ID: 918146499

View in Genome Browser
Species Human (GRCh38)
Location 1:181760759-181760781
Sequence CTTTGAAGTCAGATAGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 648
Summary {0: 1, 1: 2, 2: 11, 3: 99, 4: 535}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918146499 Original CRISPR CTTTGAAGTCAGATAGAACA GGG (reversed) Intronic
900390950 1:2433578-2433600 CTTTGAAGTCAGAAAGCCCCCGG - Intronic
900778503 1:4601806-4601828 GTTTGAAGTCAGAAAGGAGAAGG - Intergenic
901766761 1:11504948-11504970 CTTTGGAGTCAGATATATCTTGG + Intronic
902650562 1:17834666-17834688 GTCTGAAGTCAGAGACAACAGGG - Intergenic
902792900 1:18781167-18781189 TTTTGGAGTCAGATAGATCTAGG + Intergenic
903510663 1:23872564-23872586 CTTTGAAGTCAAACAGAACTAGG + Exonic
904265499 1:29316352-29316374 CTTTGAAGTCAGATAAACCCAGG + Intronic
904291182 1:29486802-29486824 CTTTGAAGTCAGATATACCATGG - Intergenic
904481291 1:30795292-30795314 TTTTGGAGTCAGATAGATCTGGG + Intergenic
904625957 1:31802454-31802476 CTTTGGAGTCAGACAGAGCTAGG - Intronic
904787571 1:32994164-32994186 TTTTCTAGTCAGATAGAACAGGG + Intergenic
904980957 1:34501140-34501162 TTCTGAAATCAGAGAGAACACGG - Intergenic
905092987 1:35444557-35444579 CTTTGTAGTCAGACATAACAGGG - Intronic
905269071 1:36774868-36774890 CTTTGGAGTCAGACAGACCTGGG + Intergenic
905285239 1:36875086-36875108 CCTAGAAGGCATATAGAACAAGG + Intronic
905407881 1:37748856-37748878 CTTTGAGGTCAGACAGACCTGGG + Intronic
905657952 1:39697954-39697976 CTTTCAAGTCAGACAGATCTTGG + Intronic
905682698 1:39885495-39885517 CTTTGGAGTCATATAGAGCTGGG + Intergenic
905835142 1:41112828-41112850 CTTTGAAGTAAGATAGACATGGG - Intronic
905900471 1:41578698-41578720 CTTTGGAGTCAGATAGGTCTGGG + Intronic
906002165 1:42435801-42435823 CTTTAGAATCAGATAGACCAGGG - Intronic
906247292 1:44285328-44285350 CTTTGGAGTCAGACAGAACTGGG - Intronic
906501921 1:46347582-46347604 CTCTGAAGTCAGATTGAAGTAGG + Intronic
906681355 1:47727822-47727844 CTTTGAAGTCAAATAGACCTAGG - Intergenic
906773962 1:48511805-48511827 TTTTGCAGTCAGACAGAGCAGGG + Intergenic
906835133 1:49074714-49074736 CTTTGGAGTGAGACAGAACTGGG - Intronic
906862221 1:49373729-49373751 CTTTGGAGTCAGACAGAATTGGG - Intronic
906964558 1:50443798-50443820 CTTTGAAGTTAGAAAGATCAGGG - Intronic
906985217 1:50676000-50676022 TTTTGAAGTCACAAAGAATAGGG - Intronic
907126799 1:52057165-52057187 CTTTGGAATCAGAAAGACCAAGG - Intronic
907132853 1:52112035-52112057 CTTTGGAGTTAGACAGAACTGGG - Intergenic
907149434 1:52269629-52269651 ATTTGAAGACAGATATTACATGG - Intronic
907540476 1:55212382-55212404 CTTTGAAGTCAAAGAGACCTGGG + Intronic
907545266 1:55254273-55254295 CTTTGAAGTCATATAGACCTTGG + Intergenic
907668793 1:56456581-56456603 CTTTGAAGTCAGATAGATCTAGG - Intergenic
907712139 1:56893389-56893411 CTTTGAAGTCAGATACATCTGGG + Intronic
907747067 1:57223923-57223945 CTTTGGAGTCAGAAAAAACTGGG + Intronic
907747682 1:57230570-57230592 CTTTGAAGCCAGACAAACCACGG + Intronic
907947581 1:59149563-59149585 CTTTGAATTCAGATACACCTGGG + Intergenic
907987883 1:59550824-59550846 CTTTGGAGTCAGACAGAACAAGG + Intronic
908068282 1:60431707-60431729 TTTTGAAGCCAGAAAGGACAAGG - Intergenic
908666929 1:66503668-66503690 CTCTGAAGGCAGAGAGAACTGGG + Intergenic
908707304 1:66972595-66972617 GTCTGAAGTAAGAAAGAACATGG + Intronic
909009443 1:70318068-70318090 ATATGAAGTCATATAGAAAAGGG - Intronic
909042136 1:70667270-70667292 CTTTGAAGACAGATAGATCTGGG + Intergenic
909046606 1:70718186-70718208 CTCTGAAATCAGATGGAACTGGG - Intergenic
909591724 1:77357261-77357283 CTTTGAAGTCACAAAGACAAGGG + Intronic
909839933 1:80307641-80307663 TGTTGAAGTCAGAGAGACCAAGG - Intergenic
911754904 1:101542614-101542636 CTCTGAAGTCAGCTAACACAAGG + Intergenic
912467059 1:109881622-109881644 CCTTGAAGTCAGATAGCCAAGGG - Intergenic
913397809 1:118391763-118391785 CTTTGGAGTCATTTAGAACTGGG + Intergenic
915224831 1:154404798-154404820 CTTTGCAGTCAGATAGACCTGGG - Intergenic
915569900 1:156738960-156738982 CTTTGAAGTCAGATATATGTGGG - Intronic
915729098 1:158040381-158040403 CTTTAGAGTCAGACAGACCAGGG + Intronic
916003203 1:160636008-160636030 TTTTGAAGTCAGACAGACCTAGG - Intronic
916055865 1:161068736-161068758 CTTTGAAGCCAGAAGGACCAGGG - Intronic
916769339 1:167892851-167892873 TGTAGAAGTCAGATAGACCAGGG + Intronic
916977481 1:170096669-170096691 CTTTGAAGTCAGAAATAACTGGG - Intergenic
917503290 1:175605184-175605206 CTTTGGAGTCAGAAAGACCTTGG + Intronic
917951708 1:180044955-180044977 CTTTGAAGGCAGATAAATTAAGG - Intronic
918146499 1:181760759-181760781 CTTTGAAGTCAGATAGAACAGGG - Intronic
918444106 1:184599008-184599030 CTTTGGAGTCAGACAGACCTGGG - Intronic
919510130 1:198452337-198452359 CTTTGAAGTCAGACAAACCTGGG - Intergenic
919955600 1:202411808-202411830 CTTTGGAGTCAGACAGACCAGGG - Intronic
920078406 1:203353886-203353908 CTTTCAAGTCATGTAGACCAAGG - Intergenic
920662368 1:207926360-207926382 CTTTGGAATCAGACAGAACTGGG + Intergenic
921008031 1:211113237-211113259 TTTTGAAGTCACATAGACCTAGG - Intronic
921441475 1:215191359-215191381 CTTTGGAGCCAGCTAGAATAGGG + Intronic
922659234 1:227414969-227414991 CATATAATTCAGATAGAACAGGG - Intergenic
922870760 1:228900161-228900183 CTTTGAAAGCAGAAAGAAGATGG - Intergenic
923365475 1:233256428-233256450 CTTTGGAATCAGATAGCCCAAGG - Intronic
924301520 1:242643852-242643874 CTTTGAAGTTAAATAGATCTGGG + Intergenic
924835374 1:247641756-247641778 CTTTGAAATCAGATAGACCTGGG - Intergenic
1063852729 10:10211357-10211379 CTATGAAGTTAGATAGAAGCAGG + Intergenic
1064243511 10:13651405-13651427 CTTTGAATGTAGATAGAACATGG + Intronic
1064726052 10:18281059-18281081 ATTTCAAGTCAGATAGCCCAGGG - Intronic
1064760618 10:18616355-18616377 ATTAGAGTTCAGATAGAACACGG - Intronic
1064910809 10:20399867-20399889 CTTTGAAGTCACACAGACCTGGG - Intergenic
