ID: 918134330

View in Genome Browser
Species Human (GRCh38)
Location 1:181658313-181658335
Sequence CATGGGAAACAGTTGTACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918134330 Original CRISPR CATGGGAAACAGTTGTACAT TGG Intronic
901565103 1:10107525-10107547 CATGGGATAAAGTAGCACATAGG + Intronic
903987382 1:27238570-27238592 CATGGGAATCACTTGAACCTGGG - Intronic
904448856 1:30598156-30598178 CATGGTAAGCAGTTACACATCGG + Intergenic
905147896 1:35902246-35902268 CGGGGGAAACAGTTCTACAATGG + Exonic
906417398 1:45631353-45631375 CATGAGAATCACTTGAACATGGG - Intronic
907285311 1:53376167-53376189 CAAGGGAAACAGTTCTGCGTTGG + Intergenic
907507894 1:54934807-54934829 CATGGGAATCATTTGAACCTGGG + Intergenic
907793969 1:57695805-57695827 CAGGGGAATCAGTTGAACCTAGG + Intronic
908067815 1:60426563-60426585 CATGAGAATCACTTGTACCTGGG - Intergenic
908343965 1:63212342-63212364 AATTAGAAACAGTTGTTCATAGG + Intergenic
908596913 1:65697914-65697936 CATGAGAAACACTTGAACCTGGG - Intergenic
909555628 1:76950589-76950611 CATGGGTAACAGTTATATAAGGG + Intronic
911820024 1:102406678-102406700 CATGAGAATCATTTGAACATGGG - Intergenic
911892761 1:103393472-103393494 CATGAGAATCACTTGAACATGGG - Intergenic
915429119 1:155852070-155852092 CAGGGGAATCACTTGAACATGGG + Intronic
917080192 1:171249831-171249853 CACTGGAAACAGTTAAACATTGG + Intronic
917980894 1:180268356-180268378 CAAGAGAAACAGATGTAGATTGG + Intronic
918134330 1:181658313-181658335 CATGGGAAACAGTTGTACATTGG + Intronic
918847148 1:189631219-189631241 GATAGGAAATATTTGTACATAGG + Intergenic
919330524 1:196164476-196164498 CATGGGAGAAAGATGTACACTGG - Intergenic
919887424 1:201945109-201945131 CATGGGAAAGAGTGTTGCATAGG - Intronic
919929658 1:202213216-202213238 CATGGGGAAGTGTTGGACATCGG - Intronic
920538099 1:206753730-206753752 CATGGGAATCACTTGAACCTGGG + Intergenic
921780716 1:219159612-219159634 CATGGGCAAAAGTTATACATTGG - Intergenic
922699986 1:227753631-227753653 CATCGGAGGCAGTTTTACATAGG + Intronic
1062995496 10:1862390-1862412 CCTGGGAAACAGTTTGACAGAGG + Intergenic
1067207851 10:44234715-44234737 CATGAGAAACAGCTGAACACAGG - Intergenic
1069054511 10:63830761-63830783 CATGGGAATCATTTGAACCTGGG + Intergenic
1070006517 10:72429325-72429347 CAAGGGAATCAGTTGAACCTGGG + Intronic
1070102581 10:73402109-73402131 TATGGGAAACAATGGTACAATGG + Intronic
1070417170 10:76201733-76201755 CATCGGCACCAGTTTTACATAGG - Intronic
1071753083 10:88503286-88503308 CATGAGAATCACTTGAACATGGG + Intronic
1074012182 10:109493512-109493534 CATGGGAATCACTTGAACCTGGG - Intergenic
1077700615 11:4438655-4438677 CATGGGACACAATTTTAGATAGG + Intergenic
1077773421 11:5245634-5245656 CATGGAAAACAATTGGAAATGGG - Intergenic
1078343777 11:10524522-10524544 CATTGGAAAAAGATTTACATGGG - Intronic
1079218557 11:18538010-18538032 GATGAGAAACAGGTGAACATTGG - Intronic
