ID: 918146127

View in Genome Browser
Species Human (GRCh38)
Location 1:181757732-181757754
Sequence AGGTGTTGCCACATGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918146127_918146132 1 Left 918146127 1:181757732-181757754 CCCTACTCCATGTGGCAACACCT 0: 1
1: 0
2: 0
3: 13
4: 125
Right 918146132 1:181757756-181757778 CAGTTTTGTGTACTCCTTTAAGG 0: 1
1: 0
2: 2
3: 13
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918146127 Original CRISPR AGGTGTTGCCACATGGAGTA GGG (reversed) Intronic
903490895 1:23727491-23727513 ACGTGTTGCCCCATGGAGACTGG + Intergenic
912577490 1:110686708-110686730 AGTTGGTGACACAAGGAGTAGGG - Intergenic
913074718 1:115332122-115332144 AGGAGTTGTTACGTGGAGTAAGG + Intronic
913446021 1:118951657-118951679 AGGTTTTGCCACTTGGAATCAGG - Intronic
918146127 1:181757732-181757754 AGGTGTTGCCACATGGAGTAGGG - Intronic
920607114 1:207399434-207399456 AGGAGCTGCCAAATGGAGTAGGG + Intergenic
924215678 1:241819310-241819332 AGGTGGTCCCACGTGGACTACGG + Intergenic
1066638005 10:37526170-37526192 AGGAGTTGCAGCATGAAGTATGG + Intergenic
1070524700 10:77285683-77285705 GGGTGTTACCACATGGCATAGGG + Intronic
1075244720 10:120810859-120810881 AGCTGTGGCCACATAGAGTGGGG - Intergenic
1077063802 11:629387-629409 AGGTGTTGCCGCAGAGAGAATGG - Intergenic
1080377480 11:31730317-31730339 AGGTGTTCTCACATGGTGGAAGG + Intronic
1098972773 12:76873492-76873514 AGGAGGAGCCAAATGGAGTACGG - Intronic
1099033200 12:77554631-77554653 GGGTGATGTCACATGGAGTAAGG + Intergenic
1100501144 12:95175039-95175061 AGGTGTTGCCACATCCATTAGGG + Intronic
1104141570 12:125992425-125992447 AGGTGATGACACATGAAGTATGG + Intergenic
1105404792 13:20124615-20124637 AGATGATGCCACATGCTGTAGGG + Intergenic
1109335943 13:60993779-60993801 ATGTGCTACCACATGGAGAAAGG - Intergenic
1109996970 13:70141343-70141365 AGGGGTTGCCACATGCAGTTGGG - Intergenic
1110521169 13:76478541-76478563 AGTTGTTCACACATGGAGAAAGG - Intergenic
1111978876 13:94996465-94996487 AGGTGTAGCCACAAGGGGTCTGG + Intergenic
1113469747 13:110536002-110536024 AAATGTGACCACATGGAGTACGG + Intronic
1118655128 14:67939213-67939235 ATGTGTTTCCACATGGAGGGGGG - Intronic
1121020680 14:90578430-90578452 AGCTGTTTCCACTTGGAGCAGGG - Intronic
1125553676 15:40566696-40566718 AGGTTTTGCCACATTGCCTAGGG - Intergenic
1127860937 15:62993981-62994003 AGCTGTGCCCACATTGAGTATGG + Intergenic
1131198420 15:90375856-90375878 AGGGGTTGCTACATGGGGAATGG - Intergenic
1135848776 16:25943245-25943267 AGGTGTTCCAACATGAAGGATGG + Intronic
1136358266 16:29760881-29760903 AGCTGGTGCCAAATAGAGTAGGG + Intergenic
1138913944 16:61439861-61439883 ATGTGTTACAACATGGAGAAAGG - Intergenic
1139952103 16:70677503-70677525 AGGTCTGCCCACATGGAGCAGGG + Intronic
1141144896 16:81522273-81522295 AGGTGTGGCCACCTGGCTTAGGG - Intronic
1144836249 17:18158101-18158123 AGGTGTGGCCAAATGGGGTAGGG + Intronic
1145029379 17:19493099-19493121 AGCTGTAGCCACCTGGAGCAAGG + Intergenic
1145264162 17:21371575-21371597 AGGAGATGCCAGATGGAGCATGG + Intergenic
1146224818 17:31056397-31056419 AGGTAATGCTACATGGAGAAAGG + Intergenic
1146257161 17:31398361-31398383 AGGTTTTGCCAAATGGATTCAGG - Intronic
1146263754 17:31437914-31437936 AGGTGGAGCCACATCCAGTAAGG - Intronic
1150477663 17:65487225-65487247 AGGGTTGGCCCCATGGAGTAGGG - Intergenic
1150837693 17:68579324-68579346 AGGTGATGGAACATGGACTATGG + Intronic
1153550597 18:6258154-6258176 AGGTCTCACCACATGCAGTAAGG + Intronic
1163071464 19:14845590-14845612 AGGAGCTACCACATTGAGTAGGG + Intergenic
1163515384 19:17759943-17759965 AGGTGTTGGCAAATGCAGTAAGG - Intronic
1165079511 19:33299400-33299422 GGGTGTAGCCACATGGTCTAGGG + Intergenic
925058547 2:873609-873631 AGGTGTTTCCACACAGAGTTAGG + Intergenic
925385386 2:3458339-3458361 AGATGCTGCCACAAGGAGTGAGG - Intronic
926057190 2:9780953-9780975 AGGTGATCCCACCTGGAGTTAGG + Intergenic
926675977 2:15620068-15620090 AGTTGTCGCTACATAGAGTAAGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
938682415 2:133705157-133705179 AGGTGTATCCCCATGGAGTCAGG + Intergenic
939530818 2:143359287-143359309 AGATGTTGCAAGATGGAGTAAGG - Intronic
940523358 2:154780229-154780251 AAGTGTTTCAACATGGATTAAGG + Intronic
946673440 2:222131190-222131212 TGTTGTTGTCACATGGAGGAAGG + Intergenic
947478204 2:230471279-230471301 AAGTGTGGCCAGATAGAGTAGGG + Intronic
1168994353 20:2121685-2121707 AGGTGGTGCAACATTGAGGATGG + Intronic
1169896507 20:10510366-10510388 GTGTGTGGCCACAAGGAGTATGG - Intronic
1171435638 20:25120942-25120964 AGGAGTTGCTACATGGACCAAGG + Intergenic
1171479331 20:25441082-25441104 AAGTGCTGCCACAGGAAGTAAGG - Intronic
1173625147 20:44466977-44466999 AGGTGCTGCCACCCGCAGTAAGG - Intergenic
1175221108 20:57416944-57416966 TGGTGTGGCCACAGGGAGAAAGG + Intergenic
1175794592 20:61763723-61763745 AGGTGAAGCCACATGGGGGAGGG - Intronic
1175855587 20:62119221-62119243 AGGTGGGGAGACATGGAGTAAGG - Intergenic
1176202147 20:63865895-63865917 AGGGGTTGCCTCATGGAGAGGGG + Intronic
1177731228 21:25028868-25028890 AGGAATTGGCACATGGATTAGGG - Intergenic
1180764364 22:18234968-18234990 AGGTCTTGCCACTGGGAGTGGGG + Intergenic
1180771275 22:18389573-18389595 AGGTCTTGCCACTGGGAGTGGGG - Intergenic
1180802662 22:18639188-18639210 AGGTCTTGCCACTGGGAGTGGGG - Intergenic
1180853899 22:19034744-19034766 AGGTCTTGCCACTGGGAGTGGGG - Intergenic
1181219059 22:21356073-21356095 AGGTCTTGCCACTGGGAGTGGGG + Intergenic
1182844019 22:33415976-33415998 TGGTGCAGCCACAGGGAGTATGG - Intronic
1203233115 22_KI270731v1_random:130564-130586 AGGTCTTGCCACTGGGAGTGGGG - Intergenic
952114025 3:30158158-30158180 AGGTGATGACACATTGAGGATGG + Intergenic
952825860 3:37524241-37524263 AGGTGTTTCAAGATGGAGTGGGG + Intronic
953615272 3:44484520-44484542 AGTGGTTGCCACAGGGAGGAGGG - Intergenic
956726905 3:72163794-72163816 AGCTGTGGCCACAGGGCGTATGG - Intergenic
957360852 3:79155597-79155619 AGTTCTTGCCACATGTACTATGG - Intronic
959192711 3:103135574-103135596 AATTCTTGCCACATGCAGTATGG + Intergenic
960898905 3:122534390-122534412 AGGTTTTACAACATGGAATAGGG + Intronic
961503934 3:127357704-127357726 AGGTGGTACCACAAAGAGTAGGG - Intergenic
962488642 3:135869013-135869035 AGGTGATGCCACAGGGAGTGAGG - Intergenic
963785007 3:149525629-149525651 AGGTGCTGCCAGAGCGAGTACGG - Intronic
964822351 3:160785961-160785983 AGATATTGCCAAATGGAGTTTGG - Intronic
964869479 3:161297592-161297614 AGGTCTTGTCTCATGGAGGATGG - Intergenic
966047480 3:175570273-175570295 AGGGGTGTCCACATTGAGTAGGG + Intronic
967802124 3:193673975-193673997 AGCTGTTGCCACCTCGCGTAGGG - Intronic
969931692 4:10637012-10637034 AGGTGTTGCAGTATGGAGCAGGG + Intronic
970837049 4:20421829-20421851 AGGTGCTGTCAAATGGAGAAAGG - Intronic
971543205 4:27848612-27848634 ATGTATTGCCAAATGAAGTATGG + Intergenic
976989243 4:91344197-91344219 ATGTGTTCTCACATGGAGGAAGG - Intronic
982552891 4:156824983-156825005 AGTTGTTGGCACATGTATTAAGG - Intronic
984459269 4:180012395-180012417 AGGTGTTGGCAAATTGAATAAGG - Intergenic
989116354 5:37957177-37957199 AGGTTATACCACATAGAGTAGGG + Intergenic
990197762 5:53337809-53337831 AGCTGTGGACACATGGAGTCTGG - Intergenic
992376936 5:76197541-76197563 AGATTTTGCCACCTGGACTAAGG - Intronic
993799142 5:92309094-92309116 ATCTGTTGCCACATGTAGTCTGG + Intergenic
994322402 5:98408384-98408406 AGGTGTAGCCACATTGGGTCAGG - Intergenic
997643831 5:135467219-135467241 AGCTGTGAGCACATGGAGTAGGG + Intergenic
998560442 5:143166379-143166401 AGGTGGAGCCACTTGGAGGAAGG + Intronic
999357532 5:150950334-150950356 AGGTTTTCCCACATTCAGTAAGG + Intergenic
1001201171 5:169718172-169718194 AGATGATGCCACAGGGAGTTTGG + Intronic
1002985877 6:2190698-2190720 AGGTGCTGCCAAGTGGAGGATGG - Intronic
1004354301 6:14917885-14917907 AAATGTTCCCAAATGGAGTATGG - Intergenic
1004424880 6:15500539-15500561 ATGTGTTGTCACATGGAGGCGGG - Intronic
1005557566 6:27002963-27002985 AGGTGATGCCTCTTGGAGAACGG + Intergenic
1010819347 6:80395391-80395413 AGGTGATGTCAGATGGAGAAGGG + Intergenic
1014513022 6:122348296-122348318 AGGTGTTGTCAAATGAAGGAAGG - Intergenic
1015347831 6:132180316-132180338 AGTTGTTTCCACAGGGATTATGG - Intergenic
1015826643 6:137319544-137319566 AGGTGTAGCCAAATGAAATATGG + Intergenic
1017557745 6:155590385-155590407 TGGTTTTGCCAGATGGAATATGG + Intergenic
1019148881 6:169991200-169991222 AGGTGTTGCCACATGATTCAGGG + Intergenic
1020997310 7:15280330-15280352 AAGTGTTGGCACAGGGAGTGGGG - Intronic
1023369930 7:39503029-39503051 AGGAGTAGGCACATGGAGAAGGG - Intergenic
1031971817 7:128070173-128070195 AGGTGGTGCCACACTGAGGAAGG - Intronic
1034994817 7:155570957-155570979 AGATGTGGCGACATGGGGTAGGG - Intergenic
1035465567 7:159073779-159073801 AGGCAGTGCCACATGGAGTGGGG + Intronic
1036086280 8:5616606-5616628 TGGTATTCCCACATGGAGAAGGG - Intergenic
1037728215 8:21501545-21501567 AGCTGCTGGCACATGGATTATGG + Intergenic
1039010294 8:33086259-33086281 AGGTGTGGACACATGCAGTATGG + Intergenic
1040557826 8:48496656-48496678 AGGTGTAGCCAGATGGAGAGAGG + Intergenic
1045831709 8:106469703-106469725 TGGTGTTCCCACATGTAGAAAGG + Intronic
1046010205 8:108537156-108537178 AGCTGTTGCCTAATGCAGTATGG + Intergenic
1046319946 8:112559496-112559518 TGGTGTTGCCCCCAGGAGTAAGG + Intronic
1049331813 8:142058638-142058660 GGGTGTTGTCAGATGGAGCAGGG - Intergenic
1050625657 9:7501345-7501367 AGGAGTAGCTACCTGGAGTAAGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055510420 9:76990809-76990831 AGGTGTGGAGAAATGGAGTAGGG - Intergenic
1059918472 9:119130923-119130945 AGGTATTGCCACCTGGAGATTGG + Intergenic
1061344495 9:130011566-130011588 TGGTGTTGCCACATGGGGAAGGG - Intronic
1061932031 9:133838256-133838278 AAGTCTTCCCACATGCAGTAGGG - Intronic
1186971298 X:14847469-14847491 AGATGTTGAGACATAGAGTATGG + Intronic
1189057440 X:37713161-37713183 AGCTGATGCCACATGGAGCAAGG - Intronic
1190282328 X:48939243-48939265 AGGTCCTGCCCCAGGGAGTAAGG - Intronic
1196092592 X:111761902-111761924 AGGTGTAGCCACAGGGGGAAAGG - Intergenic
1196553005 X:117052620-117052642 AAGTGTTGACACATGGAAAAGGG - Intergenic
1198129584 X:133680285-133680307 AGGTGTTCCCACCTGGGGTAGGG - Intronic