAA AGG (reversed) Intronic
900239703 1:1609969-1609991 AAAAGTGGCCAGTACCAAAATGG + Intergenic
906548439 1:46639908-46639930 AAAAATGGCAAACAGCAGAATGG + Intronic
906860483 1:49353737-49353759 AAGAGTGGCAGGCGGCAGAGCGG + Intronic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907425939 1:54379371-54379393 GTGAGTGGCCAGCACCAGGACGG + Intronic
912557184 1:110524797-110524819 AAGAGGGGCAGAGACCAGAAAGG - Intergenic
914793943 1:150903962-150903984 AAGGGAGGCAAGCACAAGACTGG + Intergenic
915230799 1:154444036-154444058 AAGAGTGGAGTGCAACAGAATGG - Intronic
915628047 1:157128428-157128450 AAGGGAGGCAAGCACGAGACTGG + Intronic
915847426 1:159281628-159281650 AAGAGAGGCAAGGAAAAGAAAGG + Intergenic
917418120 1:174832761-174832783 AGGAGTGGCAAGCTGGAGAAAGG - Intronic
918132556 1:181642573-181642595 AAGAGTGGCAAGCACCAGAAAGG - Intronic
921503947 1:215943063-215943085 AAGACTGACTAGCACCAGAAAGG + Intronic
922548074 1:226473477-226473499 GAGAGTGGCAAGCACGAGCTAGG - Intergenic
922777420 1:228221991-228222013 AAGAATGGCATGAACCAGAGAGG - Intronic
922886499 1:229024748-229024770 CAGAATGGGAAGGACCAGAAAGG - Intergenic
923209812 1:231793463-231793485 AAGAGTGGAAAACTCTAGAATGG + Intronic
923575094 1:235151186-235151208 AGGAGTGGCAAACACTAGCATGG + Intronic
1065356787 10:24850224-24850246 AACAGTGGCAAGCACAACATGGG + Intronic
1066133886 10:32423625-32423647 AGGAGTGAAGAGCACCAGAATGG - Intergenic
1070323711 10:75373908-75373930 AGGTGTGGCCAGCAGCAGAAGGG + Intergenic
1072323778 10:94276199-94276221 AAGAGAGGAGAGCACCAGACGGG - Intronic
1072482054 10:95818526-95818548 AAGTGTGGGAGTCACCAGAAAGG + Intronic
1072960946 10:99928443-99928465 AAAATTGGCCAGAACCAGAAAGG + Intronic
1073473291 10:103737080-103737102 AAGGGTGGCTAGCACAAGACAGG + Intronic
1075230072 10:120668800-120668822 AAGAGTGGGAAGTAGCTGAAAGG + Intergenic
1077720564 11:4624447-4624469 AAGAGTGGCAAGCCAAAAAATGG + Intergenic
1078051280 11:7967087-7967109 GAGAAAGGCAAGCACCAGAGGGG + Intergenic
1078420907 11:11211850-11211872 AAGAGTGGCAAGAACAATCAGGG - Intergenic
1080342379 11:31280898-31280920 AAGGGAGGCAAGCACAAGACTGG - Intronic
1082773277 11:57225627-57225649 AGGAGTGGCAAACAGGAGAATGG + Intergenic
1083185049 11:61012675-61012697 AAGAATGTGAAGCACAAGAATGG - Intronic
1084279851 11:68081037-68081059 AAGTGTGGGAACGACCAGAAAGG + Intronic
1085994891 11:81899555-81899577 AAAAGTATCAAGCACCAAAAAGG + Intergenic
1086350113 11:85936045-85936067 GAGGGTGGAAAGCACCAGACTGG - Intergenic
1087760929 11:102103776-102103798 GAGAGCAGCAAGGACCAGAATGG + Intergenic
1089083924 11:115800806-115800828 AAGAGGGCCAAGGGCCAGAAAGG + Intergenic
1089137853 11:116263831-116263853 GAGAGGGGAAAGCAACAGAAGGG + Intergenic
1090766262 11:129878883-129878905 AAAAGTGGTAAGCATCACAAAGG + Intronic
1092194502 12:6541229-6541251 AAAACTGGCAAGGAACAGAAGGG - Intronic
1092880830 12:12886649-12886671 AAGAGGGGCAAGGATCAGGAAGG - Intergenic
1092898524 12:13036944-13036966 AAGTGTGGCAAGCACAATGAAGG - Intergenic
1094841744 12:34345234-34345256 AAGAGTGGCTGGGACCAGCAGGG - Intergenic
