ID: 918146293

View in Genome Browser
Species Human (GRCh38)
Location 1:181758826-181758848
Sequence TTCCCTGGAATGTGTCCTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 238}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918146285_918146293 26 Left 918146285 1:181758777-181758799 CCTATGAGCTGGCCCTGAAGTAC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 918146293 1:181758826-181758848 TTCCCTGGAATGTGTCCTGAAGG 0: 1
1: 0
2: 1
3: 21
4: 238
918146290_918146293 -7 Left 918146290 1:181758810-181758832 CCTTCACCATGGTGTTTTCCCTG 0: 1
1: 0
2: 0
3: 19
4: 258
Right 918146293 1:181758826-181758848 TTCCCTGGAATGTGTCCTGAAGG 0: 1
1: 0
2: 1
3: 21
4: 238
918146286_918146293 14 Left 918146286 1:181758789-181758811 CCCTGAAGTACCTGAATATCGCC 0: 1
1: 0
2: 0
3: 5
4: 49
Right 918146293 1:181758826-181758848 TTCCCTGGAATGTGTCCTGAAGG 0: 1
1: 0
2: 1
3: 21
4: 238
918146287_918146293 13 Left 918146287 1:181758790-181758812 CCTGAAGTACCTGAATATCGCCT 0: 1
1: 0
2: 0
3: 2
4: 39
Right 918146293 1:181758826-181758848 TTCCCTGGAATGTGTCCTGAAGG 0: 1
1: 0
2: 1
3: 21
4: 238
918146288_918146293 4 Left 918146288 1:181758799-181758821 CCTGAATATCGCCTTCACCATGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 918146293 1:181758826-181758848 TTCCCTGGAATGTGTCCTGAAGG 0: 1
1: 0
2: 1
3: 21
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918146293 Original CRISPR TTCCCTGGAATGTGTCCTGA AGG Exonic
900639134 1:3680550-3680572 GTCCCAGGCATGTTTCCTGAAGG - Intronic
902154098 1:14469691-14469713 TTCCCTTGAACATGTCCTGATGG + Intergenic
902230338 1:15023524-15023546 TTCCCCGGAATGTGAGCTGGGGG + Intronic
902806630 1:18865237-18865259 TTCCCAGGCATCTGTCCTCAGGG - Intronic
904338417 1:29812875-29812897 TTTCCTGGAATGAGACCTGGAGG + Intergenic
904717087 1:32476559-32476581 TTCCCTGAATTGTGCCCAGAGGG + Intronic
905541361 1:38763038-38763060 TTTCCTGGAACATGTCCTGGGGG - Intergenic
906922056 1:50075223-50075245 TTCCCTAAAATGTCTCCTAAAGG - Intronic
909345461 1:74580430-74580452 ATTCCAGGAATGTGTCCTAAGGG - Intronic
910870506 1:91828970-91828992 TTCCTGGGCATGTGTCCTGCTGG + Intronic
911335909 1:96579883-96579905 TACCTTGCAGTGTGTCCTGAGGG - Intergenic
913025648 1:114836335-114836357 TTCCCTGGAATACCTCTTGAAGG + Intergenic
913280383 1:117179902-117179924 TTCCCAGGACTGAGTCCTCAGGG - Intronic
913610600 1:120506254-120506276 TTCCTTGGAGTCTGTCATGAAGG - Intergenic
913984197 1:143550559-143550581 TTCCTTGGAGTCTGTCATGAAGG + Intergenic
914418251 1:147504532-147504554 TTCCCTGGTGTGTGCGCTGAAGG + Intergenic
914580590 1:149015985-149016007 TTCCTTGGAGTCTGTCATGAAGG + Intronic
915258912 1:154660975-154660997 TGGCCTGGAAGGTTTCCTGAAGG - Intergenic
917547863 1:175991893-175991915 TTTTCTGGAATGTCTCCTGAAGG + Intronic
917590342 1:176469819-176469841 GGCCCTGGAATGTGTACTGTGGG - Intronic