1064977270 10:21131253-21131275 CTTTGAAAACAGAAAGCACAAGG + Intronic
1065012829 10:21434649-21434671 ATTAGAAGTCAGACAGACCAGGG + Intergenic
1065210432 10:23397307-23397329 CTTTGGAGTCAAAGAGACCAGGG + Intergenic
1065755768 10:28929077-28929099 CTTTGAAGAAACCTAGAACATGG + Intergenic
1066297825 10:34070419-34070441 TTTTGAAATCAGTGAGAACAAGG + Intergenic
1067658319 10:48214309-48214331 TGTTGAAGTCAAATAGAATATGG - Intronic
1068234150 10:54210662-54210684 CTTAGATGTCAGAAAGAGCATGG + Intronic
1068737433 10:60430309-60430331 ATTTGAAGGCAGATATTACAGGG - Intronic
1069259099 10:66371688-66371710 CTTTGAAGTCTGTTAGCAAAGGG - Intronic
1069301213 10:66910176-66910198 ATTTAAAGTCAGCTAGAAAATGG + Intronic
1069675991 10:70248155-70248177 CTTTGTGGTCAGATAGACTAAGG + Exonic
1069987002 10:72291301-72291323 CTCTGAAGTCAGATACACCTGGG + Intergenic
1070206121 10:74263626-74263648 CTTTGAAATAAGACAGAAAATGG - Intronic
1070733284 10:78846366-78846388 CTTTGAAGTCTGATAGATTCAGG + Intergenic
1070790761 10:79187924-79187946 CTTTGAAGTCTGATAGATCTGGG + Intronic
1071017720 10:81018201-81018223 CTTGGAAGCTAGATAGATCAAGG + Intergenic
1071804000 10:89096563-89096585 CTCTGAAGTCAGGTAGAAACAGG - Intergenic
1072173085 10:92886598-92886620 CTTTGGAGTCAGGTAGACCTGGG + Intronic
1072493866 10:95935299-95935321 CTTTGAAGGCAGAACCAACAGGG - Intronic
1072509036 10:96100006-96100028 CTGTGAAGACAAATAAAACAGGG + Intergenic
1072982382 10:100110172-100110194 CTTTATAATCAGATAGAACTTGG - Intergenic
1073221614 10:101879216-101879238 CTTTGTAGTCAGACAGACCTAGG + Intronic
1073536483 10:104281216-104281238 CTTAGATGTCAGGTTGAACATGG - Intronic
1073997056 10:109327563-109327585 CTTTAAAGTCAGATTGAATCAGG + Intergenic
1074086603 10:110212596-110212618 CTTTGCAGTCACATGGAGCAGGG + Intronic
1074141340 10:110675709-110675731 CTTTCAAGTCAGACAGACCTGGG + Intronic
1074232820 10:111554815-111554837 CTTTGAACTCAGAAAGATCTGGG - Intergenic
1075829327 10:125392055-125392077 CTTTGAAGTCAGACAGACTTGGG - Intergenic
1076454472 10:130580157-130580179 CTTTGAAGTCAGACAGCCCAGGG + Intergenic
1077496614 11:2889780-2889802 GTTTGAAGACAGATAGCTCAGGG - Intronic
1078404384 11:11056956-11056978 CTTTGGAGTCAGATAAACCAAGG - Intergenic
1078667374 11:13337856-13337878 CTTTGGAGTCAGACAGAGCTGGG + Intronic
1078869093 11:15327472-15327494 CTTTGGAGTCAGACAGAGCTGGG + Intergenic
1078927315 11:15886407-15886429 CTTTGAAGTCAGAAAGAACAGGG + Intergenic
1079160153 11:17984751-17984773 CTTTGAAGTCAGATAGACCAAGG - Intronic
1079613316 11:22460068-22460090 ATTTGAAGCCAGATACAACCAGG - Intergenic
1080001446 11:27355011-27355033 CTTGGTAGTCACACAGAACAAGG - Intronic
1080456501 11:32424267-32424289 CTGTGAAGTCAGAGAGACTAAGG + Intronic
1080704688 11:34679408-34679430 CTTTAAAGTCAGACAGCCCAAGG - Intergenic
1081385099 11:42462758-42462780 CTTTGAAGTCAGGGAGAACTAGG - Intergenic
1081663382 11:44902325-44902347 CTCTGAAGTCAGACACAACTGGG - Intronic
1081910196 11:46695491-46695513 CTTTGAAGTCAGAAAGCCCTGGG - Intronic
1082767912 11:57183185-57183207 CTTAGAAGTCAGATAAATCTAGG - Intronic
1082898470 11:58219096-58219118 CTTTGACGTGAGACAGAACTGGG + Intergenic
1082967922 11:58987119-58987141 CTTTGAAATCAATGAGAACAAGG - Intronic
1083769206 11:64856920-64856942 CTTTGAGGACAGACAGGACAAGG - Intronic
1084914527 11:72418509-72418531 CTTTGGAGTCTGACAAAACAAGG - Intronic
1085024434 11:73228335-73228357 CTTTGAAGCCAGATAGCTCTGGG + Intronic
1085883003 11:80489733-80489755 CCTTGAAGAGAGATAGAAAAGGG - Intergenic
1086059794 11:82688940-82688962 CTTTGGTGTCAGATAGACCAGGG - Intergenic
1086282444 11:85206366-85206388 ATTTGAAGCCAGATAGACCTGGG + Intronic
1086283565 11:85219411-85219433 CCTTGAAGACAGAGAGAACTAGG + Intronic
1086405002 11:86492075-86492097 CTTTCAAATCAGATAGACCTGGG + Intronic
1086425635 11:86679845-86679867 CTTTAAAGTCAGATACATCTGGG + Intergenic
1086536487 11:87853178-87853200 CATTCAAGGCAGAAAGAACATGG + Intergenic
1086954132 11:92918014-92918036 CTTTCAAGTCAGATAGACCTAGG + Intergenic
1087049570 11:93871816-93871838 CTTTGAAGTCAGACAGACCCAGG - Intergenic
1087064072 11:94011061-94011083 CTTTGGAGTCAGAAAGACCTGGG + Intergenic
1087136789 11:94729194-94729216 CTTTGAAGTCAGACAGACCTGGG + Intronic
1087811589 11:102614186-102614208 CTTTGGAGTCAGACAGAACTGGG - Intronic
1088167128 11:106952153-106952175 CTTTGAAGTCAGGTAGCATGAGG + Intronic
1088293959 11:108271818-108271840 CTTAGCAATCAGATAGTACAAGG - Intronic
1088701489 11:112417015-112417037 CATTGAACTCAGATAGACCCAGG - Intergenic
1088748209 11:112822314-112822336 CTTTGGAGTCAGGCAGACCAGGG + Intergenic
1088751959 11:112850728-112850750 CTTTGATGTCAGATTTGACAAGG - Intergenic
1088860756 11:113797023-113797045 CTATGAAGTCAGACACACCAAGG + Intergenic
1089035152 11:115381499-115381521 CTTTGAAATCAGATAAACCTAGG + Intronic
1089614601 11:119688064-119688086 CTTTGAATTCAGATAGACCTGGG + Intronic
1090050897 11:123378231-123378253 CTTTGAAGTCAGATCAACCTGGG - Intergenic
1090102632 11:123816357-123816379 TTTTGAAGTCAGATAGTTCTTGG + Intergenic
1090407414 11:126485317-126485339 CTCTGAAGTCAGCTAGTTCAGGG - Intronic
1090727982 11:129544789-129544811 CTTTGGAGTGAGACAGACCAGGG - Intergenic
1091209868 11:133847048-133847070 TTCTGAAGTGAGTTAGAACAAGG - Intergenic
1092006901 12:5077676-5077698 CTTTACAGTCAGGTAGACCAGGG - Intergenic
1092981278 12:13796897-13796919 CTTTGAGGTGAGAATGAACAAGG - Intronic
1093326229 12:17778216-17778238 ATCTGAAGCCAGATAGGACATGG + Intergenic
1093395891 12:18681795-18681817 CTTTGAAATGAGAGAGAAAAAGG - Intergenic
1093447523 12:19277255-19277277 CTTTGAAGTAAGATTTAACTTGG - Intronic
1093939722 12:25039983-25040005 TTCTGAAGTCAGACAGAACTAGG - Intronic
1094084136 12:26570775-26570797 ATTTGAAGTAAAATAGCACATGG - Intronic