1095239459 12:39839597-39839619 AATAGTGTCAAGCAGCACAAGGG - Intronic
1095797409 12:46235150-46235172 AAGAGAGGCAAGAAACAGAGAGG + Intronic
1095957358 12:47814278-47814300 AAGAGAGGACAGAACCAGAAAGG - Intronic
1096544267 12:52327011-52327033 CAGAATGGCAAGGATCAGAAAGG + Intergenic
1098300232 12:69046865-69046887 AAGAGTGCCAAGCTTCCGAAAGG + Intergenic
1099502131 12:83426968-83426990 AAGAATGGCAACCTACAGAACGG - Intergenic
1102052459 12:109872592-109872614 AAGAGTGGGACCCACCAGCACGG + Intronic
1102447108 12:113011637-113011659 TAGGGTGGCAAGCACTGGAAGGG - Exonic
1104663280 12:130627805-130627827 AAGGGTGGCCTGCACCAGGATGG - Intronic
1105471248 13:20696864-20696886 AATAATGAAAAGCACCAGAAAGG + Intergenic
1106971538 13:35146951-35146973 AAGTTTGGCAAGCATCAGTATGG + Intronic
1107192821 13:37610325-37610347 AAGAGTGGAAAGCACAGAAATGG + Intergenic
1107489159 13:40863819-40863841 AAGGGAGGCAAGCACAAGACTGG - Intergenic
1109551622 13:63910091-63910113 TAGAGTGGAAAGAGCCAGAAAGG - Intergenic
1109849841 13:68047992-68048014 AAAAGTGGCAGTCACCAGGAGGG - Intergenic
1110364890 13:74671209-74671231 AAGAATGGCAAGCAGCAACATGG - Intergenic
1112367632 13:98769145-98769167 AAGTGTGGCATGGAACAGAATGG - Intergenic
1115037749 14:28881120-28881142 ATGAGTGGCAAACACAACAAGGG + Intergenic
1115364804 14:32545997-32546019 AAGACTGGCTGGCAGCAGAAGGG - Exonic
1116064560 14:39966440-39966462 CAGAGGGAAAAGCACCAGAAGGG + Intergenic
1117480696 14:56141371-56141393 AAGATTGGCTGGCACGAGAATGG + Intronic
1117696491 14:58369895-58369917 AGGAGGGGAAAGCTCCAGAAGGG + Intronic
1118398439 14:65356988-65357010 AGGAGAGGTAAGAACCAGAAGGG + Intergenic
1118749330 14:68795029-68795051 AAATCTGGCAAGCGCCAGAAAGG + Intronic
1118934699 14:70276552-70276574 AAAAGTTACAAGGACCAGAAAGG + Intergenic
1120900015 14:89567643-89567665 ATGAGTGGCAAGGACAAGGAAGG + Intronic
1126262135 15:46705434-46705456 AAGTGTGGCAAGCTTGAGAAAGG - Intergenic
1126421356 15:48476538-48476560 AGGAGTGCCAATCACCAGATGGG - Intronic
1127297933 15:57626495-57626517 AAGAATGGGAAGCACTTGAAGGG - Intronic
1129378780 15:75152602-75152624 GGGTGTGCCAAGCACCAGAAAGG + Intergenic
1130681294 15:85999146-85999168 TAGAGTGCTCAGCACCAGAAAGG - Intergenic
1130805847 15:87321136-87321158 AAGAGATGTATGCACCAGAATGG + Intergenic
1131022695 15:89112733-89112755 AAGAGAGGCAAGCAAGAAAATGG - Intronic
1132354056 15:101158383-101158405 AATAGTTCCAAGCAGCAGAACGG - Intergenic
1135991760 16:27222839-27222861 AAGAGAGACAAGCAGCAGGAGGG + Intergenic
1137438331 16:48476929-48476951 AAGAATGACAAACAGCAGAAAGG - Intergenic
1144970771 17:19108166-19108188 AAGACTGGCAGGCAGCAGACAGG - Intergenic
1144991073 17:19234328-19234350 AAGACTGGCAGGCAGCAGACAGG - Intronic
1146284930 17:31567950-31567972 AAGAGGGGCAAGAGACAGAAGGG + Intergenic
1146677769 17:34785244-34785266 AAGCCTGGCAGGCAACAGAAGGG + Intergenic
1148978491 17:51550247-51550269 AAGGTTGGCAAGACCCAGAAGGG - Intergenic
1152937413 17:83148495-83148517 CACAGTGGCTAGCACTAGAAAGG + Intergenic
