ID: 918144748

View in Genome Browser
Species Human (GRCh38)
Location 1:181745647-181745669
Sequence ATGTGGATTAGGAAGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918144748_918144758 20 Left 918144748 1:181745647-181745669 CCAGCCACCTTCCTAATCCACAT 0: 1
1: 0
2: 0
3: 25
4: 232
Right 918144758 1:181745690-181745712 ATTTCAAATTAGTCTTCAGTGGG 0: 1
1: 0
2: 1
3: 23
4: 282
918144748_918144757 19 Left 918144748 1:181745647-181745669 CCAGCCACCTTCCTAATCCACAT 0: 1
1: 0
2: 0
3: 25
4: 232
Right 918144757 1:181745689-181745711 CATTTCAAATTAGTCTTCAGTGG 0: 1
1: 0
2: 1
3: 18
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918144748 Original CRISPR ATGTGGATTAGGAAGGTGGC TGG (reversed) Intronic
901116970 1:6854346-6854368 ATATGGCTTAGGAATGTGGAAGG + Intronic
902802957 1:18841734-18841756 GTGTGGTTGAGGAAGGTGCCGGG + Exonic
903003023 1:20279822-20279844 ATGTGGGCCAGGAAGGAGGCTGG + Intergenic
903947397 1:26972329-26972351 TTGGGGAATAGGAAGGAGGCTGG + Intergenic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905405078 1:37727090-37727112 ATTTGGAGGAGGTAGGTGGCTGG - Exonic
906139162 1:43523240-43523262 ATGTTGACTAGGCAGCTGGCTGG + Intergenic
906560031 1:46749514-46749536 AAGTGGTTGAGGAAGGAGGCAGG - Intergenic
906722362 1:48018190-48018212 AGGTGGCTGAGGATGGTGGCAGG + Intergenic
910495175 1:87818513-87818535 ATTTGGATTAACAAGGGGGCTGG + Intergenic
912417644 1:109520983-109521005 GTGAAGATTAGGAAGGGGGCAGG + Intergenic
913166497 1:116191818-116191840 ATCTGGATTAGGGTGGTGGCAGG + Intergenic
915226711 1:154417098-154417120 ATGTGCTTCTGGAAGGTGGCAGG - Intronic
915395889 1:155583803-155583825 CTGTGGACTAGGAAGCAGGCTGG - Intergenic
915411495 1:155704414-155704436 CTGTGGACTAGGAAGCAGGCTGG - Intronic
915944667 1:160141147-160141169 AAGTGGCTTAGGAAGGTGGAAGG - Intronic
917831852 1:178898596-178898618 ATGATGATCAGGAGGGTGGCAGG - Intronic
918144748 1:181745647-181745669 ATGTGGATTAGGAAGGTGGCTGG - Intronic
918206626 1:182315306-182315328 ATGTGGACTAGGAAGCTGGAGGG - Intergenic
920003596 1:202816085-202816107 ATGTGGATGAGGAACCTGGGTGG + Intergenic
920570906 1:207016559-207016581 GTGTGGATTGGGAAGGAGGCAGG + Intronic
920922522 1:210310091-210310113 ATTTGGGTTTGGGAGGTGGCTGG - Intergenic
921287171 1:213619593-213619615 GTGGGGATTAGGAAGGTCTCAGG + Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921481382 1:215667919-215667941 ATGTAGTGTAGGAAGGTGGTGGG + Intronic
923430281 1:233913334-233913356 ACCTGGATGAGGAAGGTGACAGG - Intronic
1064495466 10:15905508-15905530 CTGGGGATTAGGGTGGTGGCGGG - Intergenic
1065178242 10:23099151-23099173 ATATGAATTTGGAAGTTGGCGGG + Intronic
1066356338 10:34687800-34687822 ATGTGGAGTCAGTAGGTGGCGGG - Intronic
1066624303 10:37390653-37390675 AAGTTGATTATGCAGGTGGCCGG + Intergenic
1069749171 10:70734688-70734710 AAGTGGATTTGGATGGGGGCAGG + Intronic
1069819399 10:71218087-71218109 ATGTGTATTAAGCAGGTGGGCGG + Intronic
1069839292 10:71329082-71329104 ATGTGGAAAAAGAAGATGGCAGG - Intronic
1071518633 10:86315419-86315441 ATGTGGCCCAGGAAGGGGGCTGG + Intronic
1075031564 10:119028050-119028072 GTTTTGATTAGGAAGATGGCAGG - Intergenic
1075079885 10:119376232-119376254 ATTTGGAAGAGGAAGGTGACTGG - Intronic
1075786060 10:125050941-125050963 ATCTGGATGAGGAGGGTGGATGG + Intronic
1077177071 11:1195815-1195837 ACGTGGAGCAGGCAGGTGGCCGG + Intronic
1077615821 11:3672818-3672840 TTGTGTGTTAGGAAGGTGGTTGG - Intronic
1078096726 11:8301954-8301976 ATGTGGATCAGGAAAGTGATGGG - Intergenic
1080605665 11:33862864-33862886 ATGTTGCCTAGGAATGTGGCAGG + Intronic
1081056024 11:38412115-38412137 AGGAGGTTTATGAAGGTGGCCGG + Intergenic
1083549258 11:63574054-63574076 TAGTGGATTAGGGATGTGGCTGG - Exonic
1083685238 11:64371465-64371487 GTGGGGATTAGGAGGGGGGCAGG - Exonic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088256669 11:107909722-107909744 AGGTGGATAAGGAAGGAGGTGGG - Intronic
1088371465 11:109092980-109093002 ATGAGTATGAGGGAGGTGGCGGG + Intergenic
1090940799 11:131386519-131386541 CTGTGGTGTAGGAAGGAGGCAGG + Intronic
1091076090 11:132618621-132618643 ATGTGGATAAAGAAGTTGGTAGG - Intronic
1091974225 12:4811570-4811592 ATGTGGTGTAGGAAGGTAGCTGG - Exonic
1092072166 12:5640208-5640230 ATGGGCATTAGGAAGGTTTCAGG - Intronic
1092658933 12:10718299-10718321 ATGTGGAGGAGGAAGGTGGGTGG - Intronic
1093101452 12:15034507-15034529 ATGTGGGTTAGAATTGTGGCAGG - Intergenic
1093115263 12:15202023-15202045 ATGTTGATTAGGAAGGAAGAAGG - Intronic
1093674910 12:21927329-21927351 ATGTGGATAAGGAAGTTGGTTGG + Intronic
1095468512 12:42512560-42512582 ATGTGGAATAGGGAGAGGGCAGG - Intronic
1096463600 12:51836360-51836382 ATGAGGATGAGGATGGTGGGCGG - Intergenic
1097037530 12:56133684-56133706 ATGGGAAATAGGAAGCTGGCAGG + Intronic
1097054981 12:56243777-56243799 CTGTGGATGAAGAAGGTGGGTGG - Exonic
1097880430 12:64681518-64681540 ATGTGGGATGGGAAGTTGGCAGG - Intronic
1099399643 12:82186986-82187008 GTTTGGATTAAGAAGTTGGCCGG - Intergenic
1100761896 12:97816638-97816660 ATGTGATCTAGGAAGGTGACTGG - Intergenic
1103483875 12:121269484-121269506 CTGTGGATAAGGATGGGGGCAGG + Intronic
1103587820 12:121969161-121969183 ATGTGCATTTGGCAGATGGCAGG - Intronic
1104919828 12:132285035-132285057 ATGGGGATCAGGAGGCTGGCAGG - Intronic
1106111417 13:26780878-26780900 GTGTGGAATTGGAGGGTGGCAGG + Intergenic
1108147522 13:47495262-47495284 AAGTGGATTAGGAAGGATGAAGG + Intergenic
1108577444 13:51802456-51802478 ATGGGGAGGAGGAAGCTGGCAGG + Intronic
1110781454 13:79470552-79470574 ATGTGAATTTGGAGGGTGGAGGG - Intergenic
1111782473 13:92745532-92745554 ATCTGGAGTAGCAAGCTGGCTGG - Intronic
1112704771 13:102055172-102055194 ATGTGCATGAGGCATGTGGCAGG - Intronic
1113555225 13:111228679-111228701 ATGTGGTTCAGGAAAGCGGCAGG + Intronic
1113911414 13:113843179-113843201 ATGGGGATCAGGGAGGTGGGCGG - Intronic
1114231360 14:20785863-20785885 CTGTGGCTGAGGCAGGTGGCTGG + Intergenic
1114524587 14:23359848-23359870 ATCTGGAGTGGGAAGGAGGCCGG - Exonic
1117799076 14:59425203-59425225 ATGTGGACCAGGGAGGTGGCAGG - Intergenic
1118385585 14:65253139-65253161 ATGTGGAATAAGAATGTGGTGGG + Intergenic
1118856719 14:69629040-69629062 ATGTGGATTCGAAAGTTGGGTGG + Intronic
1120135507 14:80863783-80863805 AAGTGAATTAGGGAGGTAGCTGG + Intronic
1120885315 14:89447376-89447398 ATGTGAGTTAAGAAGGTGGGCGG + Intronic
1121455097 14:94033329-94033351 AGGTGGATTAGGAACGGGGGTGG - Intronic
1124888303 15:33708029-33708051 GAGTTGATTAGGAAGTTGGCTGG - Intronic
1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG + Intergenic
1127122083 15:55780459-55780481 AGGAGGATTAAGAAGGAGGCAGG + Intergenic
1128233639 15:66052472-66052494 ATGTGGATCAGGATTGAGGCTGG - Intronic
1128568240 15:68715177-68715199 ATGGAGTTGAGGAAGGTGGCAGG - Intronic
1128673601 15:69593195-69593217 ATGTGGATAAACATGGTGGCAGG + Intergenic
1130037649 15:80376386-80376408 ATATAAATTAGGAGGGTGGCGGG - Exonic
1130202527 15:81845489-81845511 ATTTGGTTTAGGAATGTGGTGGG - Intergenic
1130662968 15:85845150-85845172 ATGTGGCTGGGGGAGGTGGCGGG + Intergenic
1134360043 16:13522801-13522823 ATGGGGATGAGGCAGGTGTCTGG - Intergenic
1135070730 16:19349240-19349262 ATATTGATTAGCAAAGTGGCTGG + Intergenic
1138190450 16:55009748-55009770 ATGTGGATTGGGAAGGTCTGGGG + Intergenic
1138446770 16:57069730-57069752 ATGTGGGGTAGGGATGTGGCGGG - Intronic
1141443187 16:84042442-84042464 ATGGGGATGAGGAAGGTTGGGGG - Intronic
1141456513 16:84145621-84145643 ATGTGGTGTGGGAAGGGGGCTGG - Intronic
1142738415 17:1916425-1916447 ATGTAGATTTGAGAGGTGGCTGG + Intergenic
1143150331 17:4803868-4803890 ATGTGGCTGGGGATGGTGGCGGG - Intergenic
1144453812 17:15402909-15402931 ATGAGGTTTAGGGAGGTGGCTGG + Intergenic
1148377065 17:47158194-47158216 ATGTGAAATAGGTAGGTGGGTGG - Exonic
1149197511 17:54138702-54138724 ATATGTATTAGAAAAGTGGCTGG - Intergenic
1149655316 17:58306743-58306765 AGGTGGAGTTGGAAGGGGGCTGG + Intronic
1151670511 17:75569396-75569418 ATGTGCGTTAGGCAGGTGGTTGG - Intronic
1153362593 18:4214220-4214242 CTGAGGAACAGGAAGGTGGCAGG + Intronic
1154336565 18:13470760-13470782 GTGTGGCTGAGGAGGGTGGCTGG - Intronic
1155984664 18:32217449-32217471 ATGTGAATCTGGAGGGTGGCGGG + Intronic
1157786858 18:50491435-50491457 ATGAGGGTTAGGAGGGTGGTTGG + Intergenic
1157967094 18:52220616-52220638 CTGTGGGTCAGGAAGTTGGCTGG - Intergenic
1158215202 18:55093760-55093782 ATGGGGATTTGGCAGGTGGGGGG + Intergenic
1158896775 18:61921624-61921646 ATATGGTGTAGGGAGGTGGCAGG - Intergenic
1159258250 18:65976755-65976777 AAATGGAATGGGAAGGTGGCAGG + Intergenic
1160106388 18:75982333-75982355 ATGTGCCTGAGGAAGGCGGCTGG - Intergenic
1160425495 18:78776237-78776259 ATGTGGAGGAGGAAGGAGACTGG + Intergenic
1160533344 18:79577933-79577955 ATGAGGAGTAGGAAGGACGCGGG - Intergenic
1160680460 19:409635-409657 CTGTAGATGAGGAAGGTGGGGGG + Intergenic
1160809426 19:1007061-1007083 ATGTTGATGGGGAAGGAGGCTGG + Intronic
1166338542 19:42123122-42123144 ATGTGGATGGGGAAAGTGGTGGG - Intronic
1166992950 19:46704246-46704268 CTGTGGATGAGGAAGGTGTGCGG + Exonic
1167323923 19:48812651-48812673 CTGTAGAATAGGAAGGTGGCTGG - Intergenic
1167551984 19:50167682-50167704 ATGTGTACTAGGGAGGGGGCTGG - Intergenic
925543524 2:4991982-4992004 ATGTTGCTTATGATGGTGGCAGG - Intergenic
925639062 2:5969991-5970013 ATCTGGATTAGGAAGGAGAGAGG - Intergenic
926051269 2:9746328-9746350 ATGTGGAGTCTGGAGGTGGCTGG - Intergenic
926200173 2:10789821-10789843 CTGTGGATTATGACGGTGGGCGG - Exonic
929078697 2:38100431-38100453 GTGTGCAATAGGAAGGGGGCTGG - Intronic
929823084 2:45289180-45289202 ATTTGCATGAGGAAGGTGGCAGG + Intergenic
931580400 2:63765538-63765560 AAATGGATTAGGCAGGTGTCTGG + Intronic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935546537 2:104405768-104405790 TTGTTGATTGGCAAGGTGGCTGG - Intergenic
937218389 2:120327240-120327262 ATGTGCTTTAGGAAGCTGCCTGG + Intergenic
939279754 2:140047828-140047850 ATGTGCATTTTGAAGGTGTCTGG + Intergenic
940895866 2:159081439-159081461 CTGTGGATTGAGAATGTGGCAGG + Intronic
941003232 2:160222524-160222546 ATGTGGGTGAGGAAGGGGGATGG - Intronic
942226634 2:173822384-173822406 ATCTGGTGTAGGAAGATGGCTGG - Intergenic
942346444 2:175007336-175007358 ATGTGGGTAGGGAAGGTGGTCGG - Intergenic
942537127 2:176976774-176976796 AGATGGACTAGGAAGGTGGCAGG + Intergenic
942706781 2:178782771-178782793 ATGTGCATTAGGACTGTGGGAGG + Intronic
946037364 2:216754785-216754807 ATGTGTAGGAGGGAGGTGGCAGG + Intergenic
946375301 2:219304637-219304659 ATGTGAATAAGCAAGGAGGCAGG - Intronic
1171358939 20:24573009-24573031 ATGTGGGTCAGGACGGGGGCTGG - Intronic
1175608208 20:60328687-60328709 CTGTGAATTAGGGAGGTGGAGGG - Intergenic
1182395908 22:30035802-30035824 AGGAGGGTTAGCAAGGTGGCAGG - Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1183726498 22:39592859-39592881 GTGTGGGGTAGGAGGGTGGCGGG - Intronic
949980447 3:9499315-9499337 GTGTGGATGGGGCAGGTGGCAGG - Exonic
950903509 3:16517084-16517106 ATGTGAATTAGGGTGGGGGCAGG + Intergenic
951633020 3:24741748-24741770 ATGTGGATTGGGAAATTAGCAGG + Intergenic
953027262 3:39152472-39152494 ATGTGGAGAAGGAAGAGGGCAGG + Intronic
953323952 3:41996758-41996780 AGGAGGATTAGGCAGGTGGGAGG - Intergenic
953930607 3:47003990-47004012 GTGTGGTTTAGGAGGATGGCAGG + Intronic
955470626 3:59282669-59282691 TTGTGGCCTGGGAAGGTGGCAGG + Intergenic
956181381 3:66521052-66521074 ATATGAATTAGGATGGTGACAGG + Intergenic
956703004 3:71975187-71975209 ATGTTGACTATCAAGGTGGCCGG + Intergenic
956958116 3:74365008-74365030 CTGTGGATTAGAAAGGTTTCTGG + Intronic
958057484 3:88430807-88430829 ATGTGGATGAGGAAGGGTGCAGG - Intergenic
958744208 3:98113471-98113493 ATGTGTCTTGGGAAGGTGGAGGG - Intergenic
959441240 3:106377956-106377978 ATGAGGATTAGGAAGATGAGAGG + Intergenic
959446180 3:106442536-106442558 AGGTAGATTAGGAAGGTTGTCGG - Intergenic
959523528 3:107348162-107348184 ATATGGATTGGGAATGTGGTTGG - Intergenic
960335611 3:116414006-116414028 AGGTGGAAAAGGAAGGAGGCAGG + Intronic
961569202 3:127786058-127786080 ATGTGGAGGAGGAAGGTGAGAGG + Intronic
962784012 3:138749707-138749729 ATGCTGATTAGGAATTTGGCAGG - Intronic
964181222 3:153888692-153888714 ATTTGGATAAGGAAGATAGCTGG - Intergenic
966486442 3:180476313-180476335 CTGAAGATTATGAAGGTGGCTGG + Intergenic
969476228 4:7423979-7424001 CTGTGGCTTAGGAGGATGGCAGG + Intronic
969670162 4:8585788-8585810 ATGGGGATGAGGAGGCTGGCAGG - Intronic
970703535 4:18771513-18771535 ATGTGCACTGGCAAGGTGGCAGG - Intergenic
977114447 4:93005380-93005402 ATGTGGACTAGGACAGTAGCAGG - Intronic
979504129 4:121475839-121475861 ATGTGGATTATGGAGATGGGAGG + Intergenic
980304713 4:131043745-131043767 TTGTGGATTATAAAGGTGGGAGG + Intergenic
980619656 4:135283404-135283426 GTATGGATTAGGAATGTGGGTGG + Intergenic
981515065 4:145598849-145598871 AGGTGGAAAAGGAAGGTGGAAGG + Intergenic
983693632 4:170502354-170502376 GTGTGCATTTGGAAGGTGGGAGG + Intergenic
983781428 4:171674671-171674693 ATGTGGAGCCGGAAGGGGGCTGG - Intergenic
984080499 4:175243429-175243451 AAATGGATCAGAAAGGTGGCAGG - Intergenic
985924098 5:3002202-3002224 ATGAGGATTAGGAAGGTCTCAGG - Intergenic
987356425 5:17067162-17067184 ATGTGCAATACGAAGGTGGTAGG + Intronic
988329843 5:29821832-29821854 ATTTGGCTTAGGAAAATGGCTGG - Intergenic
988415299 5:30939743-30939765 ATGTGGAGTGGGAAGGAGGCAGG - Intergenic
990077444 5:51867083-51867105 AAGTAGAGTAGGAAGGTGGGGGG - Intergenic
991312878 5:65264277-65264299 ATGGGGCTGAGGAAGGAGGCAGG - Intronic
991522449 5:67515877-67515899 AGGTTGATTTGGAAGGTGGCAGG + Intergenic
991936867 5:71810738-71810760 ATGGGGAGTTGGAAGGTAGCAGG + Intergenic
991962407 5:72058347-72058369 ATCTGGCTGAGGAGGGTGGCTGG - Intergenic
992245778 5:74820861-74820883 ATATGGATTAGGAGAGAGGCAGG - Intronic
992503290 5:77362701-77362723 GTGTGACTTGGGAAGGTGGCAGG - Intronic
993021514 5:82597411-82597433 ATCTGATTTAGGAAGGTGGTTGG - Intergenic
993511759 5:88779379-88779401 ATGAGGTTAAGGCAGGTGGCTGG + Intronic
995400637 5:111737096-111737118 ATGTGGAAAAGTAAGGTGGTTGG - Intronic
998460091 5:142303555-142303577 ATGTGGATTGTGAAGAAGGCCGG + Intergenic
999122040 5:149217199-149217221 GGGTGGATTGGGAAGGTTGCCGG + Intronic
1000258880 5:159566936-159566958 AGGTGGATTGGGAAGTTGGCAGG + Intergenic
1001210173 5:169803681-169803703 GTGTGGAGTAGGATGGTGGTAGG + Intronic
1001645082 5:173274403-173274425 ATGAGGATTAGTTGGGTGGCTGG - Intergenic
1003234305 6:4282045-4282067 AAGTGGGTTAGGCAGGTGGCGGG + Intergenic
1004703424 6:18100673-18100695 ATGTGCATTAGGACAGTGCCTGG - Intergenic
1005560834 6:27039278-27039300 TTGTGGAAGAGGAAGGTGCCAGG - Intergenic
1005925540 6:30442143-30442165 ATGTGGATTAGGAAATGGGATGG - Intergenic
1006789097 6:36686906-36686928 GGGTGGATGAGGAAGGTCGCTGG - Exonic
1007982432 6:46172416-46172438 ATGGGGATTAAGAGGGAGGCTGG + Intergenic
1009510246 6:64541650-64541672 CAGTGGATTAGGAAGGTGAATGG - Intronic
1010060199 6:71613963-71613985 ATCTTGTTTAGGAAGGGGGCTGG + Intergenic
1011511397 6:88104981-88105003 ATGAGGATGAGGAAGTAGGCAGG + Intergenic
1011855387 6:91683382-91683404 ATGTGGATAATTAATGTGGCAGG - Intergenic
1012275349 6:97266837-97266859 AGGAGGATTAGGAGGGAGGCGGG + Intronic
1015640126 6:135322861-135322883 CTGTGCATGAGGCAGGTGGCAGG + Intronic
1017041239 6:150310118-150310140 AGGTGGGATAGGAAGGTGGTGGG - Intergenic
1017796311 6:157847953-157847975 ATGTGGGGTGGGGAGGTGGCAGG - Intronic
1017974707 6:159346884-159346906 GTGCAGATTAGGAAGGTGGCAGG - Intergenic
1018247693 6:161838600-161838622 ATGAGGAAGAGGAAGGTGGCTGG - Intronic
1018720953 6:166572398-166572420 TATTGGTTTAGGAAGGTGGCTGG + Intronic
1018826039 6:167408508-167408530 GTGTGGGTTGGGAAGGTGCCTGG + Intergenic
1019872713 7:3780484-3780506 ATGTGGGTTATGAAGTTGACTGG - Intronic
1021942478 7:25691489-25691511 ATGTCCATAAGGAAGATGGCAGG + Intergenic
1022860609 7:34362906-34362928 AGGTGGATTGGTCAGGTGGCAGG - Intergenic
1023109010 7:36791543-36791565 GTGTGGCTTGGGAAGGAGGCAGG + Intergenic
1023620962 7:42072056-42072078 AAGTGGATTAGTAAAGTGGATGG + Intronic
1024616763 7:51121771-51121793 TTGTGGATTATCAAGGTGGCTGG + Intronic
1024964285 7:55008081-55008103 TGGAGGTTTAGGAAGGTGGCTGG - Intergenic
1027717598 7:81692672-81692694 AACTGGATCAGGAAGGTGGGTGG + Intergenic
1028086095 7:86639635-86639657 ATGAGGATGAGGAAGCCGGCTGG - Intergenic
1028914548 7:96243846-96243868 ATGAGGATGAGGGAGGTGCCGGG + Intronic
1029603828 7:101586319-101586341 AGGTGAATTGGGAAGGAGGCTGG + Intergenic
1030394713 7:108971501-108971523 ATGTAGGTTAGCAAGATGGCTGG + Intergenic
1031290487 7:119928363-119928385 CTGTGGATTCAGAAGGTGCCAGG + Intergenic
1033360010 7:140632365-140632387 ATGTGGATAAGAAAGGTGGTGGG + Intronic
1033558690 7:142510694-142510716 ATGTGGTGCAGGAAGGAGGCTGG - Intergenic
1035100973 7:156396243-156396265 TCCTGGATTAGGAAGGTGGTTGG + Intergenic
1036001644 8:4611859-4611881 AGATGCATTATGAAGGTGGCAGG - Intronic
1036836071 8:12068869-12068891 ATGTTGATTAGGATGGTGAGAGG - Intronic
1036857913 8:12315439-12315461 ATGTTGATTAGGATGGTGAGAGG - Intergenic
1038503217 8:28062740-28062762 ATGGGGAATATGAAGGTGACGGG - Intronic
1039385515 8:37132085-37132107 CTGTGGAGGAGGCAGGTGGCGGG - Intergenic
1040818334 8:51531904-51531926 ATGTGGATGATGACGGTGGGGGG - Intronic
1041193024 8:55372608-55372630 ATTTGGATTGGGTAGGTGGGTGG + Intronic
1046899852 8:119512467-119512489 AAGTGGACTTGGGAGGTGGCAGG - Intergenic
1048925055 8:139264197-139264219 ATGTGGCTTGGGAAGCAGGCAGG - Intergenic
1051489706 9:17647912-17647934 AGGTGGAAGAGGAAGGTGGGGGG - Intronic
1053437303 9:38084554-38084576 ATGGGGATTAGGAAGGAGGAAGG + Intergenic
1055825867 9:80323881-80323903 GTGAGGATGAGGAAGGTAGCTGG - Intergenic
1058702913 9:107615342-107615364 AAGTGGATTAGTGAGGAGGCTGG + Intergenic
1059313396 9:113404206-113404228 ATTTGGATTCGGGAGGTGGGAGG - Intergenic
1060201511 9:121654266-121654288 GAGTGGATTGGGAAGGGGGCTGG + Intronic
1061550356 9:131331101-131331123 ATGTGGCTGGTGAAGGTGGCTGG - Intergenic
1202629873 M:7790-7812 ATGAGGACTAGGATGATGGCGGG - Intergenic
1186747995 X:12589903-12589925 ATGTGGATTTGGTAGGTGGAAGG - Intronic
1189556215 X:42148009-42148031 ATGTTGAGTAGCAAGGAGGCAGG + Intergenic
1190074938 X:47310007-47310029 ATGTGGAGTTGGGAGGTGGGAGG + Intergenic
1191029935 X:55958939-55958961 ATGTGCATCAGTAGGGTGGCAGG - Intergenic
1193364140 X:80610259-80610281 ATAGGGATAAGGAAGGTGGGTGG - Intergenic
1194081269 X:89467901-89467923 ATGTGGATTGGGAAAGTCTCAGG + Intergenic
1194632468 X:96302332-96302354 CTGTGGATAAGTAAGGGGGCAGG - Intergenic
1194691175 X:96987125-96987147 ATGTTGATTATGCAGGTGTCTGG - Intronic
1196375148 X:115025518-115025540 ATGTGGAATTGGAAGGGGGGTGG - Intergenic
1197346317 X:125327926-125327948 CTGTGGTTGAGGAAGGGGGCAGG - Intergenic
1199335294 X:146612202-146612224 ATTTTGATTTGGAAGGTGGTTGG + Intergenic
1200433942 Y:3124098-3124120 ATGTGGATTGGGAAAGTCTCAGG + Intergenic