ID: 918142724

View in Genome Browser
Species Human (GRCh38)
Location 1:181732579-181732601
Sequence GGCCATTGAGGGCCTGGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 349}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918142708_918142724 16 Left 918142708 1:181732540-181732562 CCCGCTCAATGCCCACCCCAGCC 0: 1
1: 0
2: 1
3: 59
4: 526
Right 918142724 1:181732579-181732601 GGCCATTGAGGGCCTGGCCCTGG 0: 1
1: 0
2: 6
3: 40
4: 349
918142711_918142724 5 Left 918142711 1:181732551-181732573 CCCACCCCAGCCTTTATCGGCGA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 918142724 1:181732579-181732601 GGCCATTGAGGGCCTGGCCCTGG 0: 1
1: 0
2: 6
3: 40
4: 349
918142713_918142724 1 Left 918142713 1:181732555-181732577 CCCCAGCCTTTATCGGCGACCCA 0: 1
1: 0
2: 0
3: 2
4: 40
Right 918142724 1:181732579-181732601 GGCCATTGAGGGCCTGGCCCTGG 0: 1
1: 0
2: 6
3: 40
4: 349
918142709_918142724 15 Left 918142709 1:181732541-181732563 CCGCTCAATGCCCACCCCAGCCT 0: 1
1: 0
2: 4
3: 59
4: 591
Right 918142724 1:181732579-181732601 GGCCATTGAGGGCCTGGCCCTGG 0: 1
1: 0
2: 6
3: 40
4: 349
918142706_918142724 23 Left 918142706 1:181732533-181732555 CCCTCAACCCGCTCAATGCCCAC 0: 1
1: 0
2: 2
3: 12
4: 203
Right 918142724 1:181732579-181732601 GGCCATTGAGGGCCTGGCCCTGG 0: 1
1: 0
2: 6
3: 40
4: 349
918142718_918142724 -5 Left 918142718 1:181732561-181732583 CCTTTATCGGCGACCCAGGGCCA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 918142724 1:181732579-181732601 GGCCATTGAGGGCCTGGCCCTGG 0: 1
1: 0
2: 6
3: 40
4: 349
918142712_918142724 4 Left 918142712 1:181732552-181732574 CCACCCCAGCCTTTATCGGCGAC 0: 1
1: 0
2: 0
3: 4
4: 84
Right 918142724 1:181732579-181732601 GGCCATTGAGGGCCTGGCCCTGG 0: 1
1: 0
2: 6
3: 40
4: 349
918142707_918142724 22 Left 918142707 1:181732534-181732556 CCTCAACCCGCTCAATGCCCACC 0: 1
1: 0
2: 0
3: 23
4: 196
Right 918142724 1:181732579-181732601 GGCCATTGAGGGCCTGGCCCTGG 0: 1
1: 0
2: 6
3: 40
4: 349
918142715_918142724 -1 Left 918142715 1:181732557-181732579 CCAGCCTTTATCGGCGACCCAGG 0: 1
1: 0
2: 0
3: 2
4: 23
Right 918142724 1:181732579-181732601 GGCCATTGAGGGCCTGGCCCTGG 0: 1
1: 0
2: 6
3: 40
4: 349
918142714_918142724 0 Left 918142714 1:181732556-181732578 CCCAGCCTTTATCGGCGACCCAG 0: 1
1: 0
2: 0
3: 3
4: 32
Right 918142724 1:181732579-181732601 GGCCATTGAGGGCCTGGCCCTGG 0: 1
1: 0
2: 6
3: 40
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918142724 Original CRISPR GGCCATTGAGGGCCTGGCCC TGG Exonic
900177255 1:1296346-1296368 GGCCCCTGAGGGCCAGGCCGGGG - Intronic
900289719 1:1918816-1918838 GGGCCTGGCGGGCCTGGCCCCGG + Intronic
900617172 1:3570714-3570736 AGGCAGTGAGGGCCTGGCACAGG - Intronic
900694351 1:4000661-4000683 GACCATTGAGTGCCGGGCACTGG + Intergenic
901476855 1:9495590-9495612 GGCAGTTGAGAGCCTGCCCCGGG - Intergenic
903179845 1:21599664-21599686 AGGGAGTGAGGGCCTGGCCCAGG - Intronic
903280206 1:22245836-22245858 GGGCAGTGAGGGGCGGGCCCGGG + Intergenic
903549511 1:24148153-24148175 GGACATTGAGTACATGGCCCAGG + Intergenic
903774510 1:25783974-25783996 GGCCAGTGTGGCCATGGCCCTGG - Exonic
906199352 1:43949097-43949119 GGCACTTGAGGGCAAGGCCCAGG - Intronic
907300705 1:53484845-53484867 GGCCATGCCGGGCCTGGGCCGGG + Intergenic
911090135 1:94011304-94011326 GGTCAATGAGGCCCCGGCCCAGG + Exonic
911871984 1:103109449-103109471 CCTCATTAAGGGCCTGGCCCTGG + Intergenic
912410528 1:109477969-109477991 GCCCATAGAGGGCGTGGCCCCGG - Exonic
913322315 1:117597600-117597622 GGCCAGTGAGGACCCAGCCCTGG + Intergenic
913936909 1:125064127-125064149 GGTGTGTGAGGGCCTGGCCCAGG - Intergenic
913937437 1:125067140-125067162 GGTGTGTGAGGGCCTGGCCCAGG + Intergenic
916058493 1:161083751-161083773 GGCCCGTGGGGGCCTGGCCAGGG - Intronic
918142724 1:181732579-181732601 GGCCATTGAGGGCCTGGCCCTGG + Exonic
919177239 1:194033829-194033851 GGGCAGTGAGGCCCTGGGCCTGG + Intergenic
920370739 1:205477759-205477781 TGCCACTGAGCGCCTGGACCAGG - Intergenic
921179931 1:212624369-212624391 GGGCATTGTGGCCCTGGCCTGGG + Intergenic
922516075 1:226209302-226209324 GGACAGTGAGGGCCTGCCCCAGG + Intergenic
923375112 1:233353855-233353877 GGGCATTGATGGCCTCGCCGTGG + Exonic
924329520 1:242927934-242927956 GGTCTTAGAGGACCTGGCCCAGG + Intergenic
1062764316 10:49148-49170 GGGCTCTGAGGGCCTAGCCCGGG - Intronic
1063383514 10:5601699-5601721 GGCAAGTGAGGGCCTGGTCAGGG - Intergenic
1065838891 10:29683774-29683796 GGAGAGTGAGGGCCTGGCACAGG - Intronic
1065887962 10:30095384-30095406 GGCCATTGCAAGGCTGGCCCAGG - Intronic
1067052228 10:43028329-43028351 GGCCATGGAAGGCCAGGACCTGG + Intergenic
1067448431 10:46367075-46367097 GGCCGTGGTGGGCCTGGCTCTGG + Intergenic
1067588944 10:47493691-47493713 GGCCATGGTGGGCCTGGCTCTGG - Intergenic
1067636070 10:48001782-48001804 GGCCGTGGTGGGCCTGGCTCTGG - Intergenic
1067801773 10:49363914-49363936 GGACATTGAGGCCTTGGCTCAGG - Intergenic
1067893149 10:50152992-50153014 GGCCACTCAGGCCCAGGCCCCGG - Intergenic
1068198088 10:53744854-53744876 GGGCAATGAGGCCCTGGGCCTGG + Intergenic
1069728463 10:70596213-70596235 GGCCAGGGCGGGCCTGGCTCAGG - Intergenic
1069868504 10:71518928-71518950 GCCCATTGGGGGCGTGGCCAAGG + Intronic
1072625098 10:97106144-97106166 GGCAAATGATGGGCTGGCCCTGG - Intronic
1075217804 10:120553826-120553848 GGGCAGTGAGGCCCTGGGCCTGG + Intronic
1075753637 10:124793354-124793376 GGCATTTGAGGGCCTTGCCTAGG - Intergenic
1076166677 10:128287704-128287726 GGGCACTGGGGGCTTGGCCCAGG - Intergenic
1076545720 10:131244717-131244739 AGCCATTGAAATCCTGGCCCAGG + Intronic
1076856429 10:133117524-133117546 GGCTAGTGAGGGCCTGATCCTGG - Intronic
1076909505 10:133379911-133379933 GGCCAGCGTGGGCGTGGCCCAGG + Intronic
1076999631 11:316129-316151 GGCCGCTGCGGGCCTGGCACGGG - Intergenic
1077014474 11:393622-393644 CTCCATGGAGGCCCTGGCCCTGG - Intronic
1077941504 11:6848432-6848454 GGGCAATGAGGCCCTGGTCCTGG - Intergenic
1078463045 11:11530068-11530090 GGGGATGGAGGGCCTGGCCCTGG - Intronic
1082001354 11:47395162-47395184 GGCCAAAGTAGGCCTGGCCCTGG - Intergenic
1083222813 11:61264628-61264650 GGCCCTTGAGGGCACTGCCCAGG - Intronic
1083275606 11:61595417-61595439 GGCCAGTGTGGTCCTGGCCTTGG - Intergenic
1083596528 11:63920497-63920519 GGCCACTGATGGCCTGGCCAGGG - Intergenic
1084195393 11:67521650-67521672 GCCCACTGTGTGCCTGGCCCTGG - Intronic
1084963160 11:72727749-72727771 GGCCTCTGGGGGCCTGGCCCTGG + Intronic
1089504838 11:118956282-118956304 GGCAAGTGAGGCCCTGCCCCTGG - Intronic
1090208159 11:124897025-124897047 GGCCATCGTGGGCATGTCCCCGG + Exonic
1091450712 12:570539-570561 GGCCCTTTAAGGCCAGGCCCAGG + Intronic
1091837520 12:3596088-3596110 GTCCATGGAGGGCCTGGCTAAGG - Intergenic
1092191907 12:6527369-6527391 TTCCATTGCTGGCCTGGCCCCGG + Intronic
1092429402 12:8396902-8396924 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
1094493423 12:30975417-30975439 GGGGAGTGAGGGCCTGGCCTGGG - Intronic
1096983600 12:55743086-55743108 GGCTATAAAGGGCCTGGCCCGGG + Intergenic
1101318945 12:103655959-103655981 GGCCATTCAGGGCCAGGTCTAGG + Intronic
1101497912 12:105273147-105273169 GGCCAATGAGGGCCAGGCCTAGG - Intronic
1102495537 12:113316585-113316607 GGGGATTGAGGGCCCGGACCAGG + Exonic
1103701072 12:122849006-122849028 TGCCTTTGAGGGCCTGGCCCAGG + Intronic
1104052089 12:125202158-125202180 GGCCAATGAGGGCCAGCCCTGGG + Intronic
1104977496 12:132558774-132558796 GGGCTTGGAAGGCCTGGCCCCGG - Intronic
1104978093 12:132561045-132561067 GCCCTCTGGGGGCCTGGCCCAGG - Intronic
1109962089 13:69644640-69644662 GGGCATCAGGGGCCTGGCCCTGG - Intergenic
1110666050 13:78118556-78118578 GGCCATTCGGGGCATGGGCCTGG + Intergenic