1164146182 19:22513978-22514000 AAGAGTGGCCAGAATCTGAATGG + Intronic
1164293222 19:23886191-23886213 AACAGTGGCCATTACCAGAAAGG + Intergenic
1167778440 19:51578406-51578428 AAAAGAAGCAAGCCCCAGAATGG + Intronic
1168119726 19:54245052-54245074 AAGCGATTCAAGCACCAGAAGGG + Intronic
925035099 2:678923-678945 AAGAAAGGCAGGCACCAGACAGG - Intergenic
926061485 2:9807662-9807684 AAGAGTCCCCAGCGCCAGAAGGG - Intergenic
929815681 2:45229466-45229488 AAGAGTGGCAAGGACCAGCCTGG + Intergenic
930752060 2:54943992-54944014 GAGAGAGGGAGGCACCAGAAGGG - Intronic
932143906 2:69302346-69302368 AATAGTGGCCAGCACAAGCAGGG - Intergenic
933111941 2:78413014-78413036 AAGGGAGGCAAGCACAAGACTGG - Intergenic
935608057 2:104990605-104990627 AAGAGTGGCTTGAACCAGACTGG + Intergenic
940030822 2:149259451-149259473 AGGAGTGGTAAGCAGCCGAATGG + Intergenic
940460221 2:153955647-153955669 AGGACTGGCAAGCCCCAGAGTGG + Intronic
941372726 2:164687107-164687129 AAGAGTTGCCACCAGCAGAAGGG + Intronic
941808417 2:169733225-169733247 TAGAGTGGCCGTCACCAGAAAGG + Intronic
942013694 2:171789913-171789935 GAGACTGGTAAGTACCAGAAAGG + Intronic
945205189 2:207324039-207324061 ATGACTGGCAGGGACCAGAATGG + Intergenic
945797020 2:214377818-214377840 AGGTGTGGCAAGCACAATAATGG + Intronic
1170100924 20:12698661-12698683 AAGAGAAGCAGGCAACAGAATGG - Intergenic
1174290799 20:49507226-49507248 TAGAGTGACAGGCACCAGATGGG - Exonic
1174394573 20:50238915-50238937 AAGAGAGGCAACCCCCAGCAGGG - Intergenic
1174612067 20:51806031-51806053 AAGAGAGGCAAGCAGTGGAAAGG - Intergenic
1174649665 20:52113804-52113826 AAGACAGGCAAGATCCAGAAGGG + Intronic
1177790281 21:25715384-25715406 AGCAGTGGCAAGCAGCAGTAGGG - Intronic
1179086148 21:38219587-38219609 CAGAGTGGCAAGCAAATGAAAGG - Intronic
1182063871 22:27416851-27416873 AAGGCTGGCAGGCACCAAAAGGG + Intergenic
1185030362 22:48439769-48439791 GAGGGTGGCAAAGACCAGAAGGG + Intergenic
950301044 3:11879032-11879054 AAGAGAGGCAAGCACAAGACTGG - Intergenic
951102725 3:18708050-18708072 AAGATTTGGAAGCACCATAAGGG + Intergenic
951657188 3:25022788-25022810 ATGAGTGGCAAGAAGCAGCATGG + Intergenic
954789554 3:53121568-53121590 AGGAGGTGGAAGCACCAGAAGGG - Intronic
955153544 3:56392972-56392994 TTGAGTGGGAGGCACCAGAAAGG - Intronic
955912713 3:63874068-63874090 TAGAGTGGTAAGTACCAGTAAGG - Intronic
960159455 3:114334207-114334229 AACAGAGGAAAGCTCCAGAATGG + Intergenic
960417485 3:117402276-117402298 AACAGTGGCAAGTACTATAAAGG - Intergenic
962662195 3:137613870-137613892 GAGAATGGCAGGCACCAGGAGGG - Intergenic
963602629 3:147391291-147391313 GAGGGTGGCAAGCACCTGACGGG - Intronic
965378422 3:167956526-167956548 AAGAGGGGCAAGCACAAGACTGG - Intergenic
966006352 3:175017948-175017970 CAGAGTGGCAAGCATATGAAAGG + Intronic
967972080 3:195006394-195006416 AAGCATGGCAAGGACCAGTAGGG + Intergenic
968019046 3:195367533-195367555 GAGAGTGGCACGCACCTGCAGGG - Intronic
968809712 4:2794354-2794376 CAGAGTGGGAAGAACCAGGAGGG - Intronic
969441102 4:7217232-7217254 CAGTGGGGCAAGCGCCAGAAAGG - Intronic
969966370 4:11000958-11000980 GAGAGTGGTAAGCACTATAAAGG - Intergenic