1094173888 12:27522589-27522611 CTTTGGAGTCAAATAGACCTCGG + Intergenic
1094712673 12:32980677-32980699 CTTTGGAGTTAGATAGACCTGGG + Intergenic
1094733983 12:33211714-33211736 CTTTGAAGACAGAGAAAAAAAGG + Intergenic
1094789420 12:33894397-33894419 TTTTAAAGTCAGACAAAACAAGG + Intergenic
1096004393 12:48157310-48157332 CTTAGAAGGCAGATCGAAGAGGG - Intronic
1096473716 12:51895513-51895535 CTTTGGAGTCAGACAGACCTGGG + Intergenic
1097158127 12:57027325-57027347 CTTTGAGCTGAGATAGAACCTGG - Intronic
1097171554 12:57117157-57117179 CATTGGAGTCAAAGAGAACAAGG + Intronic
1097432307 12:59525607-59525629 CTTGGAGGTCACATAGAACCAGG - Intergenic
1097875086 12:64635864-64635886 GTTTGAAGTCAAATAGTAGAAGG + Intronic
1098414858 12:70221290-70221312 CTTTGAAGTCAGAAAGAACTGGG + Intergenic
1098570215 12:71980025-71980047 CTGTGAAGACAAATAGAGCATGG + Intronic
1098627160 12:72686014-72686036 GTTTGAATACAGAGAGAACAGGG + Intergenic
1098900185 12:76104320-76104342 CTTTGGAATTAGATATAACAGGG + Intergenic
1099019036 12:77380716-77380738 CTTTGGAGTCAGATGTAACTTGG + Intergenic
1099080874 12:78178666-78178688 CATAGAACTCATATAGAACAGGG + Intronic
1099278597 12:80611758-80611780 ATTTTAAGTCAGATAAACCAAGG - Intronic
1099378924 12:81931934-81931956 CTTTGAAGTCAGGCAGACCGAGG - Intergenic
1099427020 12:82535910-82535932 CTTTGAAGTTAGACAGACCAGGG + Intergenic
1099489130 12:83266936-83266958 ATTTTAAGTCAGAGAAAACAAGG - Intergenic
1100162710 12:91879219-91879241 CTTTGAAATCAGATGGAACTGGG + Intergenic
1100445898 12:94659476-94659498 ATTTGCAGTCACATAGAACATGG - Intergenic
1100568541 12:95823193-95823215 CTCTGAAGTCAGACAGACCTGGG + Exonic
1100701019 12:97148293-97148315 CTTTAAAGTCAAACATAACAGGG + Intergenic
1100890654 12:99122049-99122071 ATTTGGAGTCAGATAGATGAGGG + Intronic
1100943271 12:99748701-99748723 CTCTGAAGAAAGATAAAACAGGG + Intronic
1101100055 12:101382468-101382490 CTTTAAAGTCACACAGAATAAGG - Intronic
1101219238 12:102619098-102619120 CTTAGAGGTGAGAGAGAACATGG - Intergenic
1101523249 12:105504277-105504299 CTCTGAAGTCAGACACACCATGG + Intergenic
1102409759 12:112707502-112707524 CTTTGAAGTCAGACTGATCTGGG - Intronic
1102715010 12:114962994-114963016 CTTTGGAGTCAGATGGACCTGGG - Intergenic
1102742173 12:115217532-115217554 CTTTGGATTCAGACAGAACTGGG - Intergenic
1102792937 12:115662769-115662791 CTTTGAACTCAGACAGAAATGGG - Intergenic
1103039933 12:117686483-117686505 CTTTGGGGTCAGACAGAACCAGG - Intronic
1104156627 12:126139220-126139242 ATTTGAAGTTAGAGAGAACAGGG + Intergenic
1104433706 12:128738905-128738927 TTTTGAAGTCACATAGAGCAAGG + Intergenic
1104550570 12:129753045-129753067 CTTGAAAGTCACATATAACAAGG - Intronic
1105561502 13:21496724-21496746 TTTTGAAGTCAGATGGACCAAGG - Intronic
1105643902 13:22295960-22295982 CTCTGGAGTCAGATAGATCTGGG - Intergenic
1106118097 13:26834156-26834178 CTTTAAAGTCAGATGGACCCTGG + Intergenic
1106407569 13:29487298-29487320 CTTTGGAGTCAGACAGACCTGGG + Intronic
1107423123 13:40268230-40268252 CTTTGGACTCAGACAGACCAAGG - Intergenic
1107638632 13:42418538-42418560 CTCTGAAGTCAGACAGACCTGGG + Intergenic
1108292030 13:48971644-48971666 CTTTGGAGTCAGGTAGATCTGGG - Intergenic
1108909695 13:55530800-55530822 CCTTGAAGTCATATGTAACAGGG - Intergenic
1109134767 13:58633657-58633679 ATTTGAAGTCAACTAAAACAGGG - Intergenic
1109416554 13:62047729-62047751 CTTTGGAGTCAGATGGAATTGGG + Intergenic
1109777261 13:67057632-67057654 CTTTGAATTCAGAAAGATCTAGG + Intronic
1110234688 13:73204441-73204463 ATTTTGAGTCAGATAGACCAGGG + Intergenic
1110428686 13:75398810-75398832 CTTTGAGGTGAGAAAGAAAAAGG - Intronic
1112201372 13:97279225-97279247 CTTTGAAATCAGAAGGACCAGGG + Intronic
1112275410 13:98013429-98013451 CTTTGGAGTCAGACAGATCTGGG - Intronic
1112922860 13:104636624-104636646 CTTTGAAGGCAGATTGCCCAGGG + Intergenic
1113347776 13:109497451-109497473 CTTTGAAGTCACACAGATCAAGG + Intergenic
1114577271 14:23726317-23726339 ATTTGAAGTCAGAAAGAGGAGGG - Intergenic
1114728624 14:24966421-24966443 CTTTGGAGTCAGATGGACCCAGG + Intronic
1114786619 14:25607404-25607426 CTTTGAAGGCAGAAAGCAGAAGG + Intergenic
1114854001 14:26415632-26415654 CTTTGATGTCAGGAAGAACTTGG - Intergenic
1115082552 14:29474404-29474426 ATTCAAAGTCAGATAAAACATGG + Intergenic
1115085108 14:29506350-29506372 TTTTGTAGTCAGGTAGGACATGG - Intergenic
1115457138 14:33616523-33616545 CTGTGAGGTCAGGAAGAACAGGG - Intronic
1115786659 14:36834350-36834372 CTTTGGAGTCAGACAGACCTGGG + Intronic
1117538783 14:56726824-56726846 CCTGGAAGTGAGATAAAACAAGG + Intronic
1118960946 14:70532073-70532095 TTTTGAAGTCAGATAGTATGAGG - Intronic
1119470405 14:74894232-74894254 CCGTGTAGTCAGAAAGAACACGG - Intronic
1119686986 14:76640805-76640827 CTTTCCAGGCAGACAGAACAGGG - Intergenic
1119994866 14:79242203-79242225 TTTTGTAGTCAGATAGACCTGGG - Intronic
1120490358 14:85170829-85170851 CTTTGAAGTCAGAAAAATCTTGG - Intergenic
1121041513 14:90752776-90752798 CTTTGTAGTCAGATAGACCAGGG - Intronic
1121314170 14:92951315-92951337 CTTTGGAGTCAGACAGATCTGGG + Intronic
1121928955 14:97954667-97954689 CTTTGAGGTCAGACAGAAAATGG + Intronic
1122020345 14:98832996-98833018 CTTTGCATTCAAATAAAACATGG + Intergenic
1123806121 15:23875472-23875494 ATCTGAAGTCTGAAAGAACAAGG - Intergenic
1125904536 15:43378878-43378900 CTTTGGAGCCAGATAGAGCTGGG - Intronic
1125989164 15:44088863-44088885 CTTTGTAGTCAGACTGAACAGGG - Intronic
1126440051 15:48677946-48677968 CTTTAGAGTCAGAAAGAACTGGG - Intergenic
1127014439 15:54667616-54667638 CTTTGGAGTCAGACAGATCATGG - Intergenic
1128039855 15:64562435-64562457 CTTTGAAGTCACATAGATTTAGG - Intronic
1128759632 15:70207358-70207380 CTATGAAGTCAGATGGATCTGGG + Intergenic
1129618963 15:77125674-77125696 CTTTTAAGTCAGACAGACCTGGG - Intronic
1130107327 15:80938678-80938700 CTTTGAAGACAGACAGATCTAGG - Intronic