1113310494 13:109127351-109127373 GGCCAACGAGGCACTGGCCCAGG - Exonic
1113784881 13:112997206-112997228 GACCACTGTGGGTCTGGCCCAGG + Intronic
1113882492 13:113635484-113635506 GGGCCCTGAGGCCCTGGCCCTGG + Intronic
1114670357 14:24407814-24407836 GCCCGTTGGGGGCCTGCCCCTGG - Intronic
1115936627 14:38559880-38559902 GGGCATTGGGGCCCTGGACCTGG + Intergenic
1116742633 14:48776377-48776399 GAACATTGGGGCCCTGGCCCTGG - Intergenic
1117993760 14:61459504-61459526 GGCTCTTCATGGCCTGGCCCTGG - Intronic
1118005956 14:61564344-61564366 GTCCTTTGAGTGCCTGTCCCTGG + Intronic
1118350178 14:64968026-64968048 GGGCATTGAGAGCCTGGCCAAGG - Intronic
1118362051 14:65064944-65064966 AGCCAGTCAGGGCCTGGGCCTGG - Intronic
1119400389 14:74358628-74358650 GCCCACTGTGGGGCTGGCCCTGG - Exonic
1119492782 14:75051188-75051210 GGCCAGGGAGGGGCTGGGCCTGG - Intronic
1119758257 14:77133785-77133807 TGGCAGTGAGGGCCCGGCCCTGG - Exonic
1120848391 14:89146750-89146772 GGCCATAGAGAACCTGGCCATGG + Intronic
1121694665 14:95903112-95903134 GGCCATTTAGAGCATGGCCTTGG + Intergenic
1121707700 14:96011294-96011316 GGGCATAGAGGCCCTGGGCCTGG + Intergenic
1122114059 14:99518865-99518887 TGCCAGCGAGGGCATGGCCCGGG + Intronic
1122124159 14:99570289-99570311 GGCCACTGTGAGCCAGGCCCTGG + Intronic
1122284407 14:100642222-100642244 GGGCATTGAGGTCATGGGCCTGG + Intergenic
1122625975 14:103085487-103085509 GGGTGCTGAGGGCCTGGCCCGGG + Intergenic
1122904623 14:104795959-104795981 GGCCAGAGAGGGCGTGGCCCCGG - Intergenic
1202835709 14_GL000009v2_random:76243-76265 GGTCATTGTGGGCCTGGCAGCGG + Intergenic
1123495191 15:20816945-20816967 GGCCAGGAAGGTCCTGGCCCGGG + Intergenic
1123551683 15:21386038-21386060 GGCCAGGAAGGTCCTGGCCCGGG + Intergenic
1123921090 15:25070339-25070361 GGCCATTAAGGGCATGGCTGTGG + Intergenic
1124155977 15:27225654-27225676 GGCTATTGAGGGCATGGCCCAGG + Intronic
1124638864 15:31382608-31382630 GGCCAGTGTGGGCCTGCACCTGG + Intronic
1124879895 15:33632214-33632236 GGCCATTGACTGCCTAGGCCAGG - Intronic
1127369875 15:58329899-58329921 GGGCATTCAGGGCCAGGCTCAGG - Intronic
1127635486 15:60865512-60865534 GGGCATTGAGGTTCTGGCCAAGG - Intronic
1127843046 15:62846945-62846967 GGCCATAGAGGGTCTGGGCTGGG - Intergenic
1128052488 15:64676121-64676143 GGCCTTCAGGGGCCTGGCCCGGG - Exonic
1129293612 15:74587259-74587281 GGCCAGAGAGGGCCTGGACCAGG + Intronic
1129312529 15:74722674-74722696 GGCCATTCTGGGCCAGGCGCCGG + Exonic
1129394651 15:75237305-75237327 GGCCAGGGAGGCCCTGGCCCAGG - Intergenic
1129678428 15:77644645-77644667 GGCCAGTGAGAGGCTGACCCGGG - Intronic
1129689714 15:77706274-77706296 GGCCGTGGTGGGCCTGGCCCAGG - Intronic
1129725198 15:77898091-77898113 CACCATGGAGAGCCTGGCCCTGG + Intergenic
1130064988 15:80595778-80595800 GCCCATTCTGGGGCTGGCCCTGG - Exonic
1131215335 15:90530681-90530703 GTCCATCCAGGGCCCGGCCCTGG + Intronic
1132118783 15:99158814-99158836 GGCCAACAAGGGCCGGGCCCAGG - Intronic
1132397919 15:101488518-101488540 GGCCGGTGAGGGTCAGGCCCCGG + Intronic
1202960025 15_KI270727v1_random:113280-113302 GGCCAGGAAGGTCCTGGCCCGGG + Intergenic
1132572389 16:649691-649713 GGCCACTGCGGGGCTGGGCCGGG - Intronic
1132668925 16:1094863-1094885 TGCCCGTGGGGGCCTGGCCCGGG - Exonic
1132861291 16:2073024-2073046 GGGATTCGAGGGCCTGGCCCAGG + Intronic
1133113439 16:3563160-3563182 GGCCATGGAGAGCGGGGCCCTGG - Exonic
1135651163 16:24207997-24208019 GGCCATTTAGGACCTGTTCCTGG - Intronic
1136110837 16:28063000-28063022 GGCCATCGAGGCCCGAGCCCCGG - Intronic
1136175587 16:28514287-28514309 GGCCAGTCAGGCCCTGGGCCAGG + Intergenic
1137250579 16:46737774-46737796 GGGCACTGAGGGCCAGGCCCTGG + Exonic
1137262419 16:46842645-46842667 GGCCATAGGTGGCCTGGCCCTGG + Intergenic
1137404510 16:48179088-48179110 AGCCTTTGAGGGCATGGTCCTGG + Intronic
1137900118 16:52258355-52258377 AGCCAATGATTGCCTGGCCCTGG - Intergenic