973588381 4:52414687-52414709 AAGAGGGGCTACCAGCAGAAGGG + Intergenic
973795635 4:54423334-54423356 AAGAAAGGAGAGCACCAGAAAGG + Intergenic
975709082 4:77141153-77141175 TTGTGTGGCAGGCACCAGAATGG - Intergenic
976522544 4:86045811-86045833 AAGAAAGGCAAGCAGAAGAAAGG - Intronic
977053518 4:92161181-92161203 AATGGTGGTAAGCACCATAAAGG + Intergenic
981638615 4:146910497-146910519 AGGAGTGGCAAGCAGGAGAGTGG + Intronic
981805953 4:148715356-148715378 AAGACTGGGAATCACTAGAAAGG + Intergenic
982781492 4:159495872-159495894 GAGGGTGGGAAGCCCCAGAAGGG + Intergenic
983546949 4:168975172-168975194 AAGGGTGGCTAGACCCAGAAGGG - Intronic
984447028 4:179849747-179849769 AAGAGTGGCCAACACAAGAAAGG + Intergenic
984812499 4:183807397-183807419 AAGAGTGGAAAGCATCCCAAAGG - Intergenic
985241032 4:187930928-187930950 AAGAGAGACAAGAACTAGAAAGG + Intergenic
992175337 5:74144102-74144124 ACGACTGCCAAGCAGCAGAAGGG + Intergenic
994569907 5:101502952-101502974 AAGAGAAGGAAGCACCAGGAAGG + Intergenic
994653664 5:102562048-102562070 AAGCATGGCAAGTACCTGAAGGG + Intergenic
996932565 5:128908079-128908101 AAGAGAAGCAAGCAAAAGAATGG - Intronic
1003184195 6:3816435-3816457 AAGACTGTCAAGACCCAGAAAGG - Intergenic
1005813664 6:29533701-29533723 AGCAGGGCCAAGCACCAGAAAGG + Intergenic
1007158182 6:39766606-39766628 AAGATTACCAAGCACCAGACAGG + Intergenic
1007210479 6:40189861-40189883 AAGTGAGGCAAGCTCCACAAAGG + Intergenic
1007323050 6:41040955-41040977 AAGAGTGGCAAGAACTAGCTTGG - Intronic
1009434118 6:63598755-63598777 AAGAGAGGCAAGACACAGAATGG + Intergenic
1010257351 6:73774382-73774404 AATAGAGGCAAGCAGCAGAAAGG - Intronic
1010458051 6:76081993-76082015 AAGAGAGAGAAGCACCAGTAGGG + Intergenic
1011484679 6:87829598-87829620 ATAAGTGGCCAGCAACAGAAAGG - Intergenic
1011700747 6:89952036-89952058 AACAGTGGCATGCACGAGACAGG - Intronic
1014057191 6:117029809-117029831 AAGATTGGAAAGCCACAGAACGG + Intergenic
1015094584 6:129399651-129399673 AGGAGTGGCTATTACCAGAATGG + Intronic
1015668583 6:135660464-135660486 AACAGTGGTAATCCCCAGAAAGG - Intergenic
1016494479 6:144644748-144644770 AAGAGTTGCCAGTACCAAAATGG + Intronic
1018776658 6:167023445-167023467 AAGAGTGGCAAGAGCAAGAGTGG + Intronic
1019744432 7:2691769-2691791 CAGGGTGGCAGGCACCGGAAGGG + Intronic
1021045046 7:15912481-15912503 GAGGGTGGCAAGCTACAGAATGG + Intergenic
1021300273 7:18964162-18964184 AAGAGTAGAAAGCAGTAGAATGG - Intronic
1021777127 7:24064985-24065007 CTGAGTGGCAAGCAAAAGAAAGG - Intergenic
1021884303 7:25124031-25124053 AAGGGAGGCAAGCACAAGACTGG - Exonic
1024286901 7:47765684-47765706 AAGAGTGGCAGGCCCCTCAAAGG + Intronic
1024344253 7:48296813-48296835 GAAAGTGTAAAGCACCAGAAGGG + Intronic
1024988296 7:55214390-55214412 GAGAGGGGCAGGCACCAGATTGG + Intronic
1026125535 7:67576304-67576326 CAGAGTGGAAATCCCCAGAAAGG - Intergenic
1026440321 7:70438334-70438356 AAGAGTGGCAATGGCAAGAAGGG + Intronic
1026767753 7:73171300-73171322 AAGACTTGCAAGCACCATATGGG - Intergenic
1027044220 7:74981008-74981030 AAGACTTGCAAGCACCATATGGG - Intronic