1080111281 11:28570740-28570762 TATGGGAACAAGTTGTACCTAGG - Intergenic
1081445516 11:43128057-43128079 AACCGGAAACAGTTGTGCATTGG + Intergenic
1082763075 11:57145358-57145380 CATGGCAGACAGTTGTGCAGCGG - Intergenic
1085035815 11:73299414-73299436 CATGGGAATCACTTGAACCTGGG + Intergenic
1086406941 11:86506736-86506758 CATGGGGAAAACTTGGACATAGG - Intronic
1090750417 11:129742115-129742137 CAGGGGAATCATTTGAACATGGG - Intergenic
1091733334 12:2897983-2898005 CATGAGAATCACTTGAACATGGG + Intronic
1093306625 12:17528198-17528220 CCTGGAAAACAATTGTACCTTGG + Intergenic
1093970870 12:25374872-25374894 CATAGGAAACTGATGTATATAGG + Intergenic
1097420426 12:59371826-59371848 AATGGGGTACATTTGTACATGGG + Intergenic
1099591459 12:84596395-84596417 TGTTGGAAACAGTTGTGCATTGG + Intergenic
1101980219 12:109399497-109399519 CATGAGAAACACTTGAACTTGGG + Intronic
1102884821 12:116513484-116513506 CATGGGAATCACTTGAACCTGGG + Intergenic
1109407990 13:61925642-61925664 CATGGGAAACTTGTTTACATTGG - Intergenic
1109442004 13:62386600-62386622 CATAGGAAACAGTAATACAAAGG + Intergenic
1110568242 13:76977501-76977523 CAGGGGAGACACTTGTATATTGG + Intergenic
1111062341 13:83038676-83038698 CATGGGATTCACTTGTAAATAGG + Intergenic
1111553030 13:89840536-89840558 CATGAAAAACATTTTTACATAGG + Intergenic
1112667339 13:101590831-101590853 CATTGCAAACAGATCTACATTGG - Intronic
1113209845 13:107964145-107964167 AATGGAAAAGAGTTGTAGATGGG - Intergenic
1115865394 14:37741379-37741401 CATGGGAATCACTTGAACCTGGG - Intronic
1116941941 14:50799141-50799163 CATGGGAAAGAGCTGTGCTTTGG + Intronic
1117073659 14:52079068-52079090 CAGGGGAAATAGTGGTACACTGG - Intergenic
1117983005 14:61360410-61360432 CATGAGAATCATTTGAACATGGG + Intronic
1120516475 14:85476799-85476821 CATGGGAAAAAGTGGTCCAAGGG + Intergenic
1122930265 14:104929981-104930003 CATGGGCACCTGTCGTACATGGG - Exonic
1127149436 15:56058140-56058162 CATGAGAAACACTTGAACCTGGG - Intergenic
1127167455 15:56261622-56261644 CATGGGAATCACTTGAACCTGGG + Intronic
1127664817 15:61135236-61135258 CATGAGAAACACTTGAACACAGG + Intronic
1127907981 15:63391168-63391190 CATGAGAATCAGTTGAACCTGGG - Intergenic
1129004552 15:72361355-72361377 CCTGGGTAACATTAGTACATTGG - Intronic
1129545596 15:76391688-76391710 CTTGAGAAACAGCTGTTCATTGG - Intronic
1130179605 15:81611796-81611818 CAGGGGAGACAGTGGTAAATTGG - Intergenic
1130384962 15:83403162-83403184 CTAGGGAGACAGTTGAACATTGG + Intergenic
1132795156 16:1716964-1716986 CAGGAGAAACAGTTGAACCTGGG + Intronic
1134511825 16:14854768-14854790 CAGGGGTTGCAGTTGTACATAGG + Intronic
1134699468 16:16253267-16253289 CAGGGGTTGCAGTTGTACATAGG + Intronic
1134972361 16:18541404-18541426 CAGGGGTTGCAGTTGTACATAGG - Intronic
1135964239 16:27022675-27022697 CATGGGAATCACTTGAACATGGG + Intergenic
1138443841 16:57050943-57050965 CATGGGAATCACTTGAACCTGGG - Intronic
1138513777 16:57524482-57524504 CAGGAGAAACACTTGAACATGGG + Intronic
1138974565 16:62188116-62188138 CCTGTGTAACAGTTATACATTGG - Intergenic
1140469515 16:75206359-75206381 CATTGGACTCAGTTGTACCTGGG - Intronic
1144878416 17:18416404-18416426 CATGAGAATCAGTTGAACCTGGG + Intergenic
1145153817 17:20527989-20528011 CATGAGAATCAGTTGAACCTGGG - Intergenic
1146318559 17:31828453-31828475 CATGAGAATCACTTGAACATGGG - Intergenic
1148060593 17:44833343-44833365 CATGAGAATCAGTTGAACCTGGG - Intergenic
1148163494 17:45465615-45465637 CATGAGAATCAGTTGAACTTAGG + Intronic
1148914724 17:50966246-50966268 CATGGGAAACAGGTGGAGATGGG - Exonic
1149036284 17:52137950-52137972 AATGGGAAACTGATGCACATAGG - Intronic
1149415305 17:56453557-56453579 CAAGGGTGACAGTTGTACACTGG - Intronic
1149665238 17:58360668-58360690 CATGGGAAACAGATGTAGCCAGG + Intronic
1149773320 17:59338553-59338575 CATGGGGAACAGTTGTGCAGAGG + Intronic
1149773363 17:59338904-59338926 CCTGGGAAACAGTTTTTCAGGGG - Intronic
1150233771 17:63575593-63575615 CATGAGAATCACTTGAACATGGG + Intronic
1150300254 17:64041909-64041931 CATCGGAAACAGTTGTCTCTAGG + Exonic
1150965038 17:69958542-69958564 CAACGGAAACAGTTGTATAAGGG + Intergenic
1151268383 17:72974190-72974212 CATGAGAATCAGTTGAACCTGGG - Intronic
1155871524 18:31034805-31034827 CATGGGAAGTGGTTGTAAATGGG + Intronic
1156136192 18:34041471-34041493 TATGGGAAATAGTTATCCATGGG + Intronic
1156956367 18:42969566-42969588 AATGGGAAACAGTTGTAGTTTGG - Intronic
1157017068 18:43728206-43728228 CATGAGAATCACTTGAACATGGG - Intergenic
1157878394 18:51294984-51295006 CATGGGAATCACTTGAACCTGGG - Intergenic
1157943163 18:51951257-51951279 CATGGGAAATATTTGAAGATTGG - Intergenic
1158893948 18:61896002-61896024 CATGGGTATCAGTTGTCCCTGGG + Intergenic
1159007253 18:63024109-63024131 CATGAGAATCAGTTGAACCTTGG - Intergenic
1159163690 18:64676070-64676092 CTTAGGAAACAGTTAAACATTGG - Intergenic
1159815183 18:73065146-73065168 AATGGGAAACATTAGTACTTGGG + Intergenic
1159936823 18:74375545-74375567 CATGAGAATCACTTGAACATGGG + Intergenic
1160894985 19:1398188-1398210 CATGAGAATCACTTGAACATGGG - Intronic
1164184400 19:22849935-22849957 CATGAAAAACAGTTTAACATAGG - Intergenic
1164982581 19:32625521-32625543 CATGAGAATCAGTTGAACCTGGG - Intronic
1165809415 19:38601868-38601890 CATGAGAATCAGTTGAACTTGGG - Intronic
1166145646 19:40833074-40833096 CATGGGTATCTGGTGTACATGGG + Intronic
1166622367 19:44313255-44313277 CATGAGAATCACTTGTACCTGGG + Intergenic
1168556150 19:57342301-57342323 CATGAGAATCAGTTGAACTTGGG - Intergenic
925236068 2:2278795-2278817 TATGGGAAACAGTAGGACAGTGG + Intronic
925499088 2:4484309-4484331 CATGGGAAAAAGATGTAGGTTGG + Intergenic
926722171 2:15968958-15968980 CATGGGGATCAGTTGCACCTGGG - Intergenic