917656136 1:177127614-177127636 TTCAATGGAAGGTGACCTGAGGG + Intronic
918146293 1:181758826-181758848 TTCCCTGGAATGTGTCCTGAAGG + Exonic
919724950 1:200875625-200875647 GTGCCTGAAATGTGTCCTGCTGG - Intergenic
920571343 1:207020353-207020375 ATTTCTGGACTGTGTCCTGATGG - Exonic
920602843 1:207346614-207346636 TGCACTGGAATTTGTCCTCAGGG + Intronic
920831415 1:209469188-209469210 TTCCCTGGTATGTGGCCTCCAGG - Intergenic
923699338 1:236284837-236284859 GTCCCTGAATTCTGTCCTGATGG - Intergenic
923884764 1:238142084-238142106 TTCCCTGGAATAGGTCCTTTGGG + Intergenic
924102468 1:240618905-240618927 TTCTCAGGAATGGGTCCTGTGGG - Intergenic
1063103612 10:2973423-2973445 TTCCCTGAAAGGTGTCCCCAGGG + Intergenic
1063387411 10:5624772-5624794 TTCCCGGGAATGTGATCTGGAGG + Intergenic
1064691217 10:17920331-17920353 TTCTATGGACTGGGTCCTGACGG + Intergenic
1067143338 10:43674754-43674776 TTCTCTGGAGTCTGTCCTAAAGG - Intergenic
1068042123 10:51838567-51838589 TTACTTGGAAAGTGTCCTGCAGG + Intronic
1068680242 10:59811365-59811387 CTTCCTGGAATCTATCCTGAAGG + Intronic
1071194367 10:83140610-83140632 TTTCCTAGAATCTGTCCTGGGGG - Intergenic
1071569670 10:86690099-86690121 TTCCCTGGAATGTGCCCAGGAGG - Intronic
1077224316 11:1433463-1433485 CTCCCAGGAGTTTGTCCTGAGGG + Intronic
1077305541 11:1867177-1867199 TCCCTTGGAACTTGTCCTGATGG + Intronic
1077358344 11:2128783-2128805 TTCCCTGGAGTTGGTACTGATGG + Intergenic
1077631683 11:3815557-3815579 TTCCTTGGAAGGTTGCCTGAAGG - Intronic
1078473863 11:11613721-11613743 TGGCCTGGAATGTCTCTTGAAGG - Intronic
1082220915 11:49635358-49635380 TATTCTGGAATATGTCCTGATGG + Intergenic
1086845755 11:91747912-91747934 GTGCCTGGAATTTCTCCTGAAGG + Intergenic
1087629417 11:100633129-100633151 CTCCCTGGAATGAGTCCTCACGG - Intergenic
1089575435 11:119439134-119439156 GTGCCTGGAATGGGGCCTGAGGG - Intergenic
1090196614 11:124821982-124822004 GTCCCTGGAAATTGTCCTAAGGG - Intergenic
1095957167 12:47813474-47813496 CTCCTTGGAATGGGTCCTGCAGG + Intronic
1098515372 12:71369620-71369642 TCTCCTGGAATGCCTCCTGAAGG - Intronic
1098879046 12:75897878-75897900 TTCCCTGGGATGTGCCCAGCTGG + Intergenic
1100015458 12:90005439-90005461 TGCCCTGGAATGAGCCTTGAGGG + Intergenic
1100586274 12:95982938-95982960 TTCTCTGGAATGTTCCATGATGG - Intronic
1104214555 12:126723406-126723428 TTCCCTGGAGTGTGACTAGATGG - Intergenic
1105760313 13:23508020-23508042 TCCCCTGGAATCCCTCCTGAAGG - Intergenic
1107627213 13:42301261-42301283 TTACCTGGATTGTGTTCTGAAGG - Exonic
1110416508 13:75259377-75259399 TTCCCTGGAATGCTTTTTGAGGG + Intergenic
1111269072 13:85856175-85856197 TCTCCTGGAATATATCCTGAAGG + Intergenic
1112591610 13:100768393-100768415 TTCCTTTGAATGTGTCCTGCTGG + Intergenic
1114016623 14:18435868-18435890 TTCTCTGTAATGTTTCTTGAGGG + Intergenic
1114416502 14:22548382-22548404 TTCCCTGACTTTTGTCCTGAAGG - Intergenic