1027079422 7:75221350-75221372 AAGACTTGCAAGCACCATATGGG + Intergenic
1028621970 7:92835668-92835690 AAGCCTGCCAAGCACCACAAGGG + Intronic
1029388644 7:100259933-100259955 AAGACTTGCAAGCACCATATGGG + Intronic
1030994843 7:116347704-116347726 AAGAGTGCCACACACCAGAATGG - Intronic
1031861108 7:126981311-126981333 TAGAGTGCAAAGCCCCAGAATGG - Intronic
1034020555 7:147637242-147637264 AAGGGTGGAAAGCAGCAGACTGG + Intronic
1036293045 8:7511847-7511869 AAGAGTGGGAACCATGAGAATGG - Intergenic
1036329516 8:7809153-7809175 AAGAGTGGGAACCATGAGAATGG + Intergenic
1037037791 8:14189404-14189426 AAGAGAAGCAAGAACCAGAGAGG - Intronic
1040526359 8:48228695-48228717 AAGAGTGGCAAGAAAAAAAATGG - Intergenic
1040755024 8:50762710-50762732 AAGGGAGGCAAGCACAAGACTGG - Intronic
1041520557 8:58751329-58751351 ACCAGTGGCAAGCAAAAGAAGGG + Intergenic
1041763577 8:61393673-61393695 AAGGGTGGCTAGACCCAGAAGGG - Intronic
1042647227 8:71000730-71000752 GAGCATGGCAAACACCAGAAAGG - Intergenic
1047114577 8:121826765-121826787 AAGAGGGGGAAGGAACAGAAAGG - Intergenic
1047380294 8:124355757-124355779 AAGAGGGGCAGGCACCTGCAAGG + Intronic
1048595085 8:135858139-135858161 AAGGGAGGCAATGACCAGAAGGG - Intergenic
1049125918 8:140787771-140787793 GTGTGTGGCAAGCACCAAAAGGG + Intronic
1050034941 9:1425005-1425027 AACACTGGCAAGCAAAAGAAAGG - Intergenic
1050638689 9:7641880-7641902 AGCAGTGGCAACCAGCAGAAAGG + Intergenic
1050774847 9:9246970-9246992 ATGAGTGGCAAGAGACAGAAGGG - Intronic
1057075130 9:92134625-92134647 CAGGGTGGCAGGGACCAGAAAGG + Intergenic
1058670129 9:107354342-107354364 AAGGGTGGCAACCACCAGTGAGG - Intergenic
1058755922 9:108083172-108083194 CAGAGTTGCAAGTTCCAGAAAGG - Intergenic
1058934105 9:109751921-109751943 AAGTGTAGCAAGAACCAGAAAGG + Intronic
1060224267 9:121781808-121781830 AAGAGTGGAAGCCACCAGGAGGG + Intronic
1060774624 9:126363888-126363910 AAGAGTGGTAAGCACTGCAATGG - Intronic
1060836001 9:126755572-126755594 GAGAGAAGCAAGAACCAGAAGGG + Intergenic
1203655380 Un_KI270752v1:19097-19119 AAGAGTGGGTAGCACTAGGAAGG + Intergenic
1186685376 X:11919784-11919806 AAGAGGGGCAAGGAGGAGAAGGG - Intergenic
1186690046 X:11965708-11965730 GAGAGTGGAAAGCAACAGACAGG - Intergenic
1190191596 X:48281100-48281122 AAGAGTGTCAGCCCCCAGAAAGG - Intergenic
1192736009 X:73850589-73850611 AGCCGTGGCAAGGACCAGAATGG - Intergenic
1194755392 X:97733141-97733163 AAGAGTGGTAAGCTTCAGGAAGG + Intergenic
1196488275 X:116239541-116239563 AAGAGTGTCCATCACCAGAAGGG + Intergenic
1196613562 X:117742245-117742267 AAAAGAGGCATCCACCAGAATGG + Intergenic
1196799648 X:119531167-119531189 AAGACTGGAAAGCAAGAGAAGGG + Intergenic
1198424975 X:136508843-136508865 AAGTATGGCAGGCAGCAGAAGGG - Intronic
1199439884 X:147855954-147855976 TTGAGTGGAAAGCTCCAGAAGGG - Intergenic
1199878365 X:151953361-151953383 ACCAGTGGCAAGGCCCAGAATGG - Exonic
1200130523 X:153841317-153841339 AAGGGAGGCAAGCACAAGACTGG + Intergenic
1200174599 X:154104735-154104757 AAGAATGTCAAGAAACAGAAAGG + Intergenic
1201116427 Y:10838738-10838760 AGGAGTGGAAAGGAACAGAATGG - Intergenic