1130896913 15:88178007-88178029 CTTTGAAGATAGAAAGATCAGGG - Intronic
1130937860 15:88485350-88485372 CTTTGGAGTCACAAAGACCAGGG + Intergenic
1130955578 15:88624902-88624924 CTTTGAAGTCAGGCAGAGCAGGG - Intronic
1131076544 15:89498955-89498977 CTTTGAAATCAGACAGCCCAGGG - Intergenic
1131154432 15:90066019-90066041 CTTTCAAATCAGATCGGACATGG + Intronic
1131800052 15:96059315-96059337 CTTTGGAATCAGGTAGAACTGGG - Intergenic
1131833202 15:96367178-96367200 CTTTGAAGTTAGAGTGAAGATGG - Intergenic
1131844182 15:96471329-96471351 CTTTGAAGACAGATTAAAAACGG - Intergenic
1132040831 15:98523498-98523520 TTTTGAAATCAGATAGACCTGGG - Intergenic
1133844696 16:9443149-9443171 CTTTAGAGTCAGATAGACCTCGG - Intergenic
1134820865 16:17246331-17246353 CTCTGCAGCCAGAAAGAACAGGG - Intronic
1135274511 16:21100522-21100544 CTAAGGATTCAGATAGAACACGG - Intronic
1135877934 16:26221700-26221722 TTTGGAAGTCAGACAGAACCTGG - Intergenic
1137514293 16:49129751-49129773 CTTTGAAGTAAAAAAGAACTTGG - Intergenic
1137922352 16:52503233-52503255 CTATGAAGTCAAATAGGACTGGG + Intronic
1138747808 16:59383849-59383871 CTGTGAAGTCAATAAGAACATGG + Intergenic
1138751377 16:59426280-59426302 TTTTGAAGTCTGAGAGTACAAGG + Intergenic
1139274862 16:65718270-65718292 GTTTGGAGTGAGACAGAACAAGG - Intergenic
1139358929 16:66384442-66384464 ATTTAAAGTCAAATAGAGCAAGG - Intronic
1139385983 16:66571472-66571494 CTTTAGAGTCAGATAGACCTGGG - Intronic
1140906756 16:79415720-79415742 CTTTGGAGTCAGTTAGACCTGGG + Intergenic
1141905220 16:87020660-87020682 CTTTGGAGTCAGCTAGACCTGGG - Intergenic
1143565854 17:7720101-7720123 ATTTTAAGACAGAAAGAACAAGG - Intronic
1143991442 17:10966742-10966764 CTATGAAGTCAGATAGGGAATGG + Intergenic
1144798307 17:17907532-17907554 CTGTGAAATCAGAGAGAAAATGG + Intronic
1145305249 17:21670522-21670544 CTCTGAAGTCAGAAAGACCTGGG + Intergenic
1145752676 17:27366655-27366677 CTTTGAAGTCAGGCAGCTCAGGG - Intergenic
1146372178 17:32271962-32271984 ATTTGGAGTCAGATAGACCTGGG + Intronic
1146393096 17:32440915-32440937 CTTTGAAGTGAGAAGGAACGTGG + Intergenic
1146504927 17:33396551-33396573 CTTTGAAGTCACAAAGACCTAGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147048490 17:37772639-37772661 CTTTGGAGTCAGAGAGACCCAGG + Intergenic
1148408877 17:47447165-47447187 CTTTGAAGTGGGAAATAACAAGG - Intergenic
1148749255 17:49935300-49935322 CCTTCAAGTCAGAAAGGACAGGG + Intergenic
1148983171 17:51597218-51597240 CTTTGAATTCAGATAGATCTTGG + Intergenic
1149048427 17:52275320-52275342 CTTTGAAGACAGATACAAATGGG + Intergenic
1149606595 17:57929366-57929388 CTTTGGGGTCAGATAGATCCAGG - Intronic
1149673611 17:58438460-58438482 CTTTGCAGTCAGGCAGCACATGG + Intronic
1149927134 17:60712548-60712570 ATTTGAATTCAGACAGAACTAGG - Intronic
1150586542 17:66523339-66523361 CTTTGGAGTCAAATAGCACTTGG + Intronic
1151060233 17:71084020-71084042 ATTTGAACTCAGATACCACATGG + Intergenic
1151060461 17:71086519-71086541 CTTTGAAATCAGGTAGAGAAAGG - Intergenic
1153486825 18:5607227-5607249 CTCTGGAGTCAGATAGAAGATGG + Intronic
1153720603 18:7897760-7897782 CTTAGAAGTCATAAAGAACAGGG - Intronic
1154039844 18:10844079-10844101 CTTAGAAGTCAGAGAGAATTGGG + Intronic
1155024237 18:21926887-21926909 ATTGGAAGTCACATAGAAAATGG - Intergenic
1155111387 18:22718139-22718161 TTTTGAAGTCACATAGACCTCGG - Intergenic
1155898655 18:31360973-31360995 CTTTGAAGTCTGATGGGACATGG - Intergenic
1156029201 18:32692735-32692757 CTCTGAAATCAGATAGACCTAGG + Intronic
1156065497 18:33138769-33138791 CTTTGGAGTCAGACAAAACTGGG - Intronic
1156106011 18:33661929-33661951 CTTTGATGTAAAATAGAAGAAGG + Intronic
1156256217 18:35399208-35399230 CATTGAAGTCAGGAAGAAAATGG - Intergenic
1156289372 18:35732553-35732575 CTTTGAAGTCAGATAGCCACAGG + Intergenic
1157663300 18:49464528-49464550 CTTTGGAGTCAGACAGATCTGGG + Intergenic
1158664700 18:59421973-59421995 CTTTGAAGTCAGAAAGGAGTGGG + Intergenic
1159660507 18:71090298-71090320 GTTTGAAGTCAGATAGTATGAGG + Intergenic
1160279878 18:77479008-77479030 CTCTGCAGTCAGATAAAAAAGGG + Intergenic
1160523078 18:79520080-79520102 CTTGGAAGTCAGATTTAAAATGG + Intronic
1161946560 19:7440826-7440848 CTTTGAAGTCCTATAAAACGAGG - Intronic
1164600030 19:29555347-29555369 ATTTGAAATCAGTGAGAACAGGG + Intronic
1165885785 19:39077202-39077224 CTTTGAAATCAGACACACCAGGG + Intergenic
1166266712 19:41688883-41688905 CTTCCAGGTCAGGTAGAACATGG - Intronic
1166566052 19:43766333-43766355 CTTTGAACTCAGACAGATCAGGG - Intergenic
1167646153 19:50706225-50706247 CTTTGGAGTCAGAGAGATCTGGG - Intronic
1167666473 19:50825352-50825374 CTTTGAAGTCAGCAATAAGATGG + Intronic
1168125027 19:54278224-54278246 CTTTGAGCTCAGAGAGGACAGGG + Intronic
1168133045 19:54332844-54332866 CTTTGAACTTAGAGAGGACAGGG + Intergenic
1168176959 19:54633332-54633354 CTTTGAGCTCAGAGAGGACAGGG - Intronic
1168185773 19:54698511-54698533 CTTTGAGCTCAGAGAGGACAGGG - Intronic
925867941 2:8245282-8245304 CTCTGAACTCCAATAGAACATGG - Intergenic
926487804 2:13484346-13484368 CCATGAAGCCAGAAAGAACAGGG - Intergenic
927387985 2:22558562-22558584 CCTTGAAGTGAGAGAGAGCACGG + Intergenic
927423130 2:22953741-22953763 CTCTGGAGTCAGAGAGACCATGG + Intergenic
927546488 2:23958681-23958703 CTTTGGAGTCAGATAAACCTAGG + Intronic
928260373 2:29761279-29761301 CTTTGAAGGCAGATAGATGTGGG + Intronic
928657437 2:33466886-33466908 GTTTGAAGTCAGACAGACCTGGG + Intronic
928812353 2:35244450-35244472 ATTTGAAGTCAGACATAACTGGG + Intergenic
930369679 2:50487265-50487287 CTTTGACGTCAGAAAGACCTGGG - Intronic
933247073 2:79987380-79987402 TTTTGAATTCAGAAAGAACTGGG + Intronic
933295930 2:80491373-80491395 CTTTGAAGACAGATAGACAACGG + Intronic
935197157 2:100823933-100823955 TTTTGAAGTCAGACAGACCTGGG + Intronic
935249209 2:101246995-101247017 CTTTGCAGTCAGGTAGACCTAGG - Intronic
936239924 2:110778522-110778544 TTTTGGAGTCAGATAGAACAGGG + Intronic
936898034 2:117450868-117450890 CTTTGCAGTCAAATAGATCTGGG - Intergenic
936902595 2:117499916-117499938 CTTTAAAGTTATATAGAAAAAGG - Intergenic
937082364 2:119149432-119149454 CTTTGACGTCAGATAGACCTGGG + Intergenic
937235617 2:120430361-120430383 CTCTGGAGTCAGACAGACCAAGG - Intergenic
937483867 2:122293349-122293371 CTTTGAAATAAGATGCAACAAGG - Intergenic
937632192 2:124115550-124115572 TTCTGAAGTCAGATAGACCTGGG + Intronic
938155850 2:128939436-128939458 CTTTGGAGTCACACAGACCAGGG + Intergenic
938169631 2:129063452-129063474 CTTAGGACTGAGATAGAACAGGG - Intergenic
939372364 2:141317661-141317683 CTTAGATGTCAGACAGAACAGGG + Intronic
939866061 2:147473773-147473795 CTTTGAAGTCAAATAGATCTAGG - Intergenic
940158792 2:150689211-150689233 CTTTAAAATCAGATAGACCTGGG - Intergenic
940896178 2:159083358-159083380 TTTTAAAGTCACATACAACATGG - Intronic
941296742 2:163748435-163748457 CTTTGCAGCAAGATAGAACTGGG - Intergenic
941365804 2:164609848-164609870 TTTTGAATTCAGATAGATGATGG - Intronic
941716961 2:168774166-168774188 CTCTGCAGCCAGATAGTACATGG + Exonic
941821626 2:169849647-169849669 CTGTTAAGTCAGATAGAATTTGG + Intronic
942003202 2:171671400-171671422 CTTTGAAGATAGAAGGAACACGG + Intergenic
943325930 2:186498061-186498083 CTTTGTAGGCAGATAAACCAGGG - Intronic
943382347 2:187167103-187167125 CTTTGAAGTCAGACAGACCTTGG - Intergenic
945042582 2:205754700-205754722 CTTTACATTCAGATAAAACATGG - Intronic
945772386 2:214060245-214060267 CTTTGGAGTCATTTAGAATATGG - Intronic
946498964 2:220225398-220225420 CTTTGGAATCAGATAGAACTTGG + Intergenic
947473419 2:230418613-230418635 ATTTGATCTCAGATAAAACAGGG - Intronic
948087561 2:235264317-235264339 CTTTGGAGTCAGACAGGACTGGG - Intergenic
948175069 2:235936891-235936913 CTTTGAAATCAGAAAGATCTGGG - Intronic
1168970188 20:1925614-1925636 CTTTGAAGTCAGACAAACCAGGG + Intronic
1168974911 20:1957494-1957516 CTTTGAAGTCAGAGAGGACCTGG + Intergenic
1168990565 20:2092218-2092240 CTTTGGAATCAGATACACCAGGG + Intergenic
1169248995 20:4046074-4046096 CTTTGAAGGCAGCTAGACCTGGG - Intergenic
1169424629 20:5486190-5486212 CTTCGAAGTCAGGAAGAACATGG + Intergenic
1171194734 20:23187908-23187930 CTTTGACGTCAGAGTGAGCAGGG + Intergenic
1171256089 20:23690085-23690107 GTTGGAAGTGAAATAGAACAGGG + Intergenic
1171263439 20:23751995-23752017 TTTGGAAGTGAAATAGAACAGGG + Intergenic
1171272492 20:23827767-23827789 GTTGGAAGTGAAATAGAACAGGG + Intergenic
1171522765 20:25787995-25788017 CTCTGAAGTCAGAAAGACCTGGG + Intronic
1171530508 20:25849964-25849986 CTCTGAAGTCAGAAAGACCTGGG + Intronic
1171554062 20:26067888-26067910 CTCTGAAGTCAGAAAGACCTGGG - Intergenic
1172043435 20:32062295-32062317 ATTTGAAGTCAGATAGAGCTGGG - Intronic
1172356309 20:34282686-34282708 CTTTGAAGCCAGATAGACCTGGG - Intronic
1172484516 20:35290373-35290395 CTCTGGAGTCAGAAAGAACTGGG + Intronic
1172809762 20:37638838-37638860 CTTTCAAGTCAGAGAGAAACAGG + Intergenic
1173679560 20:44868304-44868326 CTCTGAAGTCAGACAGAACTGGG - Intergenic
1173913404 20:46687900-46687922 CTTCGTAGTCAGAGAGGACAGGG + Intronic
1174243761 20:49160208-49160230 CTTTGAAGTCAGACACATCTAGG - Intronic
1174651103 20:52126352-52126374 TTCTGAAGTCAGAAAGAACTGGG - Intronic
1177520630 21:22218115-22218137 CTCTCAAGTCACATAAAACAAGG + Intergenic
1177636390 21:23792504-23792526 ATTTGAAGTCTGATAGACCTGGG + Intergenic
1179107426 21:38415137-38415159 CTGTGGAGTCAGAAAGAACTGGG + Intronic
1179404064 21:41111014-41111036 CTTTGCAGTAAGAGACAACAAGG + Intergenic
1179446992 21:41438923-41438945 CTTTGAAGCCAGCTGGACCATGG + Intronic
1179775782 21:43661110-43661132 CTGGGAAGTCTGATAGAAAAAGG + Intronic
1181785707 22:25225178-25225200 CTTTGCAGTCAGATAGAGCTGGG + Intronic
1182031214 22:27160880-27160902 CTTTGGAGTCAGACAGACCTGGG - Intergenic
1182335045 22:29578470-29578492 CTTTGAAATCAGATGGACCTGGG - Intronic
1182883613 22:33754858-33754880 CTGGGAAGTCAGATTGTACATGG - Intronic
1182944328 22:34307809-34307831 CTTTGAAATCAGATAGGGCCAGG + Intergenic
1183598979 22:38829068-38829090 CTTTGGAGTCAGACAGCCCAGGG + Intronic
1184876655 22:47280287-47280309 CTTTGAAGTCGGACAGAAATGGG - Intergenic
1185054881 22:48574497-48574519 CTTGGAGGTCAGATAGATCAAGG - Intronic
949211433 3:1507626-1507648 CTTTGAAGTCAGACAGCCCTAGG + Intergenic
949222080 3:1647894-1647916 CTTTGAAGTCAGAATGACAATGG - Intergenic
949438405 3:4053665-4053687 CTTTGAAATCAGGGAGAATAGGG + Intronic
949479020 3:4475627-4475649 GTTTGAAGTCAGATAAAATGAGG + Intergenic
949607821 3:5673832-5673854 CTTGGAAGTCAGAGTGAACTTGG - Intergenic
951006549 3:17622336-17622358 CTGAGAAGTCATTTAGAACAGGG - Intronic
951912509 3:27766339-27766361 ATTTGATGTCAGACAAAACAAGG - Intergenic
951985984 3:28621525-28621547 CTTTGAAACCAGTGAGAACAAGG + Intergenic
952499334 3:33945314-33945336 CTTTGAAGTCAGACAGACCTGGG - Intergenic
952675446 3:36024935-36024957 CTCTGAAGTTAGATAGTAAAAGG + Intergenic
953363468 3:42321802-42321824 CTCTGAAGCCAGATGGAACCAGG + Intergenic
953519200 3:43625038-43625060 CTTGGAAGCCAGAGAGAACATGG - Intronic
953543185 3:43840796-43840818 CTTTGAAGTCCAGTAGGACAAGG - Intergenic
954837926 3:53486935-53486957 CTTTGGAGACACATAGAACTGGG - Intergenic
955672654 3:61418214-61418236 CTTTGGAGTCAGAGAGATCAGGG - Intergenic
955800769 3:62684042-62684064 CTTTGAAGTAAGTTACTACATGG + Intronic
958681557 3:97338583-97338605 ATTTGAAGTCAGCTATAATAGGG - Intronic
959687314 3:109161913-109161935 CTTTGGAGTCATAGAGATCAAGG - Intergenic
960584484 3:119308471-119308493 CTTTGAAGACAGATGGAGGAAGG - Intronic
960632800 3:119750038-119750060 CTTTGGAGTCACATAGACCATGG - Intronic
960738364 3:120804784-120804806 CTTTAATGTCAGATAGACCAGGG + Intergenic
961078290 3:124002172-124002194 CTTTGAAGTCAGATAAACTTGGG + Intergenic
961305227 3:125954598-125954620 CTTTGAAGTCAGATAAACTTGGG - Intergenic
961836530 3:129665726-129665748 ATTTGAAGTCAGACAAAACTGGG + Intronic
962475613 3:135752721-135752743 CTTTGAAATCACCTAGGACACGG + Intergenic
962714073 3:138112259-138112281 CTCTGGAGTCAGATAGAACTTGG - Intronic
963402856 3:144823365-144823387 TTTTCAAACCAGATAGAACATGG - Intergenic
964982865 3:162708377-162708399 CTTTGGAGTCAGACAGAAAAAGG - Intergenic
965815769 3:172635102-172635124 CTTTGAAGCCAGACAGCACTGGG - Intronic
965876214 3:173324425-173324447 CTTTGGAGTCAGATAGATTTGGG - Intergenic
966322336 3:178714826-178714848 CTTTGAGGAGAGATTGAACATGG + Intronic
966887645 3:184385709-184385731 CTTGGGAGTCAGATAGACCTGGG + Intronic
967019714 3:185512153-185512175 CTTTGAACTCAGCCAGAACTGGG - Intronic
967152706 3:186664415-186664437 ATTTGAAGACAGAAAGAAAAGGG - Intronic
967467233 3:189822008-189822030 CTTTGTGGTCAGATAGACCTGGG + Intronic
967843524 3:194026596-194026618 CCTGGAAGTAAGAGAGAACATGG + Intergenic
969076927 4:4586941-4586963 GTTTGAAGTCAGATAGCATGAGG - Intergenic
969084909 4:4649052-4649074 CTTTGGAGTCAGACAGACCTGGG - Intergenic
969949431 4:10819190-10819212 GTTTCAAGTCACAAAGAACAGGG + Intergenic
970226878 4:13868060-13868082 TTTTCAAGTCAGATAGAACTGGG - Intergenic
970353942 4:15233895-15233917 CTTTGAAGTCTGGTATACCAGGG + Intergenic
970476513 4:16429247-16429269 CAGAGAAGTCAGATAAAACAAGG - Intergenic
972099377 4:35393609-35393631 CATTGAAGTCAGAAATTACAAGG - Intergenic
974517625 4:62937370-62937392 CTTTGAAATCAGACAGACCCAGG - Intergenic
974939715 4:68451851-68451873 CTTTGAAGTCAGATAGACCCTGG - Intronic
975198541 4:71556120-71556142 TTTTAAAGTCAGATAGAACTGGG + Intronic
975251786 4:72188471-72188493 CTTTGAAGTCAAATACATCTGGG - Intergenic
976603647 4:86962287-86962309 CTTTGAAATCAGTTAGATCTGGG + Intronic
977984591 4:103367142-103367164 CTTTGCAGTGAGAAAGAAAATGG + Intergenic
978416902 4:108486353-108486375 CTTTGAAGGCAGAAAGAAATAGG + Intergenic
978594900 4:110366945-110366967 CATAGAAGTAAGAGAGAACAGGG - Intronic
979368315 4:119851733-119851755 AACTGAAGTCAGATAAAACATGG - Intergenic
979715070 4:123828088-123828110 CTTTGCAGTCAGATACACCTGGG - Intergenic
980101918 4:128550444-128550466 CTTTGGAGTCAGACAGACCGGGG - Intergenic
980819495 4:137994915-137994937 CTTTGAAGTTAGATGCAAGATGG + Intergenic
980952472 4:139395219-139395241 CTTTTAGGTCAGACAGAACTAGG + Intronic
981055397 4:140355489-140355511 CTTTGAAGTCACCTAGACCTGGG - Intronic
981105397 4:140875117-140875139 CTCTGGAGTCAGATAAAACCAGG - Intronic
981200094 4:141970413-141970435 GTTTGAAGTCAGGTAGCATAAGG - Intergenic
981642027 4:146955654-146955676 CTTTGGAGTCAGGTAGACCAAGG - Intergenic
981701874 4:147616467-147616489 CTTTGGAGTCACAAAGACCAAGG + Intergenic
981841840 4:149122143-149122165 TTTTGGAGTCAGAGAGAACTGGG - Intergenic
982635384 4:157889236-157889258 CTTTGTATTTAGATAGAACTGGG - Intergenic
983280859 4:165679381-165679403 CTTTGGAGTCAGACAGACCTGGG + Intergenic
984002453 4:174266653-174266675 TTTTGAAGTCAGACAGACCTGGG + Intronic
984896594 4:184546990-184547012 CTTTGAAGTCAGTCAGACCTGGG + Intergenic
985079819 4:186252967-186252989 CTTTGGAGTTAGACAGAACATGG + Intronic
985421104 4:189786033-189786055 CATTGAAGTTAGATGGCACAGGG - Intergenic
986275958 5:6275125-6275147 CTTTGAAGACAGAGAGGTCATGG + Intergenic
986352484 5:6893483-6893505 CTCTGGAGTCAGATAGAACTGGG + Intergenic
987027682 5:13943963-13943985 ATTTGCAGGCATATAGAACAGGG + Intronic
988903878 5:35764381-35764403 CTTTGAAGTCATATAGACCTAGG - Intronic
990205198 5:53421371-53421393 CTTTGAAGTCAGACAAACCTGGG - Intergenic
990272259 5:54156247-54156269 CTTTGGAGTCAGACAGAACTAGG + Intronic
992407450 5:76473093-76473115 CTTTGAAGTCAGAAAGACCTAGG - Intronic
992568124 5:78022972-78022994 CTTTGAAGTTAGATACACCTGGG - Intronic
993332048 5:86612729-86612751 CTTTGAAATCAGATAAACCTTGG + Intergenic
993767348 5:91877889-91877911 CTTTGAAATCACATAGACCTAGG - Intergenic
993857348 5:93092951-93092973 CTGTGGAGACAGATAGAAAAGGG - Intergenic
994200025 5:96962947-96962969 CTATGAAGTCACGTACAACAAGG + Intronic
994625743 5:102216230-102216252 CTTTGAATTCTGATATAAGACGG - Intergenic
995074300 5:107963482-107963504 CTTTGAAGTCAGAAAAAAAATGG + Intronic
995115236 5:108471615-108471637 CTTTGAAATCAGGTACCACAGGG + Intergenic
995628858 5:114111055-114111077 GTTTGAAGTCAGGTAGCACGAGG - Intergenic
995782351 5:115791457-115791479 CTTTGGAATCAGATAGAACTTGG + Intergenic
995957837 5:117801102-117801124 CTTTGAAGTCAGATAATATGAGG - Intergenic
996914540 5:128696291-128696313 ATTTGGAGTCAGACAAAACAAGG + Intronic
997277977 5:132614023-132614045 CTTTGAAGTCAGATACATCTAGG - Intronic
997485764 5:134229261-134229283 CTCTGGAGTCAGATGGAACTGGG + Intergenic
997568999 5:134911321-134911343 CTTGGAAGTCAGCTTTAACAAGG + Intronic
997897243 5:137730195-137730217 CCTTGGAGTCAGATAGACCTGGG - Intronic
997912741 5:137892110-137892132 CTTTGAATTCAGACAGATAAGGG - Intronic
997984298 5:138491209-138491231 CTGTGAAGGCAGAAAGAACCTGG - Intergenic
998254163 5:140572050-140572072 CTTGGAAATCAGACAGATCAGGG + Intronic
998520420 5:142795158-142795180 TTTTGGAGTCAGATAGACCTGGG + Intronic
998535629 5:142928279-142928301 ATTTTAAGACAGATAAAACATGG + Intronic
998801432 5:145873556-145873578 TTTTGGAGTCAGATAGATCTGGG - Intergenic
998944630 5:147325055-147325077 CTTTGAGGTCAGAGAGATCTAGG - Intronic
999721761 5:154403715-154403737 TTCTGAAGTCAGCTAAAACAGGG + Intronic
999855936 5:155593996-155594018 CTTTTAAGTCAGAGAGTACCAGG + Intergenic
999926470 5:156384191-156384213 TTTGGAAGTAAGAAAGAACATGG - Intronic
1000106958 5:158068889-158068911 CTTTAAAGTCAGACAAACCAAGG - Intergenic
1000740223 5:164960057-164960079 ACTTGAAGTCAGAGAGAAAAAGG - Intergenic
1001440860 5:171741708-171741730 CCTTGGAGTCAGAGAGAACGGGG - Intergenic
1001686131 5:173596295-173596317 CTCTGATCTCAGATAGATCAGGG - Intergenic
1001892747 5:175352850-175352872 GTTTGAAGTCAGATAGACCTGGG - Intergenic
1004089552 6:12487168-12487190 CTTTCAATTCTGTTAGAACAGGG + Intergenic
1004242829 6:13942749-13942771 TTTAGGAGTCAAATAGAACAGGG - Intronic
1004814268 6:19295651-19295673 CAATGAAGTCAGTTATAACAGGG - Intergenic
1005252984 6:23968748-23968770 CTTTGAAGTGAAATGGATCAGGG - Intergenic
1007000739 6:38309986-38310008 CTTTGGAGGCAGAGAGAAAAAGG + Intronic
1007291138 6:40787753-40787775 CTTTGGAGTCAGACAGAACAGGG + Intergenic
1008812939 6:55527027-55527049 CTTTGCAGTCAGATAGACTTGGG - Intronic
1009944459 6:70326498-70326520 CTTTGAAGTCAGACAGAACTAGG - Intergenic
1010153832 6:72768408-72768430 CTTTGAAGACAAACAGAATATGG + Intronic
1010905542 6:81482917-81482939 CTTTGAATTCAGAAAGATCAAGG + Intergenic
1011000826 6:82586503-82586525 CTTTGGGGTCAGTTGGAACAAGG - Intergenic
1012270378 6:97202675-97202697 CTTTGGAGTCAGATACACCTGGG - Intronic
1012417855 6:99029005-99029027 CCTTGGAGTCAGACAGAACTGGG - Intergenic
1012648256 6:101716952-101716974 TTTTGAAGGCTGATAGAAAAGGG - Intronic
1012649828 6:101738896-101738918 CTGTGAAGTAAAATAGAAAACGG + Intronic
1012868987 6:104651714-104651736 CTTTGGAGTCAGACAGACCTAGG - Intergenic
1013671237 6:112405728-112405750 ATTTGGAGTCAGATAGACCTGGG + Intergenic
1014020057 6:116576541-116576563 CTGGGGAGCCAGATAGAACAGGG - Intronic
1014860539 6:126461496-126461518 CTTTGGAGTCAGACAGAATTGGG + Intergenic
1015033110 6:128620049-128620071 CTATGAAGTCAATAAGAACAAGG - Intergenic
1015038860 6:128691770-128691792 CATTAAAGTCATATAGAAAATGG - Intergenic
1015068651 6:129061774-129061796 CTTTGGAGTCAGGTAGACCTGGG - Intronic
1016051064 6:139530623-139530645 CTTTGAAGTCAGACAGACCCAGG + Intergenic
1016138949 6:140584570-140584592 TTTTGAAGTCTGATAGAATTTGG - Intergenic
1016329115 6:142937533-142937555 ATTTGAAGTCAGACAGAATAGGG - Intronic
1016384143 6:143514678-143514700 CTATGAAGTCGTTTAGAACATGG + Intergenic
1016460379 6:144275181-144275203 CTTTGAAGGAGGAAAGAACATGG - Intergenic
1016943723 6:149507781-149507803 CTTTGAAGTCAGGTAGATCTGGG + Intronic
1017255918 6:152333456-152333478 CTTTGAGGTCACAGAGAAAATGG + Intronic
1017632994 6:156416950-156416972 CTTTGGAGTAAGATAGAACATGG + Intergenic
1017995938 6:159531684-159531706 CTTTGCAATCAGACAGAACTGGG + Intergenic
1018080940 6:160258905-160258927 CTTTGAAGTCAGCTGGACCAAGG - Exonic
1018284003 6:162217897-162217919 CTTAGAAGTCGGATAGATTAAGG - Intronic
1018365823 6:163118744-163118766 CCTTGAAGGCAGATTGAACATGG - Intronic
1019896918 7:3989959-3989981 CTCTGGAGTCAGACAGCACAGGG - Intronic
1020357204 7:7290637-7290659 CTTTGGAGTCAGATAGACCTGGG - Intergenic
1020495657 7:8850038-8850060 CTTTGAAGTCAGACAAAAATGGG - Intergenic
1020654304 7:10911399-10911421 CTTGGAAGTCAGAAACAAGATGG - Intergenic
1022592472 7:31678752-31678774 ATTTGAAGTCATAGAGAACTGGG - Intergenic
1022649820 7:32264459-32264481 TTTTTAAGTCAGATGGAACTAGG - Intronic
1023455211 7:40331394-40331416 CTTTGGAGTCAGACAGACCTTGG + Intronic
1023529635 7:41138854-41138876 TTTTGAAATCAGATAGATCTGGG - Intergenic
1024355501 7:48410204-48410226 CTTCAAAGACAGAGAGAACAGGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024783744 7:52882281-52882303 CTTTTAAGTCAGAGAGAATGAGG - Intergenic
1024924381 7:54597948-54597970 CTTTGGAATCATCTAGAACAAGG + Intergenic
1026361496 7:69605002-69605024 CTTTTAATTCTGACAGAACATGG - Intronic
1026988982 7:74572542-74572564 CTTTGACGTGATACAGAACAAGG + Intronic
1027008968 7:74725299-74725321 GTTTTAAGTCATATGGAACATGG - Intronic
1028026900 7:85854336-85854358 CTGTGAAGGAAGATAAAACAGGG - Intergenic
1028688749 7:93624821-93624843 CTTTGATATCAGAAATAACAAGG - Intronic
1028832146 7:95340000-95340022 ATTTGAAATCATAAAGAACATGG + Intergenic
1028835179 7:95366699-95366721 CTTTGAATTCAGATGGATCTGGG + Intronic
1029171552 7:98633146-98633168 CTTTTAAATCAGATAAAAGAAGG - Intergenic
1029286259 7:99468256-99468278 CTTTGAAGACAGAGAGTTCAAGG - Intergenic
1030486732 7:110178018-110178040 CTTTGAAATCAGACAGAATTGGG - Intergenic
1031054322 7:116976981-116977003 CTCTAAAGTCAGTTAGAATAAGG + Intronic
1031464202 7:122088458-122088480 CATTGCAGTCAAATAGAACTGGG - Intronic
1032623122 7:133558352-133558374 CTTTGAATTCAGCTATAACTTGG + Intronic
1032894897 7:136239425-136239447 CAATGAAGAGAGATAGAACAAGG - Intergenic
1033145528 7:138867679-138867701 CTGTGAAGTCTGAGAGAACGGGG + Intronic
1033209685 7:139451677-139451699 CTTTGGAGTCAGATAGCAAGTGG + Intergenic
1035110052 7:156474231-156474253 CTTTGCAGGCAGATACAACTAGG - Intergenic
1035146471 7:156822425-156822447 TTTTGGAGTCAGATAGACCTGGG - Intronic
1035664416 8:1370216-1370238 CTCTGAAGGCAGGTAGAAAATGG + Intergenic
1037001514 8:13724863-13724885 TTTTGAAGTCAGATAGATGCTGG - Intergenic
1038022612 8:23562823-23562845 CTTTGGAATCAGAGAGAACTGGG - Intronic
1038109105 8:24474951-24474973 CATTGCAGTCAGATAAAATAAGG + Intronic
1038232380 8:25714500-25714522 GTTTGAAGTCACATAGATCCAGG + Intergenic
1038547793 8:28439291-28439313 CTTTGCAGTCAGACAGACCTGGG - Intronic
1039464491 8:37774313-37774335 CTTTGAAATCAGACAGACCTTGG + Intronic
1040034506 8:42856776-42856798 CTTTAAAGTCAGACAGATCTGGG + Intronic
1041874844 8:62676216-62676238 CTTTGGAGTCAGACAGATCTGGG - Intronic
1042682691 8:71404070-71404092 CTACGAAGTCAGATTGAAAATGG + Exonic
1042985666 8:74580316-74580338 ATTTGAAGTGAGAGAGAGCATGG - Intergenic
1043405751 8:79931125-79931147 CTTTAAAGTAAGACAAAACAGGG + Intronic
1044226519 8:89725156-89725178 CTTTGAAGTCAGGCAGACCTGGG - Intergenic
1044273393 8:90272841-90272863 CTCTGAAGTCAGATGGCACAAGG - Intergenic
1044282068 8:90367830-90367852 CTTAGCAGTCAGATAGTACATGG - Intergenic
1044595800 8:93957126-93957148 CTTTGAAGTGAAAAAGAACTGGG - Intergenic
1044614232 8:94122762-94122784 GTTTGAAGTCAGATAGCATGAGG + Intergenic
1044791723 8:95854255-95854277 ATTTGCAGTCAGAGAGAAAAAGG - Intergenic
1044975762 8:97663916-97663938 CTTTGAAGTCAGATAGATTTGGG - Intronic
1045045515 8:98272194-98272216 CTCTGAAGTCAAATAGACCTGGG - Intronic
1046423057 8:114009513-114009535 CTTTGGAGTCAGACAGACCTCGG - Intergenic
1046444465 8:114298824-114298846 ATCTGAAGTTAGAGAGAACAAGG - Intergenic
1046647289 8:116800183-116800205 CTTTGAAGTCATATTGATCTGGG - Intronic
1047139945 8:122126966-122126988 CTTTGCAGTCAGGTAGACAAAGG + Intergenic
1047514499 8:125541917-125541939 TTTTGGAGTCAGATAGACCTGGG + Intergenic
1047832908 8:128655763-128655785 CTTTCAAGGAAGAAAGAACAGGG - Intergenic
1048240718 8:132739265-132739287 CTTTTAAATCAGATAGACCTCGG + Intronic
1048280262 8:133100630-133100652 ATTTGGAGGCAGATAGAACTGGG - Intronic
1048289554 8:133170132-133170154 CTTTGGACTCAGACAGAACTGGG + Intergenic
1048609128 8:136002928-136002950 CTATGAAGTCAGCTAGATCCGGG - Intergenic
1048636412 8:136300709-136300731 CTTTGGAGTCAGATAGAAATGGG + Intergenic
1049945035 9:586215-586237 CTTTGAAGTCAGATGTCACTGGG - Intronic
1050125387 9:2352146-2352168 CTTTGAAGTTAGATAGGCCTTGG + Intergenic
1050645056 9:7710795-7710817 CTTTGAAGTCAGATAGATTTGGG + Intergenic
1050708042 9:8426327-8426349 CCTTGAAGTCAGGGAAAACAAGG - Intronic
1050731814 9:8717462-8717484 CTGTGAAGTCAAATAGAATGAGG - Intronic
1051038547 9:12778158-12778180 CTTTGAAGCCAGATAAACCAGGG + Intronic
1051846274 9:21454974-21454996 CTTTTAGGTCATATAGAACAAGG + Intergenic
1053405373 9:37870683-37870705 CTATGAAGTCAGACAGAACCAGG - Intronic
1055314548 9:75020861-75020883 CTTTGAAGTCAGAAAGATCAGGG + Intronic
1055403280 9:75947361-75947383 AAATAAAGTCAGATAGAACAAGG + Intronic
1055792601 9:79938667-79938689 CTTTGGAATCAAATAGACCACGG + Intergenic
1056417306 9:86389128-86389150 CGTTGAAGTCAGAAAGACCTTGG - Intergenic
1057329110 9:94095557-94095579 CTTTGGAGTCAGGTGGAAGAAGG + Intronic
1057413200 9:94837309-94837331 CTTTGAAGTCTGATAGAGTTCGG - Intronic
1057702610 9:97374730-97374752 CTCTGAAGTCAGACAGACCTGGG + Intronic
1057742746 9:97726390-97726412 ATTTGGAGTCAGATACACCAGGG - Intergenic
1058324280 9:103676101-103676123 ACTTGAAGTCAGAGAGAATAAGG + Intergenic
1058447224 9:105064736-105064758 CTTTGAAGTCAGACAAGCCACGG + Intergenic
1058721737 9:107770312-107770334 CTTTGGAGCCAGAAAGACCAGGG + Intergenic
1058928305 9:109690624-109690646 CTTTGAATTCAGTTTGAAGAGGG - Intronic
1059336774 9:113573924-113573946 CTTTGGAGTCAGGCAGACCATGG + Intronic
1059422730 9:114202366-114202388 CTTTGCAGGCAGGTAGAATACGG + Intronic
1059659397 9:116386598-116386620 CTTTTGAGTCAGATAGAACTGGG - Intronic
1059668194 9:116469324-116469346 CTATGACGTCATATAGATCATGG - Intronic
1059731473 9:117061223-117061245 CTTTGGAGTCAGACAGATCTGGG + Intronic
1059974701 9:119702947-119702969 CTCTGGAGTCAGAGAGAACTGGG - Intergenic
1060040551 9:120296500-120296522 CTCTGGAGTCAGACAGATCAGGG + Intergenic
1061084032 9:128389048-128389070 CTTTGTAGCCAGATGGAAAATGG - Intronic
1185713999 X:2326725-2326747 CTTTGAGGGCAGAGAGGACACGG - Intronic
1186842558 X:13498695-13498717 CTTTGAATTGAGATAGACCTGGG - Intergenic
1187454297 X:19427809-19427831 CATTGAAGTCAGTTAAAATATGG + Intronic
1187602998 X:20852723-20852745 CTTTAAAGTTTGTTAGAACATGG + Intergenic
1187838791 X:23463731-23463753 CTTTGAAGTCAGTTAAACCTGGG - Intergenic
1188026972 X:25220149-25220171 CTTTGAAGCCAGACTGAACTTGG - Intergenic
1188069107 X:25696932-25696954 CATTGAAGTTAGATCAAACAGGG - Intergenic
1188353076 X:29156172-29156194 CTTTGGAGTCAGACAGACCAGGG - Intronic
1188363314 X:29283580-29283602 CTTCGCAGACAGATAGAGCATGG + Intronic
1188407703 X:29832243-29832265 CTTTTAAGTCAGGTAGAGCACGG - Intronic
1188607738 X:32053672-32053694 CTTTGAAGACATTTAGAACATGG - Intronic
1188862974 X:35279483-35279505 CTTTGATGTCAGATCTACCAGGG - Intergenic
1189298415 X:39935375-39935397 TTTTGGAGTCAGATGGAACTGGG - Intergenic
1189745376 X:44163058-44163080 CTTTGGAGTCAGACAGAGCTGGG - Intronic
1190734555 X:53247483-53247505 CTTTGCAGTCAGAAATAACTGGG - Intronic
1190776201 X:53554105-53554127 CTTTAAAGTCAGACAGATCTGGG + Intronic
1191771576 X:64766201-64766223 CTTTGAAGGCAGATGTAATAGGG + Intergenic
1191914695 X:66188753-66188775 CTATGCAGTCAGAGAGACCAAGG - Intronic
1192134449 X:68583681-68583703 CTTTCAAGTCTGAGAGAAAAAGG - Intergenic
1195020811 X:100825885-100825907 CTGTGAGGTCAGATAAAACCAGG - Intronic
1195603948 X:106780778-106780800 CTTTAAAGCCAGATAGAACCTGG + Intronic
1195731528 X:107973186-107973208 CTCTGAAGTAGGAGAGAACATGG + Intergenic
1195778348 X:108432928-108432950 CAGTGAAGTCAGATAGAATGGGG + Intronic
1196199568 X:112870325-112870347 CTTTGGAGTCAGATAGACCTAGG + Intergenic
1196413539 X:115445979-115446001 CTTTGAAGTCAGCCTGACCAAGG + Intergenic
1196618508 X:117795251-117795273 CTTTGGAGTCAGATGGACCTAGG - Intergenic
1196972145 X:121121495-121121517 CATTGACGTCAGATAGACCTCGG - Intergenic
1197128903 X:122980956-122980978 CTTTGGAGTCAAACAGAACTAGG - Intergenic
1197523741 X:127534248-127534270 ATTTGAGGTCAGACAGAACTGGG - Intergenic
1197779114 X:130142008-130142030 CTTTGGAGTCAGAGAGAATAGGG + Intronic
1197840467 X:130740837-130740859 CTTTGGAGTCAGACAGACCTGGG + Intronic
1198157038 X:133971251-133971273 CTTTCTATACAGATAGAACAAGG - Intronic
1198419694 X:136458234-136458256 CTTTGGAGTCAGAAAGACCTAGG + Intergenic
1198492201 X:137153077-137153099 CTTTGAAGTCAGACAGATCTGGG - Intergenic
1198670325 X:139073271-139073293 TTTTGAAATCAGATAGAGCAGGG + Intronic
1199769106 X:150962758-150962780 CTTTGGAGTCAGAGAGACCTGGG - Intergenic
1199824791 X:151488351-151488373 CTTTGCAGTCAGACAGACCTTGG + Intergenic
1202579002 Y:26359379-26359401 CTTTGGAGTCAGACAGACCAGGG + Intergenic