927646097 2:24877857-24877879 CAAGGGCAACAGCTGTACCTGGG + Intronic
927797897 2:26067424-26067446 CATGGAAAAAATATGTACATAGG - Intronic
928002700 2:27538736-27538758 CAGGGGAAACACTTGAACCTGGG + Intronic
929661115 2:43785639-43785661 CATGGGAATCACTTGAACCTGGG + Intronic
931606024 2:64052947-64052969 CATGGGAAAAAATTGTGCCTTGG + Intergenic
931979311 2:67677521-67677543 CCTGGGAAACAGGTCTGCATGGG - Intergenic
932155657 2:69414523-69414545 CATGAGAAACACTTGAACCTGGG + Intronic
933620387 2:84532105-84532127 GATGAGAATCAGTTCTACATGGG - Intronic
934648904 2:96076603-96076625 CATGGGAATCACTTGAACCTGGG + Intergenic
934964172 2:98705466-98705488 CTGGGGTAACAGTTGTAAATTGG - Intronic
936273329 2:111069242-111069264 CATGAGAATCACTTGAACATGGG - Intronic
939677433 2:145090019-145090041 TATGGGAAAAAGTTATAAATGGG + Intergenic
940264341 2:151820565-151820587 CATGAGAATCAGTTGAACCTGGG + Intronic
940610579 2:155986076-155986098 CAGGGGCAACAGTTGAACAGAGG + Intergenic
940674037 2:156706855-156706877 CATGGAAAACATATTTACATTGG + Intergenic
941064497 2:160885818-160885840 TGTGGGACACAGTGGTACATGGG - Intergenic
941117433 2:161488154-161488176 CGTGGGAAACAGTGGAAGATAGG - Intronic
941624107 2:167811354-167811376 CATGGGAAACACTTTCACAGCGG + Intergenic
943124588 2:183780873-183780895 CATGAGAATCACTTGAACATGGG + Intergenic
944834729 2:203567657-203567679 AATGGAAAACAGTTCTTCATAGG + Intergenic
945187618 2:207155724-207155746 CAGGGGAATCAGTTCTGCATAGG + Intronic
945449873 2:209981483-209981505 CATGGGAACCACTTGAACCTGGG + Intronic
946204371 2:218092881-218092903 TAGGGGAAACTGATGTACATTGG - Intergenic
946550772 2:220799918-220799940 CAGGAGAAACAGTTGAACCTGGG - Intergenic
948070480 2:235117788-235117810 CCTGGGGATCAGTTTTACATGGG + Intergenic
948967044 2:241390716-241390738 CAAAGGCAATAGTTGTACATAGG + Intronic
1169221349 20:3824837-3824859 CATGGGAATCACTTGAACCTGGG + Exonic
1170439270 20:16361707-16361729 GATGGCAAACTGTTGGACATTGG + Intronic
1172027717 20:31960396-31960418 CCTGGGATCCAGTGGTACATAGG + Intergenic
1172069389 20:32245446-32245468 CATGAGAATCAGTTGAACCTGGG - Intergenic
1172241963 20:33419019-33419041 CATGAGAATCACTTGAACATGGG + Intronic
1173359147 20:42324373-42324395 AATAGGAATCAATTGTACATGGG + Intronic
1174345633 20:49927489-49927511 CATGGGAAATAGTTGGAAAATGG + Intergenic
1174497965 20:50962640-50962662 CATGAGAATCACTTGAACATGGG - Exonic
1176390366 21:6160072-6160094 CATGGGACCCAGGTGTGCATGGG + Intergenic
1176390370 21:6160089-6160111 CATGGGACCCAGTTGTGCATGGG + Intergenic
1176390413 21:6160267-6160289 CATGGGACCCAGGTGTGCATGGG + Intergenic
1176390417 21:6160284-6160306 CATGGGACTCAGATGTGCATGGG + Intergenic
1176587390 21:8601326-8601348 CATGGGAGACAGATGTAGAATGG + Intergenic
1178095379 21:29209406-29209428 CAGGGGAATCAGTTGAACTTGGG + Intronic
