ID: 918145960

View in Genome Browser
Species Human (GRCh38)
Location 1:181756058-181756080
Sequence CCCCTGTGGAGACGGTGAAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918145960_918145967 22 Left 918145960 1:181756058-181756080 CCTCTTCACCGTCTCCACAGGGG 0: 1
1: 0
2: 1
3: 18
4: 142
Right 918145967 1:181756103-181756125 TGAGTTGTCATGCTTGTCTGTGG 0: 1
1: 0
2: 1
3: 13
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918145960 Original CRISPR CCCCTGTGGAGACGGTGAAG AGG (reversed) Exonic
900931265 1:5739302-5739324 CCCCTGTGAGGACAGTGCAGTGG - Intergenic
903862039 1:26370479-26370501 TCCCTGAGGTGACGGGGAAGGGG - Intronic
904692464 1:32303977-32303999 CCTCTCTGGAGACAGTGAGGAGG + Intronic
906198832 1:43946731-43946753 CCCCTGAGCAGGCGGTGGAGCGG - Intergenic
907255262 1:53174056-53174078 GCCGAGTGGAGAGGGTGAAGAGG - Intergenic
907527339 1:55061543-55061565 CCCCTCAGGAGCAGGTGAAGAGG + Exonic
909230189 1:73079281-73079303 GCCCTCTAGAGATGGTGAAGTGG + Intergenic
910042214 1:82866547-82866569 CACTTGAGGAGACAGTGAAGGGG + Intergenic
915287909 1:154864582-154864604 CCCCTGGGCATACGGAGAAGCGG + Intronic
915631364 1:157155785-157155807 CCCATTTGGAGCCTGTGAAGAGG - Intergenic
915937809 1:160099037-160099059 GCCCTGCGGGGACGGGGAAGGGG - Intergenic
917333164 1:173903233-173903255 CCCCTGTCGTGTCGGGGAAGGGG + Exonic
918145960 1:181756058-181756080 CCCCTGTGGAGACGGTGAAGAGG - Exonic
921066783 1:211628960-211628982 CCCCAGTGGACAAGTTGAAGAGG - Intergenic
922569554 1:226625940-226625962 CCCTTGTGGAGCTGGTGAAGGGG - Intergenic
922787836 1:228291988-228292010 CCCCTGTGGAGTGGAGGAAGGGG + Exonic
1064344502 10:14519238-14519260 CCCCTGTGAATACGATCAAGTGG + Exonic
1070674742 10:78404773-78404795 ACCCTTTGGAGACAGAGAAGTGG - Intergenic
1071971065 10:90907318-90907340 CCCCTGTGGGGAAGGTAGAGGGG + Intronic
1077378260 11:2215689-2215711 CCGCTGGGGAGTAGGTGAAGGGG + Intergenic
1077819190 11:5719430-5719452 GCTCTGTGGAGATGGTGAGGAGG - Intronic
1080215218 11:29832298-29832320 CCCCAGTGGAGACTGTGCCGGGG - Intergenic
1084785519 11:71439671-71439693 CCCCTGTGGAGACCCTGACTAGG + Intronic
1085342972 11:75745426-75745448 CCCCCTTGGAGACAGTGAGGGGG - Intergenic
1085407494 11:76272126-76272148 CACCTCTGGAAACAGTGAAGTGG + Intergenic
1085418413 11:76335283-76335305 CCCCAGTGGAGACTGTGTGGGGG - Intergenic
1085722999 11:78929621-78929643 CCCCGGGGGAGATGGTAAAGAGG + Intronic
1087241755 11:95789288-95789310 CCCCTGAGGCGCCGGCGAAGAGG + Intronic
1091539709 12:1448771-1448793 CCCCAGTGGGGACTGTGTAGGGG - Intronic
1091692586 12:2607095-2607117 CGAAGGTGGAGACGGTGAAGAGG - Exonic
1101838736 12:108312869-108312891 AGCCTGTGGAGACTGTGCAGAGG - Intronic
1106171979 13:27296309-27296331 CCCGTGAGGACACGGTGAGGAGG + Intergenic
1112336659 13:98522286-98522308 CCCCTGGGGAGAAGGAGTAGAGG - Intronic
1118141885 14:63093049-63093071 TCTCTGTGGAGGGGGTGAAGGGG - Intronic
1118949276 14:70419209-70419231 CCACTGTGGGGACGGTGGTGGGG + Intergenic
1123110237 14:105863811-105863833 CACCTGAGGAGACGGTGACCAGG + Intergenic
1123110341 14:105864212-105864234 CACCTGAGGAGACGGTGACCAGG + Intergenic
1123110639 14:105865404-105865426 CACCTGAGGAGACGGTGACCAGG + Intergenic
1123410715 15:20056579-20056601 CCCCTGTGGAGTGTGGGAAGAGG - Intergenic
1123520044 15:21063285-21063307 CCCCTGTGGAGTGTGGGAAGAGG - Intergenic
1125720388 15:41842441-41842463 CGCCTGTGGAGACGGTGGCGGGG + Intronic
1129163227 15:73759382-73759404 CTCCTCTGGAGACAGTGAATTGG - Intergenic
1129727348 15:77908345-77908367 CCCGTGTGGAGCTGGTGCAGCGG - Intergenic
1129840531 15:78740641-78740663 CCCGTGTGGAGCCGGTGCAGCGG + Intergenic
1130123621 15:81073554-81073576 TCCCTTTGGGGAAGGTGAAGAGG + Intronic
1132294138 15:100722974-100722996 CCCCTGGGTAGAGGGAGAAGAGG - Intergenic
1132609906 16:810497-810519 CCTCAGTAGAGACGGTGCAGCGG + Intronic
1133420023 16:5638159-5638181 GCCCTGTGGAGGGGGTGCAGTGG + Intergenic
1135860302 16:26050093-26050115 CCCCCCTGGAGACTGGGAAGCGG + Intronic
1137249369 16:46731018-46731040 CCCATGTGGACAAGGTGATGGGG + Intronic
1141155323 16:81593161-81593183 GCTCTGTGGAGACGGTCAAGAGG - Intronic
1143141288 17:4743285-4743307 CACCTCTGGAGAAGGAGAAGGGG - Exonic
1144793620 17:17876416-17876438 TCCATGTGGAGACTGTGCAGTGG + Intronic
1146269743 17:31477021-31477043 GCCCTGTGGAGAAGGTGGTGGGG - Intronic
1146540760 17:33692252-33692274 TTCCTGTGAAGAGGGTGAAGAGG - Intronic
1147266583 17:39238015-39238037 CTCCTCTGGAGATGGGGAAGTGG + Intergenic
1148072297 17:44915432-44915454 CCCCTGAGGAGACGTAGGAGCGG + Exonic
1148804427 17:50257211-50257233 TCCCTGTGGAGAAGCTGGAGAGG + Intergenic
1148863798 17:50618298-50618320 CACCTGTGGAGACTCGGAAGAGG - Exonic
1149866413 17:60153682-60153704 CCCCTGTGGAGACTGAGCAAAGG + Intronic
1151775311 17:76197184-76197206 CCCCTGTGGTGAAGGGGAATAGG + Intronic
1152012139 17:77725179-77725201 CTGCTGAGGAGACTGTGAAGAGG + Intergenic
1152083352 17:78202542-78202564 CCCCTATGGAGACGGCGAAGGGG + Exonic
1154018796 18:10644487-10644509 CCCCTGTGAGGACACTGAAGTGG - Intergenic
1154185432 18:12178935-12178957 CCCCTGTGAGGACACTGAAGTGG + Intergenic
1155716655 18:28952456-28952478 CCCCAGTGGAGACTGTGTGGGGG + Intergenic
1156347028 18:36266607-36266629 CCCCAGCAGAGACGGTGAACAGG + Intronic
1157584760 18:48794016-48794038 CCCCTGGGGAGATGGGGATGGGG - Intronic
1157784772 18:50471745-50471767 TCACTGTGTAGACGATGAAGTGG - Intergenic
1160155940 18:76433891-76433913 CCCCTGTGGAGCTGGGGACGTGG - Intronic
1160389552 18:78519648-78519670 CCCCTGTGGAGGCGGTGGAAAGG - Intergenic
1161707331 19:5828367-5828389 TCCCGGTGGAGACGGCGACGTGG - Intergenic
1162274131 19:9639670-9639692 CCCCTGAGAAGAAGGTAAAGTGG + Intronic
1162791001 19:13062932-13062954 ACCCTGTGGGGAAGGGGAAGTGG - Intronic
1162827079 19:13259577-13259599 CTCCCGTGGACACGGTGAAGAGG + Exonic
1163187447 19:15649044-15649066 TCCCTGGGGAGAAGATGAAGAGG + Intronic
1163217343 19:15890527-15890549 TCCCTGGGGAGAAGATGAAGAGG - Intronic
1167703508 19:51065104-51065126 GGCCTGAGGAGAAGGTGAAGGGG + Exonic
925169608 2:1743197-1743219 CTGCTGTGGAGACCGTGACGCGG + Intronic
925756676 2:7139396-7139418 CACCTGTGGAGGGGGTGGAGGGG + Intergenic
925969326 2:9095958-9095980 ACCCTGTGGAGAAGCTCAAGGGG + Intergenic
926079243 2:9970654-9970676 AGCCTGTGGAGAAGGGGAAGGGG + Intronic
932518039 2:72373834-72373856 CCACTATGGAGACGGTGTGGTGG + Intronic
932883610 2:75527419-75527441 CCCCAGTGGAGAGGGGGAGGGGG - Intronic
933713716 2:85345334-85345356 TCCCTGAGGAGCCGGGGAAGGGG - Intronic
939015980 2:136904175-136904197 CAAATGTGGAGACGGGGAAGTGG + Intronic
940601468 2:155866964-155866986 CCCATGTGGAGATCATGAAGTGG + Intergenic
948049530 2:234969119-234969141 CCCCTGTGGCTACGGGGAAGAGG - Intronic
1168898814 20:1342642-1342664 CCCCTGTGAAGACTGAGAAGTGG + Intronic
1170193035 20:13662584-13662606 ACCCTGTGCAGAGGGAGAAGGGG - Intergenic
1170609088 20:17897039-17897061 CCCCTGTAGAGACAGTGAGCAGG + Intergenic
1173227912 20:41172656-41172678 CCCCTGTGAGGAGGGTGAGGAGG + Intronic
1175149446 20:56921584-56921606 CCCCTGGGCTGACGGAGAAGGGG - Intergenic
1179511243 21:41875205-41875227 CCCCTGTGGAGGCTCTGGAGGGG - Intronic
1180068161 21:45423142-45423164 GCCCTATGGAGAAGGAGAAGTGG - Intronic
1180941504 22:19662248-19662270 CCACTGGGGAGACGCTGATGTGG + Intergenic
1181472997 22:23152289-23152311 CCCCTCTGGGGACTGTGAAGGGG + Intronic
1181863865 22:25840182-25840204 GCCCTGGGGAGACAGTGAACAGG - Intronic
1182619450 22:31610860-31610882 CCCCTGTGGAGGCTGTGGACAGG + Intronic
1183095643 22:35550542-35550564 CTGCTGTGGAGACGGTGGGGTGG - Intronic
1183831020 22:40418445-40418467 TCCCTGTGGAGTCGGTGATGAGG + Exonic
1184942874 22:47781904-47781926 CCTCTTTGGACACGGTGAGGTGG - Intergenic
1185146088 22:49137427-49137449 CCCCTGTGCAGGCGGTGCAGTGG + Intergenic
950004049 3:9680015-9680037 CACCTGGGGAGATGGTGAAAAGG - Intronic
950415878 3:12868934-12868956 CCCCTGTGGACCCAGTGGAGAGG + Intronic
950670564 3:14522928-14522950 CCCCTGCGAAGAAGGTGGAGTGG - Intronic
950746945 3:15098240-15098262 ACCCTGGGGAGACGGCGAAGTGG - Exonic
953613591 3:44469336-44469358 CACCTGTGTAGACTGTGGAGTGG - Intronic
955078658 3:55637433-55637455 CCCATGTGCAGAGGGAGAAGTGG + Intronic
955151916 3:56375904-56375926 GCCCTATGGAGAGGCTGAAGTGG + Intronic
957148692 3:76457608-76457630 CCCCTGTAGAGACCGTGTGGGGG + Intronic
960459873 3:117920495-117920517 CCCCTGTTGAGACAGGGGAGGGG + Intergenic
960936456 3:122906920-122906942 CCCCTGTGGAGACAGCGGAGTGG + Intergenic
961008906 3:123423313-123423335 CCCCTGCGGAGAAGGGGAAGCGG + Intronic
961456723 3:127028215-127028237 CACCTGAGGTGCCGGTGAAGGGG + Exonic
961679633 3:128590840-128590862 CCACTGTGGAGAAGTTGCAGAGG + Intergenic
961942256 3:130650267-130650289 TCCATGTGGAGACCGTGAAGGGG + Intronic
962883912 3:139605402-139605424 CCACTGTGGACATTGTGAAGTGG - Intronic
966159418 3:176952209-176952231 CCCCTGTGCAGACTCTGTAGAGG - Intergenic
966807418 3:183818155-183818177 CCCCTGGGGAGTCGGTAAAGGGG - Intronic
968288124 3:197519984-197520006 CCCCGGTGGAGAAGGGGAAGAGG + Intronic
969245741 4:5931678-5931700 CCCCTGCAGAGAGGGTGGAGTGG - Intronic
969247582 4:5945554-5945576 GCCCTGTGGAGTCGGGGCAGTGG + Intronic
969710495 4:8840504-8840526 CCCTTGTGGGGGCTGTGAAGAGG - Intergenic
969993390 4:11287492-11287514 ACCATGTGGAGTCGGTGATGCGG - Intergenic
976476374 4:85488253-85488275 CTCCTGTGGAGAGGGGGAAAAGG + Intronic
979640496 4:123008179-123008201 CACTTGTGTAGAAGGTGAAGGGG + Intronic
981270642 4:142845222-142845244 CTCCTGGGGAGTCGGTGGAGAGG - Intronic
982086691 4:151842814-151842836 CAGCTGTGGAGAGGGTGCAGAGG + Intergenic
982501672 4:156164886-156164908 TTCCTGTGTAGACGGTGGAGTGG + Intergenic
984785556 4:183564395-183564417 CCCTTGTGGACAGGGTGCAGGGG + Intergenic
985911577 5:2887845-2887867 GCCCTGGGGAGACGCTGGAGAGG - Intergenic
986928849 5:12794359-12794381 CCCAGGTGGAGAGGGTGAGGAGG + Intergenic
987073800 5:14361711-14361733 CTCCTGTGGAGAAGGTGCATAGG + Intronic
992991805 5:82291547-82291569 CTCCTGTGGAGACAGTAGAGGGG + Intronic
996612043 5:125393812-125393834 ACCCTGTGGAGAGGCTTAAGGGG + Intergenic
998392394 5:141795669-141795691 CCCCTGTGGACAAGGGGCAGGGG + Intergenic
998813163 5:145986537-145986559 CACCTGTGGAGAAGGGCAAGGGG - Intronic
1003029878 6:2592769-2592791 CCCTTGTGCAGTCGGTGCAGAGG + Intergenic
1004048857 6:12053560-12053582 GCCCTGTGGAGATGGTGTGGGGG + Intronic
1007990883 6:46254871-46254893 GTCCTGTGAAGACAGTGAAGTGG + Intronic
1011090290 6:83590103-83590125 CCCTTGTGGTGACTGTGGAGGGG + Intronic
1012449370 6:99338965-99338987 CCTCTGGGGACATGGTGAAGTGG - Intronic
1014845270 6:126268228-126268250 CCCCTGTGGAGAGTGTGCACTGG - Intergenic
1014883923 6:126756611-126756633 CCCCAGTGGGGACTGTGTAGGGG + Intergenic
1015652528 6:135479163-135479185 CCCCAGTGGAGACTGTGTGGGGG - Intronic
1019304215 7:325181-325203 CACCTGCGGAGACGGTCATGGGG - Intergenic
1020143117 7:5623121-5623143 AGCCTGTGGAGAAGGTGCAGAGG - Exonic
1029452703 7:100650133-100650155 CCACTGTGGAGAAAGTGCAGAGG + Exonic
1034282966 7:149866295-149866317 CGCCCATGGAGACGGTGATGGGG - Exonic
1035797897 8:2376204-2376226 CCCTTGTGGCCACAGTGAAGAGG - Intergenic
1035981314 8:4375345-4375367 CCCCTGTGTGGATGGTGAATAGG - Intronic
1040313443 8:46248699-46248721 CCCCAGTAGAGACAATGAAGCGG + Intergenic
1041380619 8:57250835-57250857 GGCCTGTGCAGAAGGTGAAGAGG - Intergenic
1058122099 9:101150017-101150039 CAGCTGTGGATACAGTGAAGAGG - Intronic
1060978388 9:127778782-127778804 CCCCTGCGGAGAGGGTGGGGAGG - Intergenic
1061681849 9:132246329-132246351 CCCCTGGGGAGACAGGGAGGCGG - Intergenic
1062347052 9:136119615-136119637 CCCCTGGGGCGACCGTAAAGTGG + Intergenic
1186409677 X:9335866-9335888 GCCCTGTGTAGACTGTCAAGAGG - Intergenic
1189194653 X:39142595-39142617 CCCCTGTGTAAAGGGTGAAGAGG + Intergenic
1190927906 X:54925055-54925077 ACACTCTGGAGAAGGTGAAGGGG + Exonic
1193911248 X:87309394-87309416 CCCCAGTGGAGACTTTGTAGGGG + Intergenic