1138091569 16:54178858-54178880 GGCAATTAGGGGTCTGGCCCTGG + Intergenic
1138586385 16:57972926-57972948 GGGCATTGAGGGGCTCACCCTGG + Intergenic
1139359186 16:66386907-66386929 CGCCATTGAGAGGCTGGACCGGG + Exonic
1139432414 16:66918235-66918257 GGCCTTGGTGGGCCTGGCCGAGG - Intronic
1139529328 16:67535257-67535279 GGGCAGTGAGGGCCTGGCCAAGG + Intronic
1139960846 16:70716469-70716491 GGCCCATGTTGGCCTGGCCCAGG + Intronic
1140213083 16:72986121-72986143 GGCCATGGAGTGCCTGTCCCTGG - Intronic
1140296187 16:73711909-73711931 AGCCCTTGAGGCCCTGGCCCTGG + Intergenic
1140469051 16:75204644-75204666 GCCCAGTGAGGGCCAGGCCTTGG - Intronic
1141089759 16:81122048-81122070 AGCCATTTTGGGCCGGGCCCAGG + Intergenic
1141685518 16:85567615-85567637 GGCCTTTTAGGGCCTAGCCTCGG + Intergenic
1143367102 17:6415556-6415578 GGCCCCTGAGGCCCAGGCCCAGG + Intronic
1143586807 17:7854552-7854574 CCCCAGTGAGGCCCTGGCCCTGG - Exonic
1143783660 17:9241948-9241970 GGCCACCGAGCCCCTGGCCCTGG + Exonic
1143787290 17:9265421-9265443 GCCCACTGGGGGCCTGGCTCAGG + Intronic
1143893442 17:10119366-10119388 GAGCACTGAGGGCCTGGGCCAGG - Intronic
1144498394 17:15764855-15764877 GGCCAGCTAGGGCCTGCCCCGGG - Intergenic
1145161776 17:20579896-20579918 GGCCAGCTAGGGCCTGCCCCGGG - Exonic
1145278391 17:21450561-21450583 GGCCACTGACAGCTTGGCCCTGG - Intergenic
1146214856 17:30971070-30971092 GGCCATGGCGGGCCTGGGCCTGG + Exonic
1147625744 17:41898711-41898733 GGCCATTGTGGGCATGGCCCTGG - Exonic
1148027474 17:44598630-44598652 GTCCATTGAGGCCCTCACCCAGG + Intergenic
1148133103 17:45274168-45274190 GACCCTCCAGGGCCTGGCCCAGG + Exonic
1148322461 17:46765779-46765801 GCACATGAAGGGCCTGGCCCAGG - Intronic
1148495420 17:48050832-48050854 GGCCCTTGAGGACCTGGACTGGG + Exonic
1149019256 17:51944360-51944382 GGCCATTGAGGGGCAGGGTCTGG - Intronic
1149610088 17:57953694-57953716 GGCCCTAGTTGGCCTGGCCCAGG + Intronic
1149664307 17:58355014-58355036 GGTCATTGAGGGTCAGGCCAGGG + Intronic
1149997174 17:61411426-61411448 AACCCTTCAGGGCCTGGCCCGGG + Intergenic
1150236022 17:63593240-63593262 GCCCAGCCAGGGCCTGGCCCAGG - Exonic
1151380832 17:73724689-73724711 GGCTCCTGAAGGCCTGGCCCAGG - Intergenic
1151386935 17:73760684-73760706 CACCCTTTAGGGCCTGGCCCAGG - Intergenic
1151493701 17:74447066-74447088 GGGCCCTGAGGACCTGGCCCCGG + Exonic
1151805289 17:76401100-76401122 GGCCAATGAGCACCTGGCCTGGG + Exonic
1152015797 17:77749528-77749550 GGCCGATGAGAGCCTGGCCCTGG + Intergenic
1152070754 17:78132553-78132575 CGCCATGGGGGGGCTGGCCCAGG + Intronic
1152436479 17:80279297-80279319 GGGCTTAGAGGGCCAGGCCCAGG + Intronic
1152458202 17:80427998-80428020 GGGCATGGGGGGTCTGGCCCTGG - Intronic
1152855508 17:82663099-82663121 GCCCAGCGAGGGCATGGCCCCGG + Intronic
1154452586 18:14489419-14489441 GGCCAGGAAGGTCCTGGCCCGGG + Intergenic
1155002999 18:21704647-21704669 GGCCATGCAGCGCCTGGCCATGG - Exonic
1155007254 18:21740710-21740732 GGCGATGGAGGGGCGGGCCCAGG - Intronic
1155164598 18:23222122-23222144 GGCCCTTGAGGCTCTGGCCTTGG + Intronic
1156472890 18:37388510-37388532 GGCCAGTGGTGCCCTGGCCCTGG + Intronic
1157490031 18:48116686-48116708 GGCCACTGCTTGCCTGGCCCTGG + Intronic
1157639649 18:49201585-49201607 GGCCCTCGAGAGTCTGGCCCTGG + Intronic
1159649906 18:70965743-70965765 GGCTCTTGAGGCCCAGGCCCAGG - Intergenic
1160316832 18:77856046-77856068 TGCCATTGAGGTCCTTTCCCTGG - Intergenic
1160402331 18:78620139-78620161 GGCCATGGAAGTCCAGGCCCTGG + Intergenic
1160480964 18:79239210-79239232 GGCGAGACAGGGCCTGGCCCTGG + Intronic
1160734819 19:657741-657763 GGCCCTGGAGGGGCTGGCCGGGG - Intronic
1160817469 19:1042802-1042824 GGCCGCTGAGGACCTGGCCCAGG + Exonic
1160860162 19:1234307-1234329 GGCCGGTGAGGGCCTTCCCCGGG + Exonic
1160903766 19:1442272-1442294 GGCCACTGAGGGCCTGGACCTGG + Intergenic