1179733050 21:43377956-43377978 CATGGGACTCAGATGTGCATGGG - Intergenic
1179733054 21:43377973-43377995 CATGGGACCCAGGTGTGCATGGG - Intergenic
1179733067 21:43378024-43378046 CATGGGACCCAGGTGTGCATGGG - Intergenic
1179733096 21:43378151-43378173 CATGGGACCCAGTTGTGCATGGG - Intergenic
1179733100 21:43378168-43378190 CATGGGACCCAGGTGTGCATGGG - Intergenic
1179945018 21:44667401-44667423 CATGGAAATCACTTGTCCATAGG + Intronic
1180256499 21:46633339-46633361 CATGGGAATCACTTGAACCTGGG + Intergenic
1180270221 22:10578323-10578345 CATGGGAGACAGATGTAGAATGG + Intergenic
1184202345 22:42979429-42979451 CATGGGAATCACTTGAACATGGG + Intronic
950324350 3:12091831-12091853 TATAGAAAACAGTTGTACATAGG - Intronic
950556335 3:13698180-13698202 CATGAGAATCACTTGAACATGGG + Intergenic
951293110 3:20898841-20898863 CATGAGAATCACTTGAACATAGG + Intergenic
951617009 3:24558171-24558193 CAGGAGAATCACTTGTACATGGG - Intergenic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
954534023 3:51344525-51344547 CATGAGAATCACTTGAACATGGG + Intronic
957126014 3:76161715-76161737 CATGGGAAACATGTGAACATAGG - Intronic
957129851 3:76209018-76209040 CATGTGAAATAGTTGAAAATGGG + Intronic
957765335 3:84617367-84617389 CATGAGAAGCGCTTGTACATGGG - Intergenic
959497524 3:107068717-107068739 CAGGGGAGAGAGGTGTACATCGG + Intergenic
959860567 3:111210656-111210678 AAGGGGAAACAGTTTTAGATTGG + Intronic
962885442 3:139621462-139621484 CATGAGAATCAGTTGAACCTGGG - Intronic
968995560 4:3943204-3943226 CATGGGAAGAATTTTTACATGGG - Intergenic
971152840 4:24052063-24052085 AATGGGAAACATTTGAATATTGG + Intergenic
971202079 4:24519072-24519094 CAGGAGAAACACTTGTACCTGGG + Intronic
971202471 4:24523292-24523314 CAGGAGAATCAGTTGAACATGGG + Intronic
971462793 4:26920204-26920226 CATGATAAACACTTGCACATGGG - Intronic
971799222 4:31266833-31266855 CATGAGAAGCAGGTGTACAGTGG - Intergenic
971847215 4:31934036-31934058 CTTGGTAAACTGTTGCACATAGG - Intergenic
974028171 4:56752392-56752414 CAGGGGAATCACTTGGACATGGG - Intergenic
974532942 4:63134654-63134676 AATGGGACACAGTTGAAAATTGG + Intergenic
975023821 4:69524415-69524437 GATGGGAAAAAGTGGTTCATGGG + Intronic
976915822 4:90373683-90373705 CATGGGAGACAATTCTTCATGGG + Intronic
978360322 4:107924731-107924753 CATGAGAATCAGTTGAACCTGGG + Intergenic
979083497 4:116374565-116374587 CAAGGGGAACAATAGTACATTGG - Intergenic
979861480 4:125698680-125698702 CATGAGAATCAGTTGGACCTGGG + Intergenic
980109419 4:128621173-128621195 CAGGAGAATCAGTTGAACATGGG - Intergenic
980109490 4:128621576-128621598 CAGGAGAATCAGTTGAACATGGG + Intergenic
980221519 4:129923245-129923267 CAAGGGAATCACTTGAACATGGG - Intergenic
980956321 4:139432735-139432757 CATGAGAATCATTTGAACATGGG - Intergenic
982102438 4:151981163-151981185 CATGGGAATCACTTGAACCTAGG - Intergenic
984293565 4:177826105-177826127 CATGGGAAAGTGTTTTAGATAGG + Intronic
984486003 4:180370846-180370868 GATGTGAAATATTTGTACATAGG - Intergenic
984532232 4:180930937-180930959 CATGGGAATCACTTGAACCTGGG + Intergenic
984972077 4:185200545-185200567 CATGGGAATCACTTGAACCTGGG + Intronic
985086426 4:186317652-186317674 CAGGGGAAACACTTGAACCTGGG + Intergenic
985286280 4:188339333-188339355 TATGGGAAACAATGGAACATTGG + Intergenic
986470396 5:8067972-8067994 CATAGGGCACAGTTGCACATGGG + Intergenic
989763849 5:45054394-45054416 CATGGGAAAGATTTGGACAGAGG - Intergenic
992025816 5:72667925-72667947 TTTGGGAAACAATTGTCCATTGG + Intergenic
992563691 5:77976895-77976917 CATGAGAATCACTTGAACATGGG - Intergenic
993069250 5:83138235-83138257 AATGGGAAACAGTTTTAAATAGG - Intronic
993411857 5:87584009-87584031 CATGGGGAACAGATGGACACAGG + Intergenic
993536653 5:89094918-89094940 CTTGATAAACATTTGTACATTGG - Intergenic
993958333 5:94264873-94264895 CATGAGAATCACTTGTACCTGGG - Intronic
996092546 5:119364942-119364964 CAGGGGAATCAGTTGAACCTGGG - Intronic
996328930 5:122308800-122308822 CATGTGCAACTGTTGTACAGTGG + Intergenic
996579012 5:125009211-125009233 AATGGGAAGTAGTTGTACAATGG - Intergenic
999873427 5:155775769-155775791 CTTGGGAAACAGTGGTAGACAGG + Intergenic
999969692 5:156846867-156846889 TATGGGCAACAGTTGCACACAGG + Intergenic
1000112365 5:158121128-158121150 CAGGGGAATCAGTTGAACCTGGG - Intergenic
1000591257 5:163160425-163160447 CTTGTGATACAGTTGTACAATGG + Intergenic
1000805415 5:165784256-165784278 CAAGGGAAACACTTGAACACGGG + Intergenic
1000960050 5:167589107-167589129 CATGAGAATCACTTGTACATGGG + Intronic
1002553154 5:180012670-180012692 CATGGGAAAGAATTTCACATAGG + Intronic
1003908347 6:10722209-10722231 CAGGAGAATCAGTTGAACATGGG + Intergenic
1004590437 6:17046260-17046282 CATGGGAAAAAGATGTCCAGAGG + Intergenic
1004727253 6:18323134-18323156 CAGGAGAATCAGTTGTACCTGGG + Intergenic
1007080400 6:39097967-39097989 CATGGGAATCACTTGAACCTGGG - Intergenic
1010195769 6:73238971-73238993 CATGAGAAACAGTTGAACCTGGG - Intronic
1012108547 6:95197596-95197618 CATGGGAAACAGCATTCCATTGG - Intergenic
1013897147 6:115102596-115102618 CATGGGAGAAAGATGTAGATTGG + Intergenic
1015982544 6:138853678-138853700 CCTGGGAAACATTTCTACTTTGG + Intronic
1017099393 6:150834336-150834358 CCTTAGAAACAGTTGTATATTGG + Intronic
1018516164 6:164581853-164581875 AATGGGAAAAATTTGTCCATGGG - Intergenic
1022177674 7:27887506-27887528 CATGAGAATCAGTTGGACCTGGG - Intronic
1023175470 7:37431688-37431710 CCTGGTAAAAGGTTGTACATAGG - Intronic
1024450739 7:49539842-49539864 CAGGAGAATCAGTTGAACATGGG + Intergenic
1026352345 7:69528496-69528518 CATGAGAATCACTTGAACATGGG - Intergenic
1026419034 7:70213694-70213716 TATGGGAAACAGTTTTATTTGGG + Intronic
1027181628 7:75944438-75944460 CATGAGAATCAGTTGAACCTGGG + Intronic
