ID: 918148934

View in Genome Browser
Species Human (GRCh38)
Location 1:181781591-181781613
Sequence CAGAACATGGGGAGGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 1, 2: 3, 3: 47, 4: 397}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918148924_918148934 10 Left 918148924 1:181781558-181781580 CCAACAGGAAATGGGATCTAGTT 0: 1
1: 0
2: 1
3: 12
4: 133
Right 918148934 1:181781591-181781613 CAGAACATGGGGAGGAAGCCAGG 0: 1
1: 1
2: 3
3: 47
4: 397
918148920_918148934 30 Left 918148920 1:181781538-181781560 CCTTTGCTCTGGGCTACAGACCA 0: 1
1: 0
2: 4
3: 41
4: 249
Right 918148934 1:181781591-181781613 CAGAACATGGGGAGGAAGCCAGG 0: 1
1: 1
2: 3
3: 47
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918148934 Original CRISPR CAGAACATGGGGAGGAAGCC AGG Intronic
900158742 1:1213609-1213631 CAGCACAGGGGGCGGCAGCCTGG - Intronic
900245842 1:1635765-1635787 CAGAACTTGAGGCTGAAGCCGGG + Exonic
900257067 1:1702908-1702930 CAGAACTTGAGGCTGAAGCCGGG + Exonic
900292127 1:1928112-1928134 CAAACCCTTGGGAGGAAGCCAGG + Intronic
900292139 1:1928145-1928167 CAAACCCTTGGGAGGAAGCCAGG + Intronic
900292151 1:1928178-1928200 CAAACCCTTGGGAGGAAGCCAGG + Intronic
900292163 1:1928211-1928233 CAAACCCTTGGGAGGAAGCCAGG + Intronic
900292175 1:1928244-1928266 CAAACCCTTGGGAGGAAGCCAGG + Intronic
900292187 1:1928277-1928299 CAAACCCTTGGGAGGAAGCCAGG + Intronic
900292199 1:1928310-1928332 CAAACCCTTGGGAGGAAGCCAGG + Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
901048426 1:6413241-6413263 CTGAGCATGGAGGGGAAGCCAGG + Intronic
901101929 1:6725758-6725780 CAGAACCAGGGCAGGAAGCCCGG - Intergenic
901688352 1:10957102-10957124 CAGCACCTGGGGAGGAAGGGGGG + Exonic
901727442 1:11253180-11253202 GAGAATATGGGGAGGAAGCTGGG - Intronic
902441177 1:16431156-16431178 AAGCAGCTGGGGAGGAAGCCTGG + Intronic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903561455 1:24231206-24231228 CAGAAAATAGGGAGAGAGCCAGG + Intergenic
903857483 1:26345494-26345516 CAGAACAAGGGGAGTGAGCCGGG + Exonic
904027630 1:27514354-27514376 CAGAACATGTGGAAGGAGCTAGG - Intergenic
904239029 1:29132177-29132199 GAGAACAGGGTCAGGAAGCCTGG + Intergenic
904690441 1:32289851-32289873 TATAAAATGGGGAGGAGGCCGGG - Intergenic
904700274 1:32353766-32353788 CAGAACTTGGGGGGCAAGTCAGG - Intronic
905277334 1:36826969-36826991 CAGAACATGGGGCTGAAGGAGGG - Intronic
905904912 1:41611720-41611742 CAGGACAGTGGGAGAAAGCCAGG - Intronic
905942963 1:41878825-41878847 CAGGAGATGGGGAGGAAGGAAGG - Intronic
906567413 1:46811013-46811035 CATGATATGGGGAGGAAGCCTGG + Intronic
907258559 1:53198263-53198285 CCACACATGGGGAAGAAGCCTGG - Intronic
907861565 1:58358596-58358618 CAGAAGGTGGGGATGCAGCCTGG + Intronic
908232615 1:62121051-62121073 CAGAAAATCGTGAGGAGGCCAGG - Intronic
908404400 1:63800066-63800088 CAGGAGATGGGCAGGCAGCCAGG + Intronic
910396479 1:86799214-86799236 CAGAAAATGGTGTGGGAGCCAGG - Intergenic
911146510 1:94557592-94557614 TAGAACTTGGGGAGGAAGAAGGG - Intergenic
913252081 1:116920039-116920061 CAGAAGATGGGCAGGAAGCCAGG - Intronic
913456716 1:119039660-119039682 CAGAACTTGGTAAGGAACCCTGG - Intronic
915040960 1:152967961-152967983 GAGAACATGCGGTGGAAGCCAGG - Intergenic
915476665 1:156156566-156156588 AAGAACATGGTGAGGAGTCCAGG + Exonic
916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG + Exonic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
918060846 1:181060121-181060143 CAGAAGATAGGAGGGAAGCCTGG - Exonic
918148934 1:181781591-181781613 CAGAACATGGGGAGGAAGCCAGG + Intronic
919631850 1:199966972-199966994 AAGAAAATGGAGAAGAAGCCAGG + Intergenic
919894804 1:202002879-202002901 CAGAGCAGGGGTAGGAACCCAGG + Intronic
920533628 1:206723176-206723198 CAGGACACGGGGAGGAAAGCAGG - Intronic
921302890 1:213767388-213767410 CAGAAGATGGGGAGGAAATGTGG - Intergenic
921630789 1:217431284-217431306 CAGAATATGGGCTGGACGCCTGG - Exonic
922549243 1:226482026-226482048 CAGGAGATGGGGGAGAAGCCTGG - Intergenic
923621363 1:235582065-235582087 CAGAACATGGAGAGTAAACGTGG - Intronic
1064918305 10:20486954-20486976 CAGGAGCTGGGGAGGGAGCCTGG + Intergenic
1066178216 10:32933039-32933061 GAGAAGGTGGGGAGGAAGTCGGG - Intronic
1067843445 10:49700202-49700224 CAGAACATGGGAATGGGGCCTGG - Intronic
1069469331 10:68673264-68673286 TAGAGCAGGAGGAGGAAGCCAGG - Intronic
1069889652 10:71645006-71645028 CAGATCATGGGGAGGAGACATGG - Intronic
1070339360 10:75482582-75482604 CAGACCCTGTGCAGGAAGCCAGG - Intronic
1070365415 10:75732312-75732334 CAAACCATGGGTAGGAATCCTGG + Intronic
1070539967 10:77408931-77408953 CAGAAGGTGGGGAGGAATTCAGG + Intronic
1072357178 10:94623301-94623323 AAGAGCATGGGGAAAAAGCCTGG - Intergenic
1072540192 10:96392611-96392633 CAGAACCTGGGGTGGAAGTCAGG + Intronic
1074152600 10:110770782-110770804 CAGAACATGGGGACCAGTCCTGG + Intronic
1074280260 10:112044850-112044872 GACAACATGGGGAAGAAGTCCGG - Intergenic
1074486672 10:113890889-113890911 CAGAAGATGAGGAGGAAACAAGG + Intronic
1074754447 10:116614023-116614045 CAGAAGCTGTGGAAGAAGCCTGG - Intergenic
1075456250 10:122586878-122586900 AAGAAGATGGGGAGGTGGCCTGG + Intronic
1076362396 10:129898474-129898496 CAGAACAAGGAGAGGAATTCAGG - Intronic
1077461135 11:2711230-2711252 CAGTACATGGGGAGGAAGTATGG - Intronic
1077677264 11:4206213-4206235 CAAAACATGGGGGCAAAGCCAGG - Intergenic
1078095674 11:8295228-8295250 GAGAGCATGGGGAAGCAGCCGGG + Intergenic
1079862439 11:25690727-25690749 CAGAACAGTGAGAGGAAGCGTGG - Intergenic
1080029511 11:27646169-27646191 GAAAACACGGGGAAGAAGCCAGG + Intergenic
1080849252 11:36054123-36054145 CAGAAAATGGGGGGGAAACCTGG - Intronic
1081423530 11:42900108-42900130 AAGAACATGGAGAGGATTCCTGG - Intergenic
1081545207 11:44066643-44066665 CAGCACAGTGGGCGGAAGCCGGG - Exonic
1081876786 11:46414006-46414028 CAGATGCTGTGGAGGAAGCCAGG - Intronic
1082096625 11:48135968-48135990 CAGCACTTGGAGAGGAAGCTGGG + Intronic
1082849444 11:57752712-57752734 CTGAACATTGAGAGGAAGCAAGG - Intronic
1083372365 11:62192501-62192523 GAGGACATGGGGAGTGAGCCTGG + Intronic
1083378253 11:62243730-62243752 GAGGACATGGGGAGTGAGCCTGG + Intronic
1084885562 11:72203763-72203785 TAGAACCTGGGGAGGGAGCAAGG + Intergenic
1084893212 11:72247182-72247204 AAGAACAGGGGGAGGCAGGCTGG - Intergenic
1085235672 11:75013418-75013440 CAGAAAGAGGGGAGGAAGGCAGG + Intronic
1085441036 11:76562434-76562456 CAGAAGATGGGAAAGAAGCAGGG + Intergenic
1085960064 11:81451173-81451195 CTGAACATGGAGAGGTAGCTGGG + Intergenic
1086663886 11:89456547-89456569 CTGAACTTGAGGAGGAAGCTGGG + Intronic
1086929185 11:92673795-92673817 CTGAACATTGGTAGGAAACCAGG + Intronic
1087143300 11:94787897-94787919 CAGAAAATGGGCAGGAATCTAGG + Intronic
1087799823 11:102491691-102491713 CAGAAAATGGGCAGGAACCATGG - Intronic
1090747773 11:129721003-129721025 CTGAATATGGGGAGGTGGCCAGG + Intergenic
1091513506 12:1153984-1154006 CAGAGCAGGGGGAGGCAGGCAGG - Intronic
1092745626 12:11669641-11669663 AAGAAGATGGGGAGGGACCCGGG - Intronic
1092769398 12:11883174-11883196 CAGAACCTGGAGAGGCAGCTGGG - Intronic
1093102553 12:15045481-15045503 CAGAACATGGGGAGGAATAAAGG + Intergenic
1096612452 12:52811742-52811764 AAGTACATGGGGAGGAAGGAGGG - Exonic
1096992732 12:55818234-55818256 ATGAACATGAGGAGGAAGCTGGG + Intronic
1097961349 12:65534626-65534648 GAAAACATGGGCAGGAAGTCAGG + Intergenic
1098513827 12:71350725-71350747 TAGAAAATGGGGTGGAAGTCAGG - Intronic
1099318712 12:81117975-81117997 GAAAACATGGGGAGGAAGCAGGG - Intronic
1100601302 12:96113657-96113679 CAGCACTTTGGGAGGAAGGCTGG + Intergenic
1101345627 12:103883411-103883433 CAGACCAAGGGGAGTAACCCTGG + Intergenic
1101428979 12:104611408-104611430 CATAACATGGGCAGGATGCAGGG - Intronic
1103074385 12:117969943-117969965 CAGAACTTTGGGAGGCAGTCAGG + Intergenic
1103366703 12:120389365-120389387 CTGACAATGGGGAGGAACCCTGG - Intergenic
1103460230 12:121097913-121097935 CAGCACATGTGGGGGAAGGCTGG - Intergenic
1103685880 12:122731546-122731568 TAGAAAATGGGGTGGAGGCCGGG + Intergenic
1104759210 12:131287046-131287068 CTGAGCATGGGGTGGAGGCCAGG - Intergenic
1105938757 13:25128288-25128310 CAGAAGGTGGGGAGGCGGCCAGG + Intergenic
1106138833 13:26993848-26993870 CAGCACCTGGGGAGGCAGCATGG + Intergenic
1110178576 13:72587609-72587631 CAAAACATGGTGTGGAAGGCAGG - Intergenic
1111489967 13:88959512-88959534 CAGAACATGGGAAAGAGGCTGGG + Intergenic
1112813558 13:103247259-103247281 GAGAAAATGGGGAGAAAGCAAGG + Intergenic
1113146315 13:107211973-107211995 CAGAACATGGGTTTGAAGTCTGG - Intronic
1113562923 13:111298329-111298351 CAGAGCATGGGGTGCCAGCCAGG - Intronic
1113868819 13:113545899-113545921 TAGGAGATGGGAAGGAAGCCTGG + Intronic
1113909886 13:113836749-113836771 AAGAAGATGGGGAGGAAGAGGGG + Intronic
1114183502 14:20383645-20383667 CTGTACATGGAGAGGAAGTCAGG + Intronic
1114590450 14:23859995-23860017 CAGAAAATGGAGGGGGAGCCTGG - Intergenic
1114616465 14:24071399-24071421 CAGAACCGGGGGAGGAGGGCAGG - Intronic
1116592941 14:46803213-46803235 CTGAACATTGGGAAGAAGCTGGG + Intergenic
1117548296 14:56810581-56810603 CACAACAGGGGGAGGAAAACAGG + Intergenic
1119149641 14:72346765-72346787 AAGAACATGGGGGAGAACCCAGG - Intronic
1119443545 14:74645880-74645902 AAGAATATGGGAGGGAAGCCAGG - Intergenic
1120422878 14:84310821-84310843 CAGAAGATGAAGAGGAAGCAAGG + Intergenic
1120713014 14:87812650-87812672 CTGAACTTGGGGAGGGAGCTGGG - Intergenic
1120726118 14:87943571-87943593 CAGAACAAGGGCTAGAAGCCGGG - Intronic
1121887757 14:97560402-97560424 CAGGACATGGAGATGAAGCCTGG + Intergenic
1122796243 14:104207593-104207615 TCGCACATGGGGAGGAGGCCTGG - Intergenic
1122873406 14:104651605-104651627 CAGAACCTGGGGACAAAGCGGGG + Intergenic
1123029866 14:105446553-105446575 CAGAGCAGGGGGAGGTTGCCTGG - Intronic
1124038070 15:26074772-26074794 CAGAAGAATGGCAGGAAGCCAGG + Intergenic
1124416992 15:29480592-29480614 CAGGGCATGGGGAGGCAGCATGG + Intronic
1125521621 15:40351031-40351053 CAGAGCAGGGGCAGGAAGTCTGG - Exonic
1125530804 15:40412303-40412325 ACGATCATGAGGAGGAAGCCAGG + Intronic
1125606920 15:40944691-40944713 TAGAAAATGGGCAGAAAGCCAGG + Intergenic
1125754438 15:42053315-42053337 AAGAACAGGGAAAGGAAGCCTGG - Intergenic
1127259987 15:57320449-57320471 CAATTCATGGGGAGGAAACCTGG - Intergenic
1127542649 15:59956836-59956858 CTGAGCATGGGCAGAAAGCCTGG + Intergenic
1128141271 15:65302308-65302330 CAGAACTTGAGGCTGAAGCCGGG - Intergenic
1128356481 15:66931024-66931046 AAGAACAGTGGGAGGAGGCCTGG + Intergenic
1130772123 15:86935138-86935160 CAGAAAATGGAGAGGAATCGGGG - Intronic
1131922250 15:97341076-97341098 CAGAAAGTGGGGAGAAATCCTGG - Intergenic
1132551666 16:556263-556285 CAGGACATGGGCAGGCAGCCAGG - Intergenic
1132593581 16:737757-737779 GAGAGCAGAGGGAGGAAGCCTGG + Intronic
1132982206 16:2744051-2744073 CAGAACATGGAGAGGCAACAGGG + Intergenic
1133393593 16:5428719-5428741 CATTACATGGAGAGGAGGCCAGG + Intergenic
1133735757 16:8614367-8614389 CAGGAGATGGGGAGGAAGAAGGG + Intergenic
1133772272 16:8874131-8874153 CAGCACTTTGGGAGGAGGCCAGG - Intergenic
1134213491 16:12297500-12297522 CAGGAGAAGGGAAGGAAGCCAGG - Intronic
1135588391 16:23688682-23688704 CAGAAGATGGGGATGCAGGCAGG - Exonic
1135892415 16:26369436-26369458 CATAAAATGTGGAGGAACCCAGG + Intergenic
1135940873 16:26820495-26820517 CAGCACATTGGGAGGCAGGCAGG + Intergenic
1136375093 16:29860658-29860680 CAGAACTTGGGGAGAAAACAGGG + Exonic
1136404926 16:30039416-30039438 AAGAATATGAGGAAGAAGCCGGG - Intronic
1136653454 16:31693534-31693556 GGGAACATGGTGGGGAAGCCAGG - Intergenic
1137316013 16:47323878-47323900 GAGAACAGGGAGAGGAAGACGGG + Intronic
1137980435 16:53064643-53064665 CAGAGCCTGGTGAGGAAGCCAGG + Intronic
1138479176 16:57290429-57290451 CAGAAAAAGGGCAGGGAGCCAGG + Intergenic
1139339984 16:66262249-66262271 CAGAATATGGTGAGGGAGCGAGG + Intergenic
1139391645 16:66609369-66609391 CACAGCATGGGGAGGAGGCCTGG - Intronic
1139547764 16:67657666-67657688 CATGAGCTGGGGAGGAAGCCTGG + Exonic
1140212797 16:72983978-72984000 CAAAACAGGGTCAGGAAGCCAGG - Intronic
1141394452 16:83692279-83692301 AAGAGCATGGGGAGGGAGTCTGG + Intronic
1141770537 16:86087168-86087190 CAGAACATGGTGGCCAAGCCGGG - Intergenic
1141818294 16:86427820-86427842 CAGAACTTTGGGAGGATGCAGGG + Intergenic
1141832979 16:86520000-86520022 CAGGGCAAGGGGAGGCAGCCAGG + Intergenic
1141920088 16:87129869-87129891 CAGCACATGGGGTGGAAGAAGGG + Intronic
1142232109 16:88904851-88904873 CTGTACATGTGGAGGAAGCCAGG + Intronic
1142876933 17:2856802-2856824 CAGAAGAACGGGATGAAGCCAGG - Intronic
1143020102 17:3913050-3913072 CAGGCAGTGGGGAGGAAGCCAGG - Intronic
1143153162 17:4819412-4819434 CAGAACCTGGGGTGGATGCGGGG - Exonic
1143198708 17:5097436-5097458 AAGGACATGGGAAGGACGCCTGG - Intergenic
1144588034 17:16500495-16500517 CAGAAAAGGAGGAGGAGGCCGGG + Intergenic
1144816878 17:18040633-18040655 CAGAGCAGGGGCAGGAGGCCTGG - Intronic
1144877714 17:18411095-18411117 CAGAAGGTGGGGAAGAAGACTGG - Intergenic
1145063546 17:19747315-19747337 CAGAACATAGGGAGGGACCATGG - Intronic
1145154515 17:20533308-20533330 CAGAAGGTGGGGAAGAAGACTGG + Intergenic
1146161928 17:30564778-30564800 CAGAACCTGGCTAGAAAGCCTGG + Intergenic
1147456032 17:40538673-40538695 CAGAAGAGGGGCAGGAATCCAGG + Intergenic
1148851867 17:50559483-50559505 CAGAACTCGGGGAGGTAGGCGGG + Intergenic
1149516161 17:57282594-57282616 CAGAACAGGGAGAGGAAGCAGGG - Intronic
1149584487 17:57776407-57776429 TAGAACGTGGGGAGGATGGCAGG + Intergenic
1151585626 17:75006694-75006716 CAGAACAGAGGGTGGAGGCCAGG + Intergenic
1151760981 17:76103180-76103202 CGGAACATGGGGAGGGGGCTAGG + Intronic
1152158400 17:78650273-78650295 CTGAGCATGGGGAGGAGTCCTGG + Intergenic
1152425866 17:80218413-80218435 CAGAGCAGGGGGAAGAAGCTTGG - Intronic
1152701404 17:81821666-81821688 CTCAACAGGGGGAGGCAGCCTGG + Intergenic
1153516642 18:5909703-5909725 CTGAAGCTGGGGAGGAAGCAAGG + Intergenic
1154936678 18:21065596-21065618 CAGAACATTGGGAGGATGAAGGG - Intronic
1155407341 18:25503466-25503488 CCGAAGATGGGCAGGAAGTCGGG + Intergenic
1155829304 18:30492882-30492904 CAGAGCATGTGGAGGGTGCCGGG + Intergenic
1157190219 18:45575294-45575316 TATAACATGGGGAGAAAGACAGG - Intronic
1157602304 18:48901793-48901815 CAGCAGAGGAGGAGGAAGCCCGG - Intergenic
1157744029 18:50119131-50119153 CAGTAAGTGGGGAGGAATCCAGG - Intronic
1158039247 18:53072364-53072386 CAGGAGATGGGGAGCAAGGCAGG + Intronic
1159889728 18:73942349-73942371 CACAACTGGGAGAGGAAGCCAGG + Intergenic
1160301649 18:77687110-77687132 CAGCCCATGGGGAGGATCCCAGG + Intergenic
1160435531 18:78849442-78849464 TAGAACATGGGAAGGAAGGAAGG + Intergenic
1160688106 19:446669-446691 CAGAAGATGGGGAGGAGCCCTGG + Intronic
1160816797 19:1039827-1039849 TACAACGTGGGGAGGCAGCCTGG + Intergenic
1161536171 19:4819990-4820012 CAGAATATGGCAAGGGAGCCAGG + Intronic
1162043556 19:7984672-7984694 CAGATTCTGGGGATGAAGCCAGG - Intronic
1162438484 19:10678249-10678271 GAGAACATGGGGAGGAGGCAAGG + Intronic
1163052106 19:14692219-14692241 GAGAACTTGGGGAGGATGTCAGG + Intronic
1163566060 19:18052028-18052050 GAGGACTCGGGGAGGAAGCCTGG + Intergenic
1163677164 19:18660860-18660882 CAGGGCATGAGGAGGAGGCCTGG + Intronic
1164458526 19:28428263-28428285 CATCACATGGGGAGGGACCCTGG + Intergenic
1164521275 19:28982122-28982144 AAGAAGATGGGGAGGAAGGGAGG + Intergenic
1164776807 19:30859065-30859087 TAGGGCATGGGGAAGAAGCCAGG + Intergenic
1165045633 19:33102842-33102864 CAGAGCATGGGGAGGAACCAGGG - Intronic
1165819792 19:38667148-38667170 CAGAACAGGGGGAGGACTCAAGG + Intronic
1165867097 19:38945724-38945746 CAGAACCTGGAGGAGAAGCCTGG + Intronic
1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG + Intergenic
1166379501 19:42348464-42348486 GAGAACATGGTGAGGCCGCCTGG + Exonic
1167149774 19:47701953-47701975 CAGGGCACGGGGAGGCAGCCCGG + Exonic
1167650953 19:50728346-50728368 TAGAACAAGGGCAGGAGGCCTGG + Intergenic
925283516 2:2701333-2701355 CAGAACATGTGCAGGGAGCAGGG + Intergenic
926747583 2:16171691-16171713 TAGAGCATGGGGTGGGAGCCGGG - Intergenic
926825061 2:16898093-16898115 TAGAAAATGGGGAGGAAGGCTGG - Intergenic
927412065 2:22837933-22837955 AAGGGCATGGGGAGGGAGCCTGG + Intergenic
927513658 2:23659742-23659764 GAGGCCCTGGGGAGGAAGCCTGG - Intronic
927884326 2:26709405-26709427 CAGGAGATGGGAAGGAGGCCTGG + Intronic
928197100 2:29223870-29223892 GAGGAAATGGGGAGGGAGCCAGG + Intronic
928442207 2:31301900-31301922 CAGAAGAGGGGAATGAAGCCTGG - Intergenic
928747864 2:34435907-34435929 GAGAAAATATGGAGGAAGCCAGG + Intergenic
928911493 2:36426593-36426615 CAGAAAATGGGCAGTAAGTCAGG + Intronic
929458325 2:42082804-42082826 CACAGGATGGGGAGAAAGCCAGG - Intergenic
929468060 2:42163806-42163828 CAGAAAATGGGCAGAAACCCAGG + Intergenic
930511111 2:52346616-52346638 GAGAAAACGGGGAGGGAGCCAGG - Intergenic
931620942 2:64208688-64208710 CAGAACATGAGGAGGATGCAGGG - Intergenic
931828747 2:66028642-66028664 CAGAACTTTGGGAAGAGGCCTGG - Intergenic
932213832 2:69953371-69953393 CAGCACATGGGGTGGGTGCCTGG + Intergenic
932306401 2:70706570-70706592 CAGAGCCTGGGGAGGAGGGCAGG + Intronic
933112059 2:78414922-78414944 GGGAACATGGGAAGGAAGCAAGG + Intergenic
933278600 2:80307897-80307919 CAGCAAATGGGAAGGAAGTCTGG + Intronic
933545254 2:83702547-83702569 CAGGACTTTGTGAGGAAGCCTGG - Intergenic
933605206 2:84375447-84375469 CTGAACATGGAGAGTAAGCAAGG + Intergenic
934484036 2:94685153-94685175 CAGCACACTGGGAGGAAGGCAGG - Intergenic
934771975 2:96912951-96912973 GAGAACTGGGGGAGGAAGCTTGG + Intronic
934957340 2:98633380-98633402 CAGATCTCGGGGAGGGAGCCAGG - Intronic
935034726 2:99358580-99358602 CAGAAACTGAGGGGGAAGCCAGG - Intronic
935755533 2:106273543-106273565 CAGAAGGTGGTGAGGAGGCCTGG - Intergenic
935765785 2:106366600-106366622 CTGAACATGGGGTGCAGGCCTGG - Intergenic
937053474 2:118911303-118911325 CAGTTCATGGAGAGGAGGCCTGG + Intergenic
937286670 2:120758430-120758452 CCGGTCAGGGGGAGGAAGCCAGG - Intronic
937784402 2:125878286-125878308 AAGAAAATGGGGAGGAGGCTAGG + Intergenic
938227188 2:129626173-129626195 CAGCACATGGGCAGGAAGCATGG + Intergenic
938708673 2:133956412-133956434 CAGTACAGGGGGAGTAAGCTGGG - Intergenic
942286395 2:174421708-174421730 CAGAAAATGGGGAGGGAACCTGG - Intronic
944863525 2:203838663-203838685 CAGGAGATGGGGAGGAAGTTTGG + Intergenic
945128391 2:206539056-206539078 CAGTATATGAAGAGGAAGCCTGG + Intronic
946097485 2:217288000-217288022 GAGAACAGAGGGAGGAAGCAAGG + Intronic
946102060 2:217333967-217333989 GAGAACAGAGGGAGGAAGCAAGG + Intronic
947420942 2:229941158-229941180 TTGAAAATGGGGACGAAGCCGGG + Intronic
947990506 2:234484037-234484059 CAGAAGCTGGGGGAGAAGCCTGG + Intergenic
948560321 2:238847648-238847670 CAGAAGATGAGGACGCAGCCAGG - Intergenic
948769673 2:240244815-240244837 GAGAGCAGGGAGAGGAAGCCAGG - Intergenic
948877082 2:240835313-240835335 CGTAAAATGGGGAGGAGGCCTGG - Intergenic
948911889 2:241009035-241009057 CAGGACATGGGGATGGAGCTTGG + Intronic
1170128061 20:12987851-12987873 GAGTACAAGGGAAGGAAGCCTGG + Intergenic
1171428610 20:25064430-25064452 CAGAACAGAGGGCAGAAGCCAGG - Intergenic
1171950780 20:31419757-31419779 CAGAAGATGAAGAGGAAGCAAGG - Intergenic
1172764433 20:37343805-37343827 AAGAACAAGGCGAGGTAGCCAGG + Intergenic
1173551931 20:43938468-43938490 CAGGACATGGGGCAGGAGCCAGG - Intronic
1175456476 20:59118872-59118894 CAGATCATGGGGAGAAAGCTAGG - Intergenic
1175954966 20:62604556-62604578 CAGACCTTGGGGAGGAGGCCTGG - Intergenic
1177739318 21:25135230-25135252 GAGAACATGGGGAGGAAATCTGG + Intergenic
1177812497 21:25939232-25939254 CAGAACATGGGAAGGAAGCCAGG + Intronic
1179095478 21:38310846-38310868 CAAAACATGGAGAGGAAGCCAGG - Intergenic
1179149176 21:38795693-38795715 CAGACCATGGGGAAGAGGCGTGG - Intergenic
1179722330 21:43322815-43322837 GAGGAAATGGGGAGGCAGCCAGG + Intergenic
1180200463 21:46220911-46220933 CAGGGCTTGGGGAGGTAGCCAGG + Intronic
1180954375 22:19735094-19735116 GAGAACATGGGGAGGACTGCAGG - Intergenic
1181019867 22:20094092-20094114 CAGCACATAGGGAGGAAAGCGGG - Intronic
1181464175 22:23101958-23101980 CAGGCCATAGAGAGGAAGCCAGG - Intronic
1182978206 22:34643143-34643165 CAGCAGATGTGGAGGGAGCCAGG + Intergenic
1183165792 22:36146314-36146336 CCGTACATGGGGAGAAAGCATGG - Intronic
1183278083 22:36913864-36913886 CAGTGGATGGGGAGGCAGCCAGG + Intronic
1183396138 22:37571894-37571916 AAGAACATGGACATGAAGCCGGG - Exonic
1183686209 22:39362677-39362699 CAGGACAAGGGCAGGAAGGCTGG + Intronic
1184154151 22:42656144-42656166 GAGAACATGTGGAGGAAGAAGGG + Intergenic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1184727294 22:46354549-46354571 CAGAACATGAGCCGGCAGCCAGG - Intronic
1184974979 22:48054674-48054696 CAGAGCATCGGGAACAAGCCTGG + Intergenic
1185230068 22:49674922-49674944 CAGAAAGAGGAGAGGAAGCCAGG + Intergenic
1185323094 22:50210818-50210840 CAGAAGATGCGCAGGAAGCTGGG + Exonic
950145021 3:10642851-10642873 CAGTGTATGGGGAGGAAGCAGGG - Intronic
950479022 3:13233404-13233426 CAGAACAGGGGCCTGAAGCCAGG - Intergenic
950532389 3:13559850-13559872 CAGACCATGTGGAGCATGCCTGG + Intronic
950655436 3:14433448-14433470 CAGCTCATGGTGAGGAACCCAGG + Intronic
950967949 3:17159443-17159465 CAGAGGATGGCGAGGCAGCCGGG - Intronic
950969916 3:17176039-17176061 GAGAACATGGAGAGGCAGCCTGG + Intronic
951641320 3:24839405-24839427 AAAAAAATGGGAAGGAAGCCAGG + Intergenic
952718209 3:36503727-36503749 CACAAAATGGGCAGGAAGGCTGG - Intronic
952866034 3:37855707-37855729 TAGAAGATGGCTAGGAAGCCAGG + Intergenic
953203314 3:40797544-40797566 GAGAAAATGTGGAGGAAGCCAGG - Intergenic
954714681 3:52521182-52521204 CAGAACCTGGGGAGGAGTGCTGG + Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955498675 3:59562814-59562836 TGGAACATGGGGAGGTGGCCAGG - Intergenic
955711469 3:61783692-61783714 ATGAACAAGGGGTGGAAGCCAGG + Intronic
955940614 3:64143859-64143881 CATAACCTGGGCTGGAAGCCAGG + Intronic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
957292112 3:78291301-78291323 CAGAAGATGGGGAGAAAGGGTGG + Intergenic
957624181 3:82637746-82637768 TAGAACCTGGGGTTGAAGCCAGG - Intergenic
957804210 3:85125609-85125631 CAGCACTTTGGGAGGAGGCCAGG - Intronic
960084818 3:113579122-113579144 CAGAAACTGGGGAGGTAGCCAGG + Intronic
960529732 3:118749722-118749744 CTGAACATGGGGAGGGTTCCTGG + Intergenic
960733428 3:120750921-120750943 CAGGACATTTGAAGGAAGCCCGG - Exonic
961084761 3:124057370-124057392 CAGAACCAGAGGGGGAAGCCTGG + Intergenic
962684613 3:137835211-137835233 CTGACCAGAGGGAGGAAGCCCGG - Intergenic
963083784 3:141418223-141418245 TAGGAGATGGGGAGGAACCCTGG - Intronic
963341067 3:144034437-144034459 CAGAACTTGGGAAGGAAGTGTGG + Intronic
963934476 3:151038042-151038064 CAAAGCATGTGGAGAAAGCCAGG - Intergenic
964466734 3:157001009-157001031 CAGAAGATGAAGAGGAAGCAAGG - Intronic
964770262 3:160217783-160217805 CAGAAAATGGTGAGACAGCCTGG + Intergenic
965986117 3:174755211-174755233 CAGAAGATGAAGGGGAAGCCAGG - Intronic
966903915 3:184508167-184508189 CAGAAGGTGGAGAGGAAGCTTGG + Intronic
968698577 4:2044171-2044193 CAAAACAAGGGGAGGCAGGCAGG - Intergenic
970219483 4:13796154-13796176 CAGAACATGTGGATAAAGCTGGG + Intergenic
970348837 4:15180624-15180646 GAGAACAGGGTGAGGAAGGCTGG + Intergenic
971037419 4:22709283-22709305 GGGAAAATGGGGAGGGAGCCAGG + Intergenic
971943216 4:33241549-33241571 CTGAAAAGGGGGTGGAAGCCAGG - Intergenic
974079000 4:57194085-57194107 GAGAACTGGAGGAGGAAGCCAGG - Intergenic
976184805 4:82432628-82432650 CAAAACGTGGGGAAGAGGCCGGG - Intronic
977580451 4:98718981-98719003 CTGAACATGGAAAGGAAACCAGG + Intergenic
977593379 4:98851221-98851243 CAGAACTGGGTGAGGAAGACTGG + Intergenic
979258206 4:118625751-118625773 GAGAACTAGGGGAGGAGGCCAGG + Intergenic
979330143 4:119414817-119414839 GAGAACTAGGGGAGGAGGCCAGG - Intergenic
979811143 4:125037815-125037837 TAGCAAATGGGGAGGAAGCCGGG - Intergenic
981157967 4:141462347-141462369 CAGTGCATGGGGAAGAAACCAGG + Intergenic
981191600 4:141871460-141871482 CAGAAGATGAAGAGGAAGCAAGG + Intergenic
981462328 4:145028042-145028064 GAGAAAATGGGGAGGGAGCCAGG + Intronic
981721985 4:147811086-147811108 CTGAAAATGAAGAGGAAGCCAGG - Intronic
981724712 4:147834855-147834877 GAGAAAATGGGGAGGGAGCCAGG - Intronic
984683306 4:182636486-182636508 CAGCACTTTGGGAGGAGGCCAGG + Intronic
985089479 4:186348673-186348695 CAGAAGCTGGGGAGGGAGCCTGG - Intergenic
985368904 4:189264070-189264092 CAGTAAATGGGGATGAAGTCAGG + Intergenic
985813730 5:2111154-2111176 CAGCACAGGGGGAGGAACTCTGG - Intergenic
985933731 5:3079202-3079224 CAGGGCAGGAGGAGGAAGCCTGG - Intergenic
986219942 5:5759049-5759071 CAGAACATGGTCAGGAACGCTGG - Intergenic
986304631 5:6506233-6506255 CTGAACATGGGGTGGAAGTGCGG + Intergenic
991559534 5:67934922-67934944 GGGAACATGGGAAGGGAGCCAGG + Intergenