ID: 918148098

View in Genome Browser
Species Human (GRCh38)
Location 1:181775459-181775481
Sequence AACTCTTGGTAGCAGCATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918148098 Original CRISPR AACTCTTGGTAGCAGCATGT AGG (reversed) Intronic
905265987 1:36754718-36754740 TTCTCTTGGTAGCAGGATCTTGG - Intergenic
905626883 1:39495237-39495259 AACTCTTGATGGCAGCCTGTGGG + Intronic
905670053 1:39785532-39785554 AACTCTTGATGGCAGCCTGTGGG - Intronic
906192905 1:43909973-43909995 CACTCTTGGCAGCATCATGTAGG - Intronic
908362072 1:63378709-63378731 AACTCTTGTTAGATGTATGTTGG + Intronic
912087632 1:106029415-106029437 AAGTGTTAGTAGCATCATGTTGG - Intergenic
914990304 1:152494392-152494414 AACTCCTTGTTGCAGAATGTTGG + Intergenic
916438656 1:164800108-164800130 CACTCTGGGTAGCAGCAAGGAGG + Intronic
918148098 1:181775459-181775481 AACTCTTGGTAGCAGCATGTAGG - Intronic
918313006 1:183299971-183299993 ATCTCTTAATAGCAACATGTTGG - Intronic
924074228 1:240316578-240316600 AAATGTTGGTAACAGGATGTGGG + Intronic
1062972466 10:1659709-1659731 AACTACTGGAAGCAGCATGATGG - Intronic
1063211063 10:3881830-3881852 AACTCTTGGGAGCACCATTCAGG + Intergenic
1064154912 10:12896050-12896072 AAATCAAGATAGCAGCATGTGGG - Intergenic
1071887369 10:89965891-89965913 ATCTCTTGGTATCACCATATGGG - Intergenic
1076557314 10:131335645-131335667 ATCTCCTGGTAGCAGCATTTAGG + Intergenic
1077928500 11:6706509-6706531 AATTCTAGATCGCAGCATGTGGG + Intergenic
1077953705 11:6990222-6990244 ATTTCTTCGTAGCAGTATGTTGG + Intergenic
1080091519 11:28354308-28354330 TACTCTTGGTAACACCAGGTTGG - Intergenic
1083722170 11:64608836-64608858 ACCACTTGGTGTCAGCATGTCGG + Intronic
1088335922 11:108703821-108703843 AACTTTTGGTATTAGCGTGTGGG + Intronic
1091851258 12:3698957-3698979 ATCTCCTGGGAGCAGCAGGTGGG - Intronic
1091983266 12:4883952-4883974 AACACAAAGTAGCAGCATGTAGG - Intergenic
1096279288 12:50237972-50237994 AACTCTTGGTTGAAACATATGGG + Intronic
1096519969 12:52179445-52179467 AACCCTTGGGAGCAGCAGGAAGG - Intronic
1100861134 12:98808570-98808592 AACCCTTGGGAACAGCATTTGGG + Intronic
1105887571 13:24655054-24655076 AACTCTTGGAAGCAGATTGGAGG - Intergenic
1108193163 13:47964016-47964038 AAATGTTTGTAGCAGCTTGTTGG + Intronic
1111351359 13:87035671-87035693 AACTCTGGATATCATCATGTCGG + Intergenic
1114285363 14:21237475-21237497 AACTCTTGAAAGCAGCAGCTGGG + Intronic
1115665404 14:35539675-35539697 ATCTCTGGGTAGGAGCCTGTAGG + Exonic
1116415357 14:44671561-44671583 AACTCTATGTAACAGCATTTGGG + Intergenic
1126624794 15:50676220-50676242 AATTTTTGCTAGCAGCATCTAGG - Intronic
1128427913 15:67561515-67561537 AACTCTTGATAGCAGAATACTGG + Intronic
1136273534 16:29163690-29163712 AACTTTTAGAATCAGCATGTCGG + Intergenic
1137813655 16:51377312-51377334 ATGTCTTGGGAGCAGAATGTGGG + Intergenic
1139151991 16:64393331-64393353 AACTCTTAGTAGCAGAAGGTAGG - Intergenic
1144085536 17:11805110-11805132 AAATCTTGCTAGCAGTGTGTAGG - Intronic
1144246455 17:13370811-13370833 AACTATTTGTACCAGGATGTTGG - Intergenic
1148574605 17:48700710-48700732 AACTCTTGAAAGCAGCAAGACGG - Intergenic
1148855410 17:50576332-50576354 AACTCTGGGTGGAGGCATGTGGG + Intronic
1149048525 17:52276785-52276807 AACTCCAGGTAGCAGCCTGTAGG + Intergenic
1157389546 18:47289630-47289652 AAGGCTTGATAGAAGCATGTGGG - Intergenic
1157705600 18:49803050-49803072 AGTTCTTGGTACCTGCATGTAGG - Intronic
1159971905 18:74665769-74665791 GAGTCTGGGTGGCAGCATGTGGG - Intronic
1160058573 18:75509340-75509362 AACTTTTTGTAGCAGAATCTGGG + Intergenic
926536754 2:14122646-14122668 AACTTTTGGTTGCAGAATGCAGG + Intergenic
931473059 2:62559224-62559246 AACACTTGGTAGAAGAATATTGG - Intergenic
935478671 2:103557897-103557919 AACTCTTGGAAGCAGCAACGTGG - Intergenic
936829597 2:116627175-116627197 AATTCCTGGAAGCATCATGTGGG - Intergenic
938077976 2:128350967-128350989 ATCTCTTTGCAGCAGCATGAAGG + Intergenic
939024567 2:136996743-136996765 TACCCTTGGAAACAGCATGTTGG + Intronic
939950808 2:148469826-148469848 ACCTGTTGGGAGAAGCATGTTGG - Exonic
940724939 2:157326363-157326385 AACTTTTGGTATTAGCAAGTTGG - Intronic
948547129 2:238740768-238740790 ATCACATGGTAGCTGCATGTGGG - Intergenic
1174758343 20:53181958-53181980 AAGTGATGGTAGCAACATGTGGG + Intronic
1181277418 22:21695479-21695501 AGCTCCTGGTAGCAGCAGGTTGG + Exonic
1182263813 22:29096272-29096294 ATCTCTTGGTAGTAGGCTGTTGG + Intronic
950123075 3:10494761-10494783 CACCCCAGGTAGCAGCATGTGGG - Intronic
951083597 3:18482844-18482866 AAAGTTTGGTAGCAGCATTTTGG + Intergenic
952130572 3:30356947-30356969 ACAGCTTGGTAGCAGCATGTGGG + Intergenic
953201950 3:40785831-40785853 AACGCTTGGCAGCAGCTTGGTGG - Intergenic
955968995 3:64418222-64418244 AGCAATTGGTAGCAGCCTGTAGG - Intronic
960148985 3:114232179-114232201 AACTGTTGGTAGCAGTAGGGTGG + Intergenic
962092567 3:132260597-132260619 AACTGTTGGTAGCTTGATGTTGG + Intronic
962948181 3:140192706-140192728 ATTTTTTGTTAGCAGCATGTTGG + Intronic
966518769 3:180849947-180849969 AACTCATGGAAGCAGAAAGTAGG - Intronic
967706592 3:192658407-192658429 AACTGCTGGTAGCAGCATTTAGG - Intronic
972571260 4:40312420-40312442 TACTCCTGGTTGCAGCATCTGGG + Intergenic
972703991 4:41522978-41523000 GCCTCTTGGTAGCAGCATGTTGG + Intronic
977859110 4:101934190-101934212 AACTCTTGTTAGCAGCCTAAGGG + Intronic
978237652 4:106478868-106478890 ACCTCTAGGTAGCAGCCTCTGGG - Intergenic
979289560 4:118964976-118964998 AAATCTTGGGAGCAGCCTTTGGG - Intronic
979459085 4:120959617-120959639 AACAGTTGGTATCAACATGTTGG + Intergenic
979492013 4:121338932-121338954 AACTCCTGAAAACAGCATGTGGG - Intronic
979694678 4:123599458-123599480 AACTCTTTCTAGTAGCAAGTGGG + Intergenic
981406302 4:144373792-144373814 AACTCTTTCTAGCAGATTGTGGG + Intergenic
983918464 4:173317199-173317221 CACTTTTGGTAGCTGCCTGTAGG - Intronic
984168137 4:176327596-176327618 AAACCTTAGAAGCAGCATGTTGG + Intronic
984643414 4:182195931-182195953 AACTCCTGCAAGCAGCTTGTAGG + Intronic
986126017 5:4882889-4882911 CACTCTTGGGGGCAGCATCTGGG + Intergenic
986822227 5:11480453-11480475 ACATCATGGGAGCAGCATGTGGG - Intronic
989670215 5:43908510-43908532 AACTATTGTTAGCAGTCTGTGGG + Intergenic
991280133 5:64904089-64904111 AACTGTTTGTAGAAGCATGGTGG - Intronic
992327127 5:75671335-75671357 AACTCATGGGAGCAGCATCATGG + Exonic
993028800 5:82679230-82679252 AACACCTGGTAGCAGGAGGTGGG + Intergenic
995531412 5:113095303-113095325 AACTCTTGGTACCAAAATTTGGG - Intronic
996589729 5:125133024-125133046 AACTCTTGGAGGCAGCATTTTGG + Intergenic
1004917808 6:20348125-20348147 AATTCTCAGTAGCAGCATGTGGG + Intergenic
1007290982 6:40786596-40786618 AACACTTGTTAGCAGCATGTAGG + Intergenic
1007839488 6:44704245-44704267 AACCCTTGGTGACAGGATGTTGG + Intergenic
1010107671 6:72188396-72188418 AACTCTATGTAACAGCATTTGGG - Intronic
1012263002 6:97110091-97110113 AAATCTAGGGTGCAGCATGTGGG + Intronic
1013431119 6:110055524-110055546 AACTCTTGGTTGAAGCAGATTGG - Intergenic
1013949000 6:115756895-115756917 AACTCTTTGTATCTGGATGTTGG - Intergenic
1015058369 6:128931627-128931649 AACTCTGGGTCACAGCTTGTGGG + Intronic
1015689287 6:135903405-135903427 TACTCCTGGAAGCAGCATATTGG - Intronic
1018287859 6:162260067-162260089 GCCTTTTAGTAGCAGCATGTAGG + Intronic
1021667622 7:23001756-23001778 CACTCTTGTTACCAGTATGTAGG - Intronic
1024850685 7:53712949-53712971 AAATCTTGGTGGCAGCTAGTTGG + Intergenic
1025772501 7:64526178-64526200 AACTCTTAGAAGAAGAATGTAGG + Intronic
1030056138 7:105585017-105585039 AACTCTTGGGTGAAGCATGTGGG - Intronic
1031118647 7:117695544-117695566 AACAATTGGGAGCAGCATGCTGG + Intronic
1031844746 7:126791702-126791724 AGCTCTTGGTCACAGCTTGTGGG + Intronic
1031946053 7:127841707-127841729 AACTCTGGCCAGCAGCATGCAGG + Intronic
1032630295 7:133643664-133643686 AACTTTATGTAGCAGCATTTGGG - Intronic
1037884279 8:22588249-22588271 AACTGCTGGTAGCAGCCTGGTGG + Intronic
1038989609 8:32853671-32853693 AAGTCATTGTAGCAGCAAGTAGG - Intergenic
1042636012 8:70876155-70876177 AAGTCTTGGATGCAGCAAGTAGG + Intergenic
1046529396 8:115423668-115423690 AACTATTGTTACCCGCATGTTGG - Intronic
1049630170 8:143649752-143649774 AGCTGTGGGTAGCAGCATGTTGG + Exonic
1050822476 9:9897350-9897372 AACTCTTGGTGGAAGTGTGTAGG - Intronic
1052839996 9:33284765-33284787 AACATTTGGTAGAATCATGTGGG + Intergenic
1056699453 9:88890189-88890211 AACTCTTGCAAGCAGAATGGTGG + Intergenic
1056852444 9:90095840-90095862 AGCTCCTGGTAGAAGCCTGTGGG - Intergenic
1188678731 X:32975734-32975756 AACTCTTGGTTGCAAGATGATGG - Intronic
1188925409 X:36036242-36036264 AACTCATGGAAGCAGAGTGTAGG - Intronic
1189752209 X:44233834-44233856 ATCTGTTGGCAGCAGCCTGTGGG - Intronic
1195087992 X:101431006-101431028 AGCTCTAGGCAGCAGCATCTTGG + Intronic
1196902437 X:120398904-120398926 AACTCTTAGAAGCAGCAAGGAGG - Intergenic