1028116962 7:87008975-87008997 CATAAGAAACAGTTGTACACTGG + Intronic
1033521946 7:142169327-142169349 CATGGGAATCACTTGAACCTGGG + Intronic
1036620293 8:10420681-10420703 CATGAAAAGCACTTGTACATGGG - Intronic
1037666494 8:20974199-20974221 CATGGGAAAGAATGGCACATTGG + Intergenic
1039026909 8:33268451-33268473 CAGGGGAATCACTTGAACATAGG - Intergenic
1039992982 8:42505796-42505818 CATGAGAATCAGTTGAACCTGGG + Intronic
1040485284 8:47865291-47865313 CAGGAGAAACACTTGAACATGGG + Intronic
1042231844 8:66564793-66564815 AATGGGAAACAGTGGTTTATGGG - Exonic
1042271304 8:66958566-66958588 CAGGGGAATCACTTGAACATGGG + Intronic
1042811729 8:72832998-72833020 ATTGGGAAACAGTTCTCCATAGG - Intronic
1043063995 8:75543112-75543134 CATGGGAATCACTTGAACCTGGG + Intronic
1044513115 8:93107089-93107111 CCTGGGATACAGTTGTCAATTGG - Intergenic
1044828022 8:96217053-96217075 AATTTGAAACAGTTGTTCATTGG + Intergenic
1044844836 8:96370723-96370745 CATGGGAATCACTTGTACCTGGG - Intergenic
1047530150 8:125667148-125667170 CATGAGAATCACTTGAACATGGG - Intergenic
1052267697 9:26593252-26593274 CATGAGAAACACTTGAACCTGGG - Intergenic
1053285858 9:36849107-36849129 CAGGGGAATCCGTTGTACGTGGG + Intronic
1054960077 9:70958192-70958214 CATGGGAAACAGTTTCAAAAGGG + Intronic
1055283801 9:74706026-74706048 CATGAGAAACACTTGAACCTGGG + Intergenic
1056069277 9:82969008-82969030 CATGTGAGACAGTTTTACAAAGG - Intergenic
1056381178 9:86058601-86058623 CAGGGGAATCATTTGAACATAGG + Intronic
1057718816 9:97516458-97516480 CATGGGAAGCAGTTGGAGCTTGG + Intronic
1058095931 9:100860493-100860515 CATGAGAATCACTTGAACATGGG - Intergenic
1058304994 9:103428986-103429008 CATGAAAAACACTTGTGCATGGG + Intergenic
1058538975 9:105992454-105992476 CAGTGGAAACAGATGTACAATGG - Intergenic
1058724760 9:107791747-107791769 CAAGGGAAATAGTTTCACATGGG - Intergenic
1059648983 9:116296945-116296967 CAGGAGAATCAGTTGAACATGGG - Intronic
1203617349 Un_KI270749v1:79508-79530 CATGGGAGACAGATGTAGAATGG + Intergenic
1188226260 X:27601605-27601627 CAGGAGAATCACTTGTACATGGG + Intronic
1188294646 X:28432569-28432591 GTTGGAAAACAGTTGTATATTGG - Intergenic
1189156049 X:38757655-38757677 TTTGGGAAACAGTTGTGCTTAGG - Intergenic
1190464075 X:50708366-50708388 CATTGGAATCAGTTGGACAAAGG - Intronic
1190476837 X:50836608-50836630 CATGAGAATCACTTGAACATGGG - Intergenic
1192384648 X:70654616-70654638 CATGAGAATCACTTGAACATGGG + Intronic
1193680168 X:84509168-84509190 CATGGGAATCACTTGAACATGGG - Intergenic
1194443842 X:93963683-93963705 CATGGGAAAAAGATGTAAACTGG - Intergenic
1196472648 X:116046293-116046315 CATGAGAATCAGTTGAACCTGGG + Intergenic
1196557203 X:117101616-117101638 CATGGGAATCACTTGAACCTGGG + Intergenic
1200380110 X:155828006-155828028 CATGAGAATCATTTGAACATGGG + Intergenic
1201059445 Y:10032512-10032534 CAGGGGAATCAGTTGAACCTGGG - Intergenic