1160920344 19:1516611-1516633 GGCCAATGAGAGCCTGCCCTGGG + Intergenic
1161054163 19:2181577-2181599 GGCCAGGGTGGGCCTGACCCAGG + Intronic
1161156244 19:2733131-2733153 GGTCTTTGAGGGCCTGGCCCTGG - Exonic
1161314667 19:3612351-3612373 GGCCAAGGAGGGCATGGGCCAGG - Exonic
1161714108 19:5865916-5865938 TGCCCTTGAGGCCCTGCCCCCGG - Exonic
1161801844 19:6420645-6420667 GGGCATTGTGGGCCTTGGCCTGG + Intronic
1161887080 19:7005310-7005332 GGCTAGTGAGGGCCTCTCCCTGG + Intergenic
1162367719 19:10259457-10259479 GGCCAGGCAGGGTCTGGCCCCGG + Intronic
1162452587 19:10763911-10763933 AGGCAATGGGGGCCTGGCCCTGG + Intronic
1162573691 19:11486724-11486746 GGGCCTTGTGGGCCTGGCCCAGG + Intronic
1162612513 19:11767389-11767411 GGCCACTGCGGCCCTGGCCCTGG + Intronic
1162951772 19:14075217-14075239 GGCCAGACACGGCCTGGCCCAGG + Intergenic
1163610893 19:18301043-18301065 GGGCAAGGAGGGTCTGGCCCTGG + Intergenic
1164722794 19:30444549-30444571 CGCCGTTGGGGCCCTGGCCCTGG - Exonic
1164836542 19:31358495-31358517 GACCACTCAGAGCCTGGCCCAGG + Intergenic
1164866509 19:31608766-31608788 GTCCATGGAGGGTCTGCCCCTGG + Intergenic
1165750369 19:38255985-38256007 GGCCAATGAGTGCCCGGCCCTGG + Intronic
1165806716 19:38584814-38584836 GCCCTTTGAGGGCAGGGCCCAGG + Intronic
1166050461 19:40255983-40256005 GGGCACTGAGGACCAGGCCCAGG + Intronic
1166571550 19:43799865-43799887 GGCCAGTGTGAGCCTGTCCCAGG + Intronic
1168254769 19:55159338-55159360 GGTCTCTGAAGGCCTGGCCCCGG + Exonic
1202636931 1_KI270706v1_random:51120-51142 GGTCATTGTGGGCCTGGCAGCGG - Intergenic
925093046 2:1170450-1170472 GGGCCTTGAAGGCCAGGCCCAGG + Intronic
925635970 2:5941692-5941714 GGCAAGTGAGGGCCAGGCCATGG - Intergenic
927511816 2:23648684-23648706 GGCCATGGAGGACCTGGCCCCGG - Intronic
927687232 2:25179482-25179504 TGCCATTGAGGGGCTGGGGCTGG + Intergenic
927695796 2:25239034-25239056 GGCCAGAGAGGGCCCGGCTCAGG + Intronic
928095362 2:28401487-28401509 AGCCACTGAGTGCCTTGCCCTGG - Intronic
928194576 2:29205995-29206017 GGCCAGTGGGGGCCAGGACCAGG + Intronic
929651224 2:43681693-43681715 GGCCACTGAGGGCCAGGCAAGGG + Intronic
929870427 2:45754633-45754655 CCCCCTTGAGGGCCTGCCCCTGG + Intronic
930772213 2:55139928-55139950 GGCCCTTCAAGGCCTGCCCCAGG + Intergenic
931670147 2:64640408-64640430 GGCCTTTCTGGGCCTGGCTCAGG + Intronic
933808647 2:86018230-86018252 GGCCTCTGAAGGCCTGGCCTGGG - Intergenic
933810737 2:86031398-86031420 GGCCATGGAGCGCCGGGTCCAGG - Exonic
934752503 2:96802503-96802525 GGCCATGAGGGGCATGGCCCCGG + Intronic
935260301 2:101350016-101350038 TTCTGTTGAGGGCCTGGCCCAGG + Exonic
935748008 2:106206107-106206129 GGACATTGAGGGCCCTTCCCTGG - Intergenic
936122121 2:109755981-109756003 GGACATTGAGGGCCCTTCCCTGG + Intergenic
936222573 2:110615493-110615515 GGACATTGAGGGCCCTTCCCTGG - Intergenic
936249252 2:110854684-110854706 GGCCATTGAGGGCCACCACCTGG + Intronic
936385854 2:112028501-112028523 GAGCTCTGAGGGCCTGGCCCAGG + Exonic
937205013 2:120230846-120230868 CGCCACTGAGAGCCAGGCCCTGG + Intergenic
937304829 2:120864872-120864894 GCCTATGGAAGGCCTGGCCCAGG + Intronic
938087629 2:128411789-128411811 GGGCTTTGAGTGCCAGGCCCAGG + Intergenic
942379730 2:175376449-175376471 GGCAAGTGAGGGCCTAGACCAGG - Intergenic
944414328 2:199467797-199467819 AGTCACTGAGGCCCTGGCCCCGG - Intronic
945197620 2:207251821-207251843 GACCATGCAGGGCCAGGCCCAGG + Intergenic
947909025 2:233789679-233789701 GGCCACGGGGGGCCTGGCCCAGG + Intronic
948423028 2:237872185-237872207 AGCCAAGGAGGGCCTGGCACGGG + Intronic
948775762 2:240288077-240288099 AGCCACTCAGAGCCTGGCCCTGG + Intergenic
949047753 2:241879870-241879892 GGCCATAGGATGCCTGGCCCTGG - Intergenic
1170569419 20:17624623-17624645 GGCCATGGAGGCACTGGCCACGG - Exonic
1170666629 20:18392444-18392466 CGGCGTTGAGGGCCTGGCCTTGG + Intronic
1170797993 20:19566415-19566437 GGCAGTTGAGGTCATGGCCCAGG + Intronic
1171883057 20:30632050-30632072 GGTCATTGTGGGCCTGGCAGCGG - Intergenic
1172244062 20:33433675-33433697 GGCCCTTGAAGGCCAGGCCTGGG - Intronic
1173288872 20:41696911-41696933 GGCCCTTGAAGACCTAGCCCAGG - Intergenic
1175846301 20:62060734-62060756 GGCCTTTGGAGGCCTGGACCTGG - Intronic
1176044113 20:63083617-63083639 GGCCACTGAGTGCCTGGACCAGG + Intergenic
1176044135 20:63083722-63083744 GGCCACTGAGTGCCCGGACCAGG + Intergenic
1176044153 20:63083787-63083809 GGTCATTGAGTGCCCGGACCAGG + Intergenic
1176044175 20:63083892-63083914 GGCCACTGAGTGCCCGGACCAGG + Intergenic
1176171271 20:63697431-63697453 GCACATTGAGGGCCAGGCCCAGG - Exonic
1176443444 21:6798865-6798887 GGCCAGGAAGGTCCTGGCCCGGG - Intergenic
1176613509 21:9008506-9008528 GGGCAGTGATGCCCTGGCCCTGG - Intergenic
1176711684 21:10155377-10155399 GGACAGTGATGCCCTGGCCCTGG + Intergenic
1176821613 21:13663912-13663934 GGCCAGGAAGGTCCTGGCCCGGG - Intergenic
1177792308 21:25734712-25734734 GGACCTTCACGGCCTGGCCCGGG - Exonic
1180000926 21:44995220-44995242 GCAGCTTGAGGGCCTGGCCCAGG + Intergenic
1180083186 21:45496064-45496086 GGGCATGGAGGGCATGGCCCAGG - Intronic
1181041629 22:20195139-20195161 GGCCATACAGGGCCTGGCCAGGG - Intergenic
1181352456 22:22268361-22268383 GGCCAGTCAGGGCCTGAACCAGG + Intergenic
1181582916 22:23837803-23837825 TGGCCATGAGGGCCTGGCCCAGG + Exonic
1181667995 22:24411708-24411730 GGCCATGGAGGGCCAGCTCCTGG + Intronic
1182422432 22:30254913-30254935 GGCCAAGGTGGGCCTGGACCTGG - Intergenic
1183482252 22:38071603-38071625 GGCAATTGGAGGCCTTGCCCTGG + Intronic
1183484414 22:38081656-38081678 GGAAGTTGAGGGCCAGGCCCAGG + Exonic
1183489861 22:38110520-38110542 GGCCATGGAGGGGCTGTCCCGGG + Exonic
1183590427 22:38776504-38776526 GGCTACTGAGGGCCAGACCCAGG - Intronic
1183668886 22:39260535-39260557 GACCATGGTGAGCCTGGCCCAGG + Intergenic
1184502644 22:44883128-44883150 TGCCACTGAGGGCTTGGTCCAGG + Exonic
1185289568 22:50016766-50016788 GGCCAGTGAGAGCCAGGCCAAGG - Intronic
1185317784 22:50186263-50186285 GGTCGTTGGGGGCCGGGCCCGGG + Intronic
950040772 3:9917794-9917816 GGGCATGGAGGGCATGGGCCTGG - Intronic
950151168 3:10688670-10688692 GGCCATAGGAGGCCTGGCGCAGG - Intronic
950266496 3:11577080-11577102 GGCCATGGATGGCCCAGCCCTGG - Intronic
950376944 3:12579992-12580014 GGCCAGTGAGGAAGTGGCCCTGG + Intronic
950740572 3:15047982-15048004 GGCCCTTGAGAGCCAGGGCCTGG + Exonic
951133336 3:19074798-19074820 GGGCAATGAGGCCCTGGGCCTGG - Intergenic
952917994 3:38264008-38264030 GGCAATTGAGGGCCAGAGCCAGG + Intergenic
953013667 3:39052263-39052285 GGCCCTTGGGGCCCAGGCCCGGG + Intronic
953253748 3:41268967-41268989 GGCCAGTGAGCGCTTGGTCCAGG - Intronic
953377707 3:42442807-42442829 GGGCCTTGAGGGCCTGGTCCTGG + Intergenic
954790570 3:53130251-53130273 GGCCCTTGAGAGCCTGCCCCAGG - Intronic
955921694 3:63963741-63963763 GTCCATAGAGGGCCTGGCAGAGG - Intronic
956510483 3:69988337-69988359 GGCCCTTGATGACCTGGCCTCGG + Intergenic
960577953 3:119245701-119245723 GGCCATGGCAGGCCTTGCCCAGG + Intergenic
961476559 3:127150390-127150412 GGCCAAGGAGGCCATGGCCCTGG - Intergenic
961509859 3:127394155-127394177 GGGCATTATGGGCTTGGCCCTGG - Intergenic
962828413 3:139119455-139119477 TGAGATTGGGGGCCTGGCCCAGG + Intronic
964922317 3:161912264-161912286 GGAGATTGAGGGCCTTGCCTGGG - Intergenic
965763916 3:172109958-172109980 GGCCTTTGTGGGCCTGGGTCTGG + Intronic
966097851 3:176228041-176228063 TGCTTTTGAGGGCCAGGCCCAGG + Intergenic
966574597 3:181485824-181485846 AGACATTGAGGGCCAGCCCCTGG + Intergenic
967153209 3:186668355-186668377 GACCATTCAGGGCCTGGTACTGG + Intronic
967156545 3:186697455-186697477 GACCATTCAGGGCCTGGTACTGG + Intergenic
968910180 4:3473539-3473561 GGCCATTGTCTGCCTGTCCCAGG + Exonic
969016625 4:4107758-4107780 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
969124687 4:4937975-4937997 GCCCCATGAGGCCCTGGCCCTGG - Intergenic
969204552 4:5633636-5633658 GGCCAATAAAGGCCTGGCCTTGG + Intronic
969296394 4:6272555-6272577 GGCCCAGGAGGTCCTGGCCCTGG - Intronic
969297560 4:6278818-6278840 GGCGGATGAGGGCCTGACCCCGG + Intronic
969349982 4:6592911-6592933 GGCAAGTGAGGCCCTGGCCTAGG - Intronic
970508285 4:16755076-16755098 GGCCATTGTGGACCTGGACCTGG + Intronic
972829927 4:42802918-42802940 GGGCATTAGGGCCCTGGCCCTGG + Intergenic
973366717 4:49214366-49214388 GGACATTGTGGGCCTGGCAGTGG - Intergenic
973393874 4:49577945-49577967 GGTCATTGTGGGCCTGGCAGCGG + Intergenic
974414137 4:61582666-61582688 GGACATTGAAGACTTGGCCCAGG + Intronic
977666377 4:99650556-99650578 GGCCTTTGAGAACCTGGCCAGGG - Exonic
980458649 4:133076555-133076577 GGGCAGTGAGGTCCTGGGCCTGG + Intergenic
985103748 4:186482532-186482554 GGCCACTGAGGGGCTCTCCCCGG - Intronic
985303597 4:188514997-188515019 GGCCATTGGCGGCGTGGCCGTGG + Intergenic
1202764245 4_GL000008v2_random:136991-137013 GGACATTGTGGGCCTGGCAGCGG - Intergenic
985481076 5:111305-111327 GGCCACTCAGGGCCTGGGCCAGG - Intergenic
985760864 5:1747831-1747853 GGGACTTGAGGGCCTGGGCCTGG + Intergenic
985838554 5:2288825-2288847 GCCCCTTGATGGTCTGGCCCTGG - Intergenic
986660139 5:10052081-10052103 GGTCAGTGGGGGCCTGGGCCTGG + Intergenic
988977042 5:36526089-36526111 GGATATTGAGGGGCTGGCCCAGG - Intergenic
997474346 5:134133995-134134017 GGCCATGCTGGGCCTGGCCCAGG - Intronic
998127107 5:139631995-139632017 GGCCATTGAGTGTCCAGCCCAGG + Intergenic
998422518 5:142000809-142000831 GACCTTTGAGAGCCTAGCCCAGG - Exonic
998955738 5:147436230-147436252 GGCTATTCAGGGCCTGGGCTGGG - Intronic
999326625 5:150648210-150648232 TGCCGTGGAGGGCCTGGCTCCGG - Exonic
999489985 5:152040188-152040210 GGTCATTGTGGGCCTTGACCTGG + Intergenic
1000338746 5:160260911-160260933 GGCCTTCAAGGGCCTGGCCTCGG + Intronic
1001487194 5:172128081-172128103 GCCCCTTGAGGGCCTAGACCTGG - Intronic
1001716254 5:173818707-173818729 GGACCTTGAGGACATGGCCCTGG + Intergenic
1002103840 5:176870219-176870241 GTGCATCGTGGGCCTGGCCCTGG + Intronic
1002187188 5:177459825-177459847 GGACATCCAGGGCCAGGCCCTGG - Intronic
1002197727 5:177510230-177510252 GGCCCTGGAGGGGCTGGCCTGGG - Intronic
1002621386 5:180491071-180491093 GGCCAGTGAGAGCCTGCCCTGGG + Intergenic
1003016941 6:2475572-2475594 GGGCACAGAGGGCCTGGCCAAGG - Intergenic
1006945115 6:37779582-37779604 GACCTTGGGGGGCCTGGCCCAGG - Intergenic
1007631426 6:43275419-43275441 GGCCTTTGGGTCCCTGGCCCCGG + Intronic
1007632995 6:43283187-43283209 GGCCATGGAGGCCCGGCCCCTGG - Exonic
1007636084 6:43300584-43300606 GGCTATGGAGGACCTGGGCCTGG + Intronic
1016719788 6:147282762-147282784 GTCCTGTGAGGCCCTGGCCCAGG - Intronic
1017030056 6:150213248-150213270 GCCCATTGAGGGCCTGTTCTTGG + Intronic
1017745963 6:157447253-157447275 GGGCTTGGAGGGCCTTGCCCAGG + Intronic
1018742550 6:166741690-166741712 GGCCCTTGAAGGCGGGGCCCTGG - Intronic
1019289181 7:242028-242050 GCCCAGGGAGGGGCTGGCCCAGG - Intronic
1019352625 7:562117-562139 GGGCATTGAGGGCAAGGCCCGGG - Intronic
1019508780 7:1406722-1406744 GGACATGGAGAGCCTGGACCAGG - Intergenic
1019737854 7:2659387-2659409 GGCCAGGGAGGGCCTGGTGCAGG - Intronic
1019936655 7:4262547-4262569 GGCCATTCAGTACCTGGCCGGGG + Intronic
1022910395 7:34895382-34895404 GGGCAGTGAGGCCCTGGGCCTGG - Intergenic
1026863326 7:73807986-73808008 GACCATACAGTGCCTGGCCCTGG + Intronic
1029075100 7:97928558-97928580 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
1029283272 7:99450217-99450239 AGCCAAGGTGGGCCTGGCCCCGG + Intronic
1029890015 7:103918421-103918443 AGCCATTAAGAACCTGGCCCAGG + Intronic
1031890251 7:127286118-127286140 GGCCACTAAGGGCTTTGCCCAGG - Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1032855695 7:135832099-135832121 AGCCATAGAGGGCTTGGCCTGGG + Intergenic
1034276671 7:149826817-149826839 CGCTGGTGAGGGCCTGGCCCTGG + Intergenic
1034338346 7:150337569-150337591 GGCCAGCGACAGCCTGGCCCAGG + Exonic
1035263610 7:157676577-157676599 GGGTGTTGAGGGGCTGGCCCGGG - Intronic
1036238246 8:7061038-7061060 TGCCGGTGAGGGCCTGGTCCTGG - Intergenic
1036242431 8:7091820-7091842 GGCCAGAGCGGGCCTGGCCACGG + Intergenic
1036899386 8:12659610-12659632 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
1036900453 8:12665757-12665779 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
1039049028 8:33476168-33476190 GGCCACTTAAGGCCTGGACCCGG - Intronic
1040104850 8:43535771-43535793 GGTCATTGTGGGCCTGGCAGTGG + Intergenic
1040538330 8:48329076-48329098 GGTGGTGGAGGGCCTGGCCCGGG + Intergenic
1041926489 8:63242520-63242542 GGCTTTTGAGGGCCTTGCTCTGG - Intergenic
1042306651 8:67340443-67340465 GACCAGAGCGGGCCTGGCCCAGG + Intronic
1044923001 8:97185667-97185689 GGCCACTGAGTGCCAGGCTCCGG + Intergenic
1045343734 8:101275985-101276007 GGCCAGTGGCGGCCTGGCCTAGG + Intergenic
1045559901 8:103251155-103251177 GGCCATGGATGGCCTGACCCTGG + Intergenic
1049564529 8:143331369-143331391 GCTCATGCAGGGCCTGGCCCAGG - Intronic
1049670939 8:143869581-143869603 GACCCTTGAGGCCCTGGCTCAGG - Exonic
1049725333 8:144143123-144143145 GGCCCTTGAGGGGCTGGCTGTGG + Intergenic
1051496296 9:17727488-17727510 GGGCATGGAGGGCATGGCCCTGG - Intronic
1053648675 9:40141068-40141090 GGACAGTGATGCCCTGGCCCTGG + Intergenic
1053757071 9:41322774-41322796 GGACAGTGATGCCCTGGCCCTGG - Intergenic
1054329657 9:63739009-63739031 GGACAGTGATGCCCTGGCCCTGG + Intergenic
1054535908 9:66235102-66235124 GGACAGTGATGCCCTGGCCCTGG - Intergenic
1055985703 9:82055545-82055567 GGTCATTGTGGGCCTGGCAGTGG + Intergenic
1057141158 9:92727561-92727583 GGCCTTTGAGGGTCAGCCCCAGG - Intronic
1057898138 9:98925823-98925845 GCCCATTCAGGGCCAGGACCAGG + Intergenic
1059334016 9:113557386-113557408 GGCCAATGAGGATCAGGCCCAGG - Intronic
1060591667 9:124820797-124820819 GGGGGTTGAGGGGCTGGCCCCGG - Intergenic
1060594948 9:124842011-124842033 AACCAGTGAGTGCCTGGCCCGGG - Intergenic
1062134097 9:134915568-134915590 GGGCACAGAGGACCTGGCCCCGG + Intronic
1062364613 9:136202874-136202896 GGCCTTTCCGGGCCTGGCCGCGG - Intronic
1062586230 9:137251164-137251186 GGCCCTGGAGGGGCTGCCCCGGG - Intergenic
1202796439 9_KI270719v1_random:124366-124388 GGACAGTGATGCCCTGGCCCTGG + Intergenic
1203525757 Un_GL000213v1:85662-85684 GGCCAGGAAGGTCCTGGCCCGGG + Intergenic
1203544994 Un_KI270743v1:121864-121886 GGTCATTGTGGGCCTGGCAGCGG - Intergenic
1185462958 X:340737-340759 GCCCCGTGAGGGCATGGCCCAGG - Intronic
1186506017 X:10092848-10092870 GGCAAATGAGTGGCTGGCCCTGG - Intronic
1188194591 X:27217260-27217282 GGCCATTGAGGGCCTTGCAGAGG + Intergenic
1190283151 X:48944547-48944569 GACCTTGCAGGGCCTGGCCCAGG + Intronic
1190310465 X:49113798-49113820 GGTCGTTCAGGGCCTGTCCCAGG - Intronic
1190326465 X:49209895-49209917 TGCCATTCAGGGGCTGGCGCGGG + Intronic
1191665740 X:63700766-63700788 GCCCATTGAAGGCCTGTCACAGG + Intronic
1191825247 X:65357496-65357518 GGCCACTCAGGGCCTGGACAGGG + Intergenic
1192598063 X:72432384-72432406 GGCCCCTGAGGGTCTGGTCCCGG + Intronic
1194313265 X:92340670-92340692 GGGCAGTGAGGCCCTGGTCCTGG + Intronic
1197524744 X:127547605-127547627 GGGCAGTGAGGCCTTGGCCCTGG - Intergenic
1197706958 X:129641036-129641058 GGCAATTCAGGACCTGACCCAGG - Intergenic
1197817016 X:130508367-130508389 GGCCAAGGAGGGCCTGTGCCAGG + Intergenic
1200176993 X:154123829-154123851 GGACAGTAAGGGCCTGGCCAGGG + Intergenic
1200251082 X:154554109-154554131 GGCCCTTAGGGGCTTGGCCCAGG - Intronic
1201226881 Y:11827055-11827077 GGTCTTAGAGGACCTGGCCCAGG + Intergenic
1201321995 Y:12709492-12709514 GGCCATCAAGAACCTGGCCCTGG - Exonic