ID: 918139248

View in Genome Browser
Species Human (GRCh38)
Location 1:181706410-181706432
Sequence TGATGGGCATGTTAAATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918139242_918139248 -2 Left 918139242 1:181706389-181706411 CCACATATATACCCATGAGCCTG 0: 1
1: 0
2: 1
3: 13
4: 109
Right 918139248 1:181706410-181706432 TGATGGGCATGTTAAATCTAAGG 0: 1
1: 0
2: 0
3: 10
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918139248 Original CRISPR TGATGGGCATGTTAAATCTA AGG Intronic
902112246 1:14091691-14091713 CTATGGGTTTGTTAAATCTATGG + Intergenic
908997721 1:70177668-70177690 TGGTGAGCAACTTAAATCTATGG - Intronic
909790650 1:79673690-79673712 TGATGTGCAAGATAAACCTAAGG - Intergenic
909949122 1:81698498-81698520 TGATGGGCAAGTTGAAGCAAAGG + Intronic
910980434 1:92955389-92955411 TGTGGGGGATGTTAAATATAGGG + Intronic
918024941 1:180734149-180734171 TGTTGGACATGTTAAGTTTAAGG + Intronic
918139248 1:181706410-181706432 TGATGGGCATGTTAAATCTAAGG + Intronic
918140325 1:181714441-181714463 TGATGGGCATGCTAAATGTTGGG - Intronic
1063201957 10:3792692-3792714 TGGTGGGCATGTTTAATGTCTGG + Intergenic
1063238126 10:4140504-4140526 TGATGGGTTTGTTAAATGCATGG + Intergenic
1063727011 10:8648183-8648205 TGAGGGGCATGCCAAATCCAGGG + Intergenic
1064404016 10:15044923-15044945 TGCTGGGCATGTTTTATCTTTGG + Intronic
1065765295 10:29024175-29024197 GGATGGGCATGATAAACATAAGG + Intergenic
1068295249 10:55062523-55062545 TGCTGGGAATGTCAAAACTATGG + Intronic
1069727073 10:70586882-70586904 TGATGGGTGTGTTAATTCTTGGG + Intergenic
1074728780 10:116345842-116345864 TGATGGGAATGTAAAATTAATGG + Intronic
1079298478 11:19256164-19256186 TGATCTGCATGTGAAATCTCAGG + Intergenic
1081138276 11:39467053-39467075 TGATTGTCATTTTCAATCTATGG - Intergenic
1082764810 11:57158620-57158642 TGTTGGGGATATTAAATGTAGGG + Intergenic
1086191997 11:84090824-84090846 TTATGAGCATTTTAAATATATGG - Intronic
1088771152 11:113037115-113037137 TGATGTGGGTGTTAATTCTAAGG - Intronic
1090919036 11:131192175-131192197 AGATGGACATTTGAAATCTAAGG - Intergenic
1095436581 12:42195657-42195679 TGATGGGCATTAGAAATCAAAGG + Intronic
1097327444 12:58293814-58293836 TGATAGGGTTATTAAATCTATGG + Intergenic
1099985394 12:89657069-89657091 TGTTGGGCATGTTAACTTTGAGG - Intronic
1103148187 12:118613611-118613633 TTGTGGACATCTTAAATCTATGG - Intergenic
1104627456 12:130370147-130370169 TGATGGGCATAATAAATCGCAGG + Intronic
1107010941 13:35670346-35670368 TGGTGGACATGTTGAATCTGAGG + Intronic
1107147859 13:37078573-37078595 AGATGGGCATGGTATATTTAGGG - Intergenic
1110533561 13:76625453-76625475 TGAAGGGCAAGTGAAAACTATGG - Intergenic
1112744542 13:102511888-102511910 GGATGGTCAAGTTAGATCTATGG - Intergenic
1116291321 14:43046147-43046169 TGATAGGCATGATAAATAAAAGG - Intergenic
1121103835 14:91267873-91267895 TGTTGGGCATGTTGAATTTGAGG + Intergenic
1122262840 14:100532950-100532972 TGATGGTCATGTTAAATCAGTGG - Intergenic
1125989754 15:44094934-44094956 TCATGGTCATGTTATATCCATGG - Intronic
1126731112 15:51683995-51684017 TCATGGGCATGCTAAATTTGAGG - Intronic
1126817233 15:52466064-52466086 TGCTCCGCATGTTAGATCTAGGG - Intronic
1136619200 16:31416836-31416858 TGATCTGGATGTTAACTCTATGG - Intronic
1143794986 17:9329283-9329305 TTATAGGCATGTTCAATCAATGG + Intronic
1153824357 18:8861918-8861940 TGAAGAGCATGTGAAATCTCAGG - Intergenic
1158275253 18:55759882-55759904 TGGTGGGAAAGTTAAATGTAAGG + Intergenic
1160262313 18:77306042-77306064 TATTGGGCATGTTAAATCGCTGG + Intergenic
1160264279 18:77325868-77325890 TGATGGGTATGTTAATTTTCTGG - Intergenic
1166194085 19:41194699-41194721 TGATGGCCATGGTAAGTCAAGGG + Exonic
925835453 2:7940935-7940957 TGACGGGCAGGTTAAAGCAAGGG + Intergenic
933178934 2:79208149-79208171 TGATGGGCATTTTAAAGAAAAGG - Intronic
935554406 2:104492233-104492255 GGAAGGGCATTTTTAATCTAAGG + Intergenic
935856520 2:107280567-107280589 TAATGGGCATGATAAATTAAAGG + Intergenic
938016111 2:127868685-127868707 TGATGGGGACGTTAAAGGTAGGG - Intronic
938970114 2:136424109-136424131 TTATGGGCATTTAAAATATATGG + Intergenic
940359754 2:152784629-152784651 TTATAGGCAAGTTAAGTCTAAGG + Intergenic
941874972 2:170422918-170422940 TGATGTGCATTTTATATCTATGG + Intronic
942665208 2:178310382-178310404 TTTTGGGCATGTTAAACTTAAGG - Intronic
942703327 2:178738763-178738785 TCATGGTTATTTTAAATCTAAGG + Intronic
943541491 2:189220503-189220525 TGATTGGCATGTTCAAACCATGG - Intergenic
944063280 2:195591981-195592003 GGATGAGTAAGTTAAATCTAGGG - Intronic
944212814 2:197224054-197224076 TGAGGGGCTGGTTACATCTATGG + Intronic
945102315 2:206273616-206273638 TTTTTGGTATGTTAAATCTAAGG + Intergenic
947474632 2:230431622-230431644 GGATGTGCCTTTTAAATCTAAGG + Intronic
947489358 2:230580516-230580538 TGATGGGCATGTTCCTTCTGTGG - Intergenic
1170333385 20:15240633-15240655 TGATGGGCAGGTTCTATGTATGG + Intronic
1176980070 21:15371609-15371631 TGTTGGGCATGTAAATTCTCTGG + Intergenic
1177052714 21:16257778-16257800 TGATCAGGATGTTAAATTTATGG + Intergenic
1180751785 22:18129728-18129750 GGATGTGCATTTTAAAGCTATGG + Intronic
952403291 3:32983109-32983131 TGTTGGGCTTCTTGAATCTATGG + Intergenic
960090280 3:113631602-113631624 TTAAGAGCATGTTAAATCTTAGG + Intergenic
960265931 3:115621194-115621216 TGATGGGGATGCTAAAGCTAAGG - Intergenic
961014392 3:123456480-123456502 TGATGTGCATGTTATCTGTAGGG + Intergenic
963857193 3:150266965-150266987 TCATGGGCATGTACATTCTAGGG + Intergenic
964048268 3:152358351-152358373 TGATGGTAATGTTAAATCATTGG + Intronic
965133583 3:164733073-164733095 AGATGGACATGTTGAATTTAAGG - Intergenic
965485708 3:169275933-169275955 TGATAGCCTTGTTAAAACTAGGG + Intronic
965503412 3:169482842-169482864 TGATAGGCCTTTTAAATCTATGG + Intronic
965793736 3:172416130-172416152 TGCTAGGCATATTAAATTTAAGG + Intergenic
967022247 3:185532932-185532954 AGATGGCTATTTTAAATCTATGG - Intronic
967743524 3:193029302-193029324 TGATGGGCATGATCAAATTAAGG + Intergenic
969039343 4:4282943-4282965 TGATGGGCATGTGATACCCATGG + Intronic
970022878 4:11588774-11588796 TGATGGACATGTTAATTTGATGG - Intergenic
974365728 4:60946614-60946636 TGATGTGCTTGTTAAAAATATGG - Intergenic
977112722 4:92979439-92979461 TGGTAGGCATGTAAAATCTCAGG + Intronic
978105398 4:104896130-104896152 TTCTGGCCATGTTAAATTTACGG + Intergenic
979530207 4:121762761-121762783 TGATGGGCAGGTTAAATTCATGG + Exonic
979756479 4:124346299-124346321 TCATGGGAATATAAAATCTATGG + Intergenic
981521757 4:145669809-145669831 TGAAGGGACTGTTTAATCTATGG - Intergenic
984996622 4:185437564-185437586 TGATGGGCATGTCCAAACTCAGG + Intronic
985232487 4:187835982-187836004 TTATGGCTATTTTAAATCTACGG + Intergenic
987067825 5:14307243-14307265 TGATGGTCATGTTGTATCAATGG - Intronic
987788278 5:22530294-22530316 TAATGTGGATGTTAAATATATGG - Intronic
992241079 5:74770417-74770439 TCATGGGTATGTTAAATAAATGG - Intronic
992662264 5:78973359-78973381 TGATGGTCAAGTAAAATCTTAGG - Intronic
993056622 5:82988563-82988585 AGATGGGCATGTGAAACCAAGGG - Intergenic
993738165 5:91502555-91502577 TGATGGGCAGGGTAAAGCTGGGG + Intergenic
993894493 5:93516247-93516269 TGAAGGGAATTTTAAATATAAGG + Intergenic
995034042 5:107513351-107513373 TGATGAGCATGTTGATTCTGTGG + Intronic
997036549 5:130199374-130199396 TTCTGGGCATGTTGAATGTATGG - Intergenic
998624577 5:143831625-143831647 GGGTGGGCATGTTAAATGTTTGG - Intergenic
999037886 5:148373919-148373941 TGATAGACATGTGACATCTATGG - Intergenic
1000311264 5:160047230-160047252 GGCTGGGCACGTTAAATCTGAGG - Intronic
1006761062 6:36461401-36461423 TGATGGGAATGCCAAATTTAGGG + Intronic
1009748935 6:67858000-67858022 TGATGTTCATGTTTAATTTATGG + Intergenic
1011714210 6:90087308-90087330 TTCTGGGCATTTTAAATCTGTGG - Intronic
1012451757 6:99359966-99359988 TGAAGTGCATGATATATCTATGG - Intergenic
1013157744 6:107509491-107509513 TTATGTGCATGATAACTCTAGGG - Intronic
1014144864 6:117986263-117986285 TGATGGCCATGTTTAAACTACGG - Intronic
1015649441 6:135439258-135439280 TGATGTGCATTTTAAAACTTAGG - Intronic
1016123369 6:140370926-140370948 TAATGGGCATATAATATCTAAGG + Intergenic
1018823695 6:167393459-167393481 TGATGATCATGTTAAGTCCAAGG - Intergenic
1021619920 7:22541344-22541366 TGAGGGGCATGTCAACTCTGAGG - Intronic
1022624260 7:32018207-32018229 TGATGGGAATGTAATATGTATGG + Intronic
1026374793 7:69739456-69739478 TGACTGGCATGTTGAATCTTGGG + Intronic
1026531529 7:71202596-71202618 TGATGGACATGTTAATTAGATGG - Intronic
1027638998 7:80711053-80711075 TGTTGTACATGTTAAATATACGG + Intergenic
1028138748 7:87248688-87248710 CCATGGGCATGATAAAGCTATGG + Intergenic
1029855870 7:103516255-103516277 TGAGGAGGATGGTAAATCTAAGG - Intronic
1030557247 7:111042144-111042166 TGATGGCCATATTAAAACTCAGG - Intronic
1030627377 7:111858944-111858966 TGATGGGCTTGTAACATCTAAGG + Intronic
1037542540 8:19886265-19886287 TCATGGCCATGTTTAGTCTATGG - Intergenic
1038336938 8:26653134-26653156 GGATGGGCCTGTGAGATCTAGGG - Intronic
1040792694 8:51251702-51251724 TGACTGGCATGTCAAATTTAAGG - Intergenic
1042621703 8:70713420-70713442 TGATGGGCTTCTTGAATCTGTGG - Intronic
1043108010 8:76139827-76139849 TGATGGGCATGTAAGATCCTTGG - Intergenic
1044095236 8:88055864-88055886 TTATGGGCATGTTACAATTATGG + Intronic
1049066057 8:140315252-140315274 TGGTGGGCATGTGAGATTTAAGG + Intronic
1050027165 9:1347424-1347446 TTCTGGGCATCTTAAAACTAAGG + Intergenic
1052828812 9:33198102-33198124 TGTTGGGCATGCTGAATCTAAGG + Intergenic
1057948357 9:99349646-99349668 TGATGGACTTGATTAATCTAGGG - Intergenic
1059742707 9:117168293-117168315 TGCTGTGCATGTTAAATTAATGG + Intronic
1186710718 X:12193313-12193335 TGATGGGCATCTTAAATTGTTGG + Intronic
1192789465 X:74367083-74367105 TCATGGGCATGTCAACTCTGTGG - Intergenic
1194654779 X:96559284-96559306 TGATGGGGCTTTTAAATCTGAGG - Intergenic
1194909529 X:99623794-99623816 TGATGGGCAAGTAAAATTGAGGG + Intergenic
1198634013 X:138675180-138675202 TCATGAGCTTGTTAAATCTATGG + Intronic