ID: 918145708

View in Genome Browser
Species Human (GRCh38)
Location 1:181753900-181753922
Sequence TCTCTGGGAACCCACGCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918145708_918145713 -2 Left 918145708 1:181753900-181753922 CCCACCGCGTGGGTTCCCAGAGA 0: 1
1: 0
2: 0
3: 1
4: 67
Right 918145713 1:181753921-181753943 GAGAGACACCCATGCTCCCAAGG 0: 1
1: 0
2: 0
3: 21
4: 163
918145708_918145714 4 Left 918145708 1:181753900-181753922 CCCACCGCGTGGGTTCCCAGAGA 0: 1
1: 0
2: 0
3: 1
4: 67
Right 918145714 1:181753927-181753949 CACCCATGCTCCCAAGGAAGTGG 0: 1
1: 0
2: 2
3: 14
4: 196
918145708_918145717 9 Left 918145708 1:181753900-181753922 CCCACCGCGTGGGTTCCCAGAGA 0: 1
1: 0
2: 0
3: 1
4: 67
Right 918145717 1:181753932-181753954 ATGCTCCCAAGGAAGTGGCCTGG 0: 1
1: 0
2: 5
3: 13
4: 162
918145708_918145721 29 Left 918145708 1:181753900-181753922 CCCACCGCGTGGGTTCCCAGAGA 0: 1
1: 0
2: 0
3: 1
4: 67
Right 918145721 1:181753952-181753974 TGGCCGACTGCTGTCCTCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918145708 Original CRISPR TCTCTGGGAACCCACGCGGT GGG (reversed) Intronic
903503008 1:23812223-23812245 TCTCTGGGACCCCATGGTGTCGG - Intronic
907310936 1:53538682-53538704 CCTCTGGGAGCCCATGCGGGTGG + Intronic
916488559 1:165280833-165280855 TCACTGGGATACCATGCGGTGGG - Intronic
916997821 1:170320206-170320228 TCTCTGGGGACCCACACCTTTGG + Intergenic
918145708 1:181753900-181753922 TCTCTGGGAACCCACGCGGTGGG - Intronic
922768281 1:228167311-228167333 TCTCTGGGAACCCCACCCGTTGG + Intronic
1062888163 10:1035386-1035408 TCGCTGGGCATCCACCCGGTGGG - Intergenic
1070881346 10:79853476-79853498 TCTCTGGGAACCAGTGCGGCTGG + Intergenic
1071647922 10:87369792-87369814 TCTCTGGGAACCAGTGCGGCTGG + Intronic
1076731763 10:132442775-132442797 TGGCTGGGAGCCCACGGGGTGGG - Intergenic
1077177998 11:1199287-1199309 TCTCTGGAAGCCCACGGGCTGGG + Intronic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1083587411 11:63870315-63870337 ACTCTGGGAACCCAGGTGGGAGG - Intronic
1085270878 11:75269197-75269219 TCTCTGGGTTCCCACGGGCTGGG + Intronic
1086959823 11:92970214-92970236 GCTGTGGGAACCCACGCTGCTGG + Intronic
1091308499 11:134556408-134556430 ACTCTGGGATCCCACGCGTGAGG - Intergenic
1091894619 12:4091195-4091217 TCTCTGGGAACCCCCTCTGGAGG - Intergenic
1092964032 12:13624666-13624688 TCTCTGGGTACACACGCTGAAGG + Intronic
1097323791 12:58253078-58253100 TCTCTGGGAGAACACGGGGTGGG + Intergenic
1098474294 12:70882383-70882405 CCTCTGGGAAGCCAGGGGGTGGG - Intronic
1101244780 12:102875057-102875079 TCTCTGGGAAAGCACGCTGGAGG + Intronic
1101733485 12:107445505-107445527 TCTCTGGGCACCCACTCCCTGGG - Intronic
1102466631 12:113134330-113134352 TCTCTGGGAGCCCACACCTTGGG + Intronic
1102588794 12:113942030-113942052 GCTCTGGGAAGCCACTGGGTAGG + Intronic
1112410531 13:99159238-99159260 TCTCTGGGAACCCAGTGGGCTGG - Intergenic
1113750569 13:112773891-112773913 TCCCTGGGAAGGCACGAGGTGGG - Intronic
1115490228 14:33951202-33951224 TCTCTGGGATCCTTCGCGGAGGG - Intronic
1119330404 14:73789280-73789302 TCTCTGGGAACACTCACTGTGGG + Intronic
1123004278 14:105314162-105314184 TCCCGGGGAACCCACGCAGGGGG + Exonic
1127838091 15:62806831-62806853 TCCCTGAGACCCCACGCTGTAGG - Intronic
1140486557 16:75298281-75298303 TATCTGGGAACCCACCCTGCAGG + Intronic
1203143641 16_KI270728v1_random:1785266-1785288 TCTCTGGGAAGCCAGGGGCTTGG + Intergenic
1149645131 17:58235376-58235398 TCCCTGGGAACCGACCTGGTGGG - Intronic
1150225586 17:63523054-63523076 TCTCTGGGACCCGACGGGGCTGG - Intergenic
1151980243 17:77504268-77504290 TTTCTGGGAGCGCACGGGGTGGG - Intergenic
1157487786 18:48100857-48100879 TCTCTGGGAACCTAAGAGGGAGG + Intronic
1161802730 19:6424807-6424829 ACTCTGGGAACCCAGCCGCTGGG + Intergenic
925590039 2:5500531-5500553 TCTCTGGGAGCCCATGGTGTTGG + Intergenic
927173354 2:20388598-20388620 TCTCTCTGAACCCACACGCTGGG + Intergenic
928173281 2:29017266-29017288 TCTCTGGGAGCCCAGGCACTGGG - Exonic
930251459 2:49039187-49039209 TCTCTGGGAAACCAGGCTGCAGG + Intronic
936039929 2:109142121-109142143 GCTCAGGGACCCCACCCGGTAGG - Intronic
948887414 2:240891187-240891209 TCTCTGGGAACCCACCTGCCTGG + Intronic
1171374933 20:24685910-24685932 ACTCTGGAAACCCACACGGTGGG - Intergenic
1174576740 20:51542552-51542574 GCTCTGGGACCCCTCGCAGTGGG + Exonic
1180058951 21:45374971-45374993 TCTCTGGGAAGCCATGAGGCTGG + Intergenic
1180073782 21:45451485-45451507 TTTCCGGGATCCCACGGGGTTGG + Intronic
1183163344 22:36129392-36129414 ACTCTGGGAACTCACGGGGAAGG + Intergenic
1183240432 22:36653708-36653730 TCTCTGGGAACCCTGGCACTGGG + Intronic
1183705107 22:39471134-39471156 TCTCTGGGAGCCCTGGGGGTGGG + Intronic
955022048 3:55131091-55131113 TCTCTGGAAAACCACGGGCTTGG - Intergenic
961380557 3:126493973-126493995 TCTCTAGGAACCCATGAGGGAGG - Intronic
966938557 3:184730650-184730672 GCTCTGGGAGCCCACGGGGAAGG + Intergenic
974375579 4:61071860-61071882 ACTCTGGGAAGCCAGGCAGTAGG - Intergenic
977561746 4:98539904-98539926 TCTGTGGGAAGCCATGCTGTGGG + Intronic
997111234 5:131076777-131076799 TCTCTGGCTACCCATGTGGTTGG - Intergenic
1001603229 5:172942738-172942760 GCTCTGGGAACGCACGCGCCAGG - Intronic
1001749279 5:174116611-174116633 TGTCTGGAAACCCAAGTGGTTGG - Intronic
1002889071 6:1317784-1317806 TCTCTGGGAAGCGACGCACTCGG + Intergenic
1030189242 7:106794316-106794338 TCTCTGGGAACTCAGGTTGTAGG + Intergenic
1032415894 7:131735176-131735198 TCCCTGGGGACCCACGTGATAGG + Intergenic
1032431966 7:131869686-131869708 TCTCTGGGAAACTACGCAGATGG - Intergenic
1045031873 8:98144730-98144752 ACTCTGGGTACCCAGGCTGTTGG + Intronic
1048709011 8:137187088-137187110 TTTCAGGGAAACCACGCTGTAGG - Intergenic
1049442960 8:142617538-142617560 CCTCTGGGAACCTAGGTGGTGGG - Intergenic
1055097506 9:72428711-72428733 TCTCTGGGAATCCACAAGCTTGG - Intergenic
1061246415 9:129403105-129403127 TCTCTGAGAACCCAGGTTGTAGG - Intergenic
1187231591 X:17428707-17428729 TCTCTGGGGACCCCAGTGGTAGG + Intronic
1187833711 X:23409236-23409258 TCTCTGAGACACCACGAGGTTGG + Intergenic