1114922142 14:27344932-27344954 ATCTCTGGAAGGTGACCTGATGG + Intergenic
1115482533 14:33875421-33875443 TTCCAAGGAATCTGACCTGAGGG + Intergenic
1117783628 14:59259635-59259657 GTCTCTGGTATGTGTCCTCAGGG - Intronic
1119371569 14:74149620-74149642 TTGCATGGAATGTGTTTTGAAGG - Intronic
1119669777 14:76509615-76509637 TTCCCTGTAATGTAGTCTGAAGG - Intergenic
1121342199 14:93112094-93112116 TTGCAAGGAATGTGTCCTGGGGG + Intronic
1124166109 15:27327433-27327455 TCCCCTGGAGTGTGTCCTCCTGG + Intronic
1127580904 15:60338596-60338618 TTTCCTGGAATCTGGCCTCAAGG - Intergenic
1128127575 15:65204375-65204397 ATCCCTGGCTTGTGCCCTGATGG - Exonic
1128535367 15:68486199-68486221 CTCCCTGCTCTGTGTCCTGAGGG - Intergenic
1131602296 15:93861959-93861981 TTGCCTGGAATGTATCCTCATGG + Intergenic
1132585231 16:703284-703306 TTCCCAGGCATGTGTCCAAAAGG - Intronic
1133155679 16:3873914-3873936 TTCCCTCAAATATTTCCTGAGGG + Intronic
1136517615 16:30777420-30777442 TTCCGGGGAAAGTGACCTGAAGG - Intergenic
1138337837 16:56267079-56267101 TTCCCTGGAATGTGGTCTTGTGG - Intronic
1139874570 16:70135150-70135172 TCCACTGGATTATGTCCTGATGG + Intronic
1145236236 17:21210154-21210176 TTCCCTGGAACATGACCTAAAGG + Intronic
1146605568 17:34254892-34254914 CCCCTTGGAATGTGGCCTGAAGG + Intergenic
1147759255 17:42787202-42787224 TTCCCAAGAAGGCGTCCTGATGG + Intronic
1148127669 17:45245254-45245276 GTCCCTGGACAGTGTCCTGGCGG + Exonic
1148830663 17:50428827-50428849 TTCTCAGGAATGTTTGCTGATGG - Intronic
1150375712 17:64680089-64680111 CTCTCTGGACTGGGTCCTGAGGG - Intergenic
1151070498 17:71205016-71205038 TTCCCTGGGAAGTGTCGTAAAGG - Intergenic
1151784619 17:76269423-76269445 ATCCCTGGTTTGTGTCCTCAAGG + Intronic
1151898679 17:76997296-76997318 GTGCCTGGAATTTCTCCTGAAGG - Intergenic
1152877634 17:82796146-82796168 TTCCCTGGGAGGTGGGCTGACGG - Intronic
1153368971 18:4292652-4292674 TTTCCAGGAATGTGGCTTGAAGG + Intronic
1156710881 18:39944087-39944109 TTCCCTGGTTTGTGTTCTCAAGG + Intergenic
1156905524 18:42348009-42348031 ATCCCTGTAATGAGTTCTGAAGG - Intergenic
1157313237 18:46568109-46568131 TTCCCTGGAGTGAGTTTTGATGG + Intronic
1158622876 18:59047911-59047933 TTCACTGGAATGTAACCTGAGGG - Intergenic
1158898858 18:61942043-61942065 TTCTCTGGAAACTGTGCTGATGG + Intergenic
1158900788 18:61960164-61960186 ATCTCTGGCATGTGTCCAGATGG + Intergenic
1159083923 18:63766039-63766061 TTCCCTGGAATGTAGGCTGCAGG - Intronic
1160957036 19:1698579-1698601 GCCCCTGGACAGTGTCCTGAAGG - Intergenic
1162529752 19:11229089-11229111 TCCCCTGGCATGTCTCCAGAGGG - Intronic
1163468450 19:17483358-17483380 GTGCCTGGAAGGTTTCCTGAGGG + Intronic
1164730705 19:30502121-30502143 TTCCCTGGCATTTGACCAGATGG - Intronic
1165337022 19:35178077-35178099 TTTCCTGGAATGTGGCATGATGG - Intergenic
1165825718 19:38704760-38704782 TTCCCTGCATTTTCTCCTGAGGG + Intronic
1166210206 19:41302067-41302089 TTCCCTGGGGTGAGGCCTGAGGG + Intronic
1166420750 19:42634085-42634107 TTCCCTGGGGTCTGTCCTGAGGG + Intronic
1167040657 19:47020948-47020970 TTCCCTAGAAGGTCTCCCGAGGG + Intronic
1167062349 19:47157547-47157569 TTCCCTGGAGTCAGTTCTGATGG + Intronic
1168267695 19:55231438-55231460 TCCCGTGGAAGGTGGCCTGAAGG + Exonic
925251656 2:2444233-2444255 TTGCCTGAAATGTGGGCTGAAGG - Intergenic
927593305 2:24375325-24375347 TTCCCTGGAAAGTGGCTGGATGG - Intergenic
928144512 2:28759970-28759992 TTTCCTGGAATGCCACCTGAAGG - Intronic
928199068 2:29235603-29235625 TTGCAGGGAATGTGCCCTGAGGG + Intronic
928646707 2:33361434-33361456 TTCACTGAAATGTGTCCCAAAGG + Exonic
930182825 2:48381873-48381895 TTTTCTGGAATATCTCCTGAAGG + Intergenic
931538644 2:63304758-63304780 TTCCCTGGAAAGGGGGCTGAAGG + Intronic
931686684 2:64800027-64800049 TTTCCTGGCCTGTGTCCAGAAGG + Intergenic
932185482 2:69691817-69691839 TTTCCTGGCATCTGTCTTGAAGG + Intronic
933312975 2:80683801-80683823 TTCCATGGAATGGGTGGTGAGGG + Intergenic
935418152 2:102840361-102840383 TTTCCTGGAATATGTGCTGCAGG - Intronic
935505433 2:103895539-103895561 TCCCCTGGAATGTTTTATGATGG - Intergenic
935514543 2:104020321-104020343 TTCCCTTGAATGTGAATTGAAGG + Intergenic
935563802 2:104585684-104585706 TTCCCTGGAATGTGCCCTCTTGG + Intergenic
935690307 2:105725460-105725482 CTCCCTGTAATCTGTTCTGAGGG + Intergenic
935782377 2:106519499-106519521 TTCCAGTGAATGTGGCCTGATGG + Intergenic
936520443 2:113208973-113208995 TTCTCTGGGCTGTGTCCTGCAGG - Intronic
937220418 2:120340118-120340140 TGCCCAGGCCTGTGTCCTGATGG + Intergenic
937279072 2:120705026-120705048 ATCCCTGGAGTGTGTGCTGCTGG - Intergenic
940100106 2:150027407-150027429 TTCTCTGGAATGTGTCCTGGAGG + Intergenic
943573494 2:189602417-189602439 AGCCCTTGAATGTGTCCTGTTGG - Intergenic
944329560 2:198449504-198449526 TCCTCTGGAATATCTCCTGATGG - Intronic
944398887 2:199302735-199302757 TTCCCTGGAAGATGTCCTTCAGG + Intronic
946671284 2:222107021-222107043 TTTCCTGGAATGTGAACTGGGGG + Intergenic
947070641 2:226284222-226284244 TTCCCTGAAATGTCTTCAGAAGG - Intergenic
1170689107 20:18596111-18596133 TACCCTCCAGTGTGTCCTGAAGG + Exonic
1170891051 20:20375747-20375769 TGCCTTTGAATGTGTCCTGCTGG - Intergenic
1174725903 20:52861850-52861872 CTCCCTGGAACTTTTCCTGAGGG - Intergenic
1175629845 20:60526328-60526350 ATTCCTTTAATGTGTCCTGAAGG + Intergenic
1176103867 20:63376652-63376674 TTCCAGGGAAACTGTCCTGAGGG - Intronic
1178580193 21:33831786-33831808 TTCCCTGGAGAGTTTGCTGATGG + Intronic
1180441129 22:15366741-15366763 TTCTCTGTAATGTTTCTTGAGGG + Intergenic
1181801351 22:25349561-25349583 TTCCCTGGAAAGAGTCCTCCTGG + Intergenic
1181886963 22:26029123-26029145 ATGCCTGGAATGTGTCCCTAGGG - Intronic
1183269894 22:36854734-36854756 TTGGCTGCAAAGTGTCCTGAGGG + Intergenic
1183623263 22:38986948-38986970 GTCCCTGGGATGATTCCTGAGGG + Intronic
1183630072 22:39027411-39027433 GTCCCTGGGATGATTCCTGAGGG + Intronic
1183633508 22:39047276-39047298 GTCCCTGGGATGATTCCTGAGGG + Intronic
1184690276 22:46114320-46114342 TGCCCTGGAAACTGTCCTGAGGG - Intergenic
949901954 3:8822526-8822548 GTCCCTGGATTGTGTCCTAGAGG + Intronic
950117413 3:10460314-10460336 TTCCCTGGGAGCTGTCCTCAAGG + Intronic
950896566 3:16457216-16457238 CTCCCTGCAATGTTTACTGAAGG - Intronic
950920486 3:16689231-16689253 GTTCCTGGAATGTCTCTTGAAGG - Intergenic
952426488 3:33180166-33180188 TTCTCTGGAATATCTCTTGAAGG - Intronic
953231240 3:41066688-41066710 GTCCCTGGGATGGGCCCTGATGG - Intergenic
953817351 3:46170405-46170427 TTCACTTGAATGTGTAATGAAGG + Intronic
957768818 3:84661104-84661126 TTCCTTGGAATCTGTTCTGGTGG + Intergenic
958881542 3:99677426-99677448 TTCTGTGGAAAGTTTCCTGAAGG - Intronic
961218940 3:125184613-125184635 TGCCCTGGAATGAGGGCTGAGGG + Intronic
961819723 3:129569807-129569829 TGCCCTCCAAGGTGTCCTGAGGG + Intronic
961989967 3:131178637-131178659 TCCTCTGGAATATCTCCTGAAGG + Intronic
965007842 3:163048593-163048615 TCCTCTGGAATATCTCCTGAAGG - Intergenic
965925685 3:173976713-173976735 TTCCCTGGCATCTGCCCTTAAGG + Intronic
966465312 3:180225231-180225253 TTTCCTGTAATGTGTCCTGCAGG + Intergenic
967667645 3:192192064-192192086 TTCTCTAGAGTTTGTCCTGAAGG - Intronic
968568515 4:1327440-1327462 TTCCCTGGAAAGTCTGCTGCAGG + Intronic
968586265 4:1417645-1417667 TGCCCAGGAATGTGTTTTGACGG + Intergenic
973962932 4:56129832-56129854 GACCATGGAATGTGTCCTGAAGG + Intergenic
975161266 4:71127233-71127255 TCCCCTGGAATGTATCCATATGG - Intergenic
975401652 4:73945013-73945035 TTCTCTGGAATCTGACATGATGG - Intergenic
976225111 4:82789759-82789781 TTCCCTGGAATGTGGGCTCGTGG + Intronic
978982544 4:114966422-114966444 TTCTCTGAAATGTTTCCGGATGG - Intronic
980709292 4:136543179-136543201 TTAGCTGCAATGTCTCCTGAGGG - Intergenic
980723397 4:136726306-136726328 TCCTCTGGAATATTTCCTGAAGG + Intergenic
981790360 4:148529515-148529537 TCTTCTGGAATGTCTCCTGAAGG - Intergenic
983271224 4:165564229-165564251 TTGCCTGGACCATGTCCTGATGG - Intergenic
984045123 4:174787963-174787985 TTTCCTTGAATTTGTCCTTATGG - Intronic
984486171 4:180372944-180372966 TTCCAAAGCATGTGTCCTGATGG + Intergenic
986168634 5:5297353-5297375 TTCCCTGGAAAGTGGGCAGAGGG + Intronic
986289615 5:6389177-6389199 GTGCCTGGAATTTTTCCTGAAGG - Intergenic
986894851 5:12353325-12353347 TCCCCTGGAATACCTCCTGAAGG + Intergenic
987593208 5:19960499-19960521 TCTCCTGGAATATCTCCTGAAGG + Intronic
987729810 5:21754417-21754439 TTACTTGGAATGTGTCCTTAAGG + Intronic
992008142 5:72499812-72499834 TTCCATGGAAGGTGGCCAGAGGG + Intronic
992504258 5:77369871-77369893 TTGGCTGGAATGTGAACTGAGGG - Intronic
992517958 5:77515437-77515459 TTCCCTGGAAAATCTCCTGAAGG + Intronic
992720806 5:79559664-79559686 TTCCCTGGAAAGTCTCTTGTGGG + Intergenic
993609602 5:90037968-90037990 TTCTTTGTCATGTGTCCTGAGGG + Intergenic
997671040 5:135672200-135672222 TTCCCTGGAACATCTCCAGAAGG - Intergenic
998158454 5:139799491-139799513 TAGCCTGGAATGTGGGCTGAGGG + Intronic
998212758 5:140213086-140213108 TCTTCTGGAATGTCTCCTGAAGG - Intronic
998532035 5:142894282-142894304 ATCCCTGGAATATGTCTTCAAGG + Exonic
1000732738 5:164856333-164856355 TTCCCTGGAACTTAACCTGAAGG - Intergenic
1000784211 5:165523991-165524013 TTCCCTTGAATGTTTTCTGGGGG + Intergenic
1001225289 5:169939390-169939412 TCTTCTGGAATATGTCCTGAAGG + Intronic
1005637427 6:27765411-27765433 TTCCCTGGACTGGGTACTGAAGG - Intergenic
1006930675 6:37686243-37686265 CTTCCTGGAATGTCTCATGATGG + Intronic
1010341144 6:74754593-74754615 TGCCCTGGCATGTGTTCTGTTGG + Intergenic
1013291434 6:108722096-108722118 TTTCCTAGAATGTGTCCTTTTGG + Intergenic
1014879190 6:126701187-126701209 TACCCTGGATTCTGCCCTGATGG - Intergenic
1016491897 6:144614392-144614414 TTCCCAGGAATCTGTCCTTGGGG - Intronic
1019110711 6:169710322-169710344 TTCCCTGGAAAGAGTCCTCCTGG + Exonic
1019716605 7:2542147-2542169 GCCCCTGGCCTGTGTCCTGAAGG - Exonic
1020144152 7:5629970-5629992 ATGCCTGGAATGTTTCCTGAGGG - Intronic
1020832225 7:13107004-13107026 TTTTCTGGAATATTTCCTGAAGG - Intergenic
1021059537 7:16093505-16093527 TTTCCTTGATTGTGTTCTGAGGG + Intronic
1021102677 7:16601737-16601759 TTCTCTGGAATGAGGCATGAGGG + Intronic
1022336786 7:29429615-29429637 TTCCCTGGAATATGTGTTCAAGG + Intronic
1022792345 7:33701587-33701609 TTCCGTTGAATATGTCCTGTGGG - Intergenic
1022916042 7:34953920-34953942 TTCCCAGGAATCTTCCCTGAGGG - Intronic
1023847897 7:44133207-44133229 ATCCCAGGAATGTCTCCTTAAGG - Intergenic
1024965154 7:55018174-55018196 TTCCCTGGCATTTCTCCTGCGGG + Intergenic
1025270730 7:57511283-57511305 TCTTCTGGAATGTCTCCTGAAGG + Intergenic
1028169099 7:87574334-87574356 TTCCCTGGGGTGTGTCTTGGAGG - Intronic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1031290248 7:119925382-119925404 TTACCTAGAATGAGTTCTGAGGG + Intergenic
1031865329 7:127032441-127032463 GTCCCAGGAGTGTGACCTGATGG - Intronic
1032164910 7:129537941-129537963 TTCTCTGAAATGTCTCCTTAAGG + Intergenic
1035517038 8:242940-242962 TTCTCTGGGATGTGTCCAGCAGG - Exonic
1037478429 8:19280140-19280162 TTCCCTATACTGTTTCCTGATGG - Intergenic
1038853301 8:31302001-31302023 ATGCCTGGAATGTGTCTGGAAGG - Intergenic
1039507320 8:38061324-38061346 TTGCATGGAATGGGCCCTGACGG - Intergenic
1042792441 8:72623513-72623535 GTCCCTGAAATGTGTCCAGATGG - Intronic
1042989878 8:74627190-74627212 TAAACTGTAATGTGTCCTGAAGG - Intronic
1043061476 8:75509988-75510010 TTCTCTGGAATACCTCCTGAAGG - Intronic
1043484976 8:80690395-80690417 TTCCCTAGAATATGTCTTGGGGG + Intronic
1043547843 8:81335321-81335343 TTTCCAGGAAGGAGTCCTGACGG + Intergenic
1043989041 8:86729982-86730004 TTCCCTGGAATGTGTACCTGTGG + Intronic
1044199066 8:89413053-89413075 TTCCCTGGAAGCTGTCGTCATGG - Intergenic
1044278696 8:90332094-90332116 TTCCCTGAAATGTTTCTAGAAGG + Intergenic
1044634305 8:94307316-94307338 CTCCCTGCAATCTGTCCTGTTGG + Intergenic
1044706328 8:95012381-95012403 TTCACTGGAATATGAGCTGAGGG - Intronic
1044730251 8:95223544-95223566 TTCCCTGGAATATGTTGAGAGGG + Intergenic
1048346502 8:133579630-133579652 TTCCCTGGAACACATCCTGAAGG + Intergenic
1049311285 8:141935183-141935205 TTCCCTGGGATTTGTTCTGAGGG - Intergenic
1050848617 9:10256355-10256377 TTCTCTGGAATAACTCCTGAGGG + Intronic
1050892297 9:10838773-10838795 TCTGCTGGAATGTCTCCTGAAGG - Intergenic
1050916914 9:11147939-11147961 TTCCTGGGAATGTATCTTGAAGG + Intergenic
1051363212 9:16300695-16300717 CTCCCTGTAATGTGTCTTCATGG + Intergenic
1052125519 9:24770070-24770092 TTCCCTAAAATGTAGCCTGAGGG - Intergenic
1052801669 9:32973864-32973886 TTGCCTAGAGTGTGTCCTGAAGG - Intronic
1053571683 9:39316292-39316314 TTCCCAGGAATTTGACCTCAGGG + Intergenic
1053622218 9:39831165-39831187 TTCCCAGGAATTTGACCTCAGGG + Intergenic
1054093241 9:60874991-60875013 TTCCCAGGAATTTGACCTCAGGG + Intergenic
1054114720 9:61150910-61150932 TTCCCAGGAATTTGACCTCAGGG + Intergenic
1054125462 9:61302720-61302742 TTCCCAGGAATTTGACCTCAGGG - Intergenic
1054593034 9:67031615-67031637 TTCCCAGGAATTTGACCTCAGGG - Intergenic
1055179779 9:73371183-73371205 TCTTCTGGAATATGTCCTGAAGG - Intergenic
1058990149 9:110247834-110247856 TCTCCTGGAATGCTTCCTGAAGG - Intronic
1062114794 9:134802597-134802619 CTTCCTGGGATGTGCCCTGAGGG - Intronic
1062584836 9:137244554-137244576 TTCCCTGGAGGGTGCCTTGAAGG - Intronic
1062608610 9:137361311-137361333 TTCCCTGTAATGTGTTCAGGTGG - Intronic
1185668696 X:1788427-1788449 TAACCAGGAATGTGACCTGAGGG - Intergenic
1188552021 X:31374971-31374993 TTCATTGGAATGTGCCCTCAGGG + Intronic
1190981032 X:55456781-55456803 TTCTGGGGAATGTGTCGTGATGG - Intergenic
1190987665 X:55516399-55516421 TTCTGGGGAATGTGTCGTGATGG + Intergenic
1192091219 X:68158544-68158566 GTCTCTAGAATCTGTCCTGATGG + Intronic
1192176365 X:68888301-68888323 CTCACTAGAATGTGTCATGAGGG - Intergenic
1192374510 X:70545529-70545551 TTTTCTGGAATATCTCCTGAAGG + Intronic
1193394453 X:80967763-80967785 TTCCCTGGAAAGGGGACTGAAGG + Intergenic
1194106321 X:89771535-89771557 TTTTCCTGAATGTGTCCTGAAGG + Intergenic
1194586995 X:95747522-95747544 TTCTCCGGAATGACTCCTGAAGG - Intergenic
1198031668 X:132759091-132759113 TTCCTTGGAATGTGGCAAGATGG + Intronic
1199943797 X:152649821-152649843 TTCCCAGGAAAGTGAACTGAGGG - Exonic
1200330666 X:155293193-155293215 TTCCCTGGAAAGAGTCCTCCTGG - Intronic
1200458282 Y:3419394-3419416 TTTTCCTGAATGTGTCCTGAAGG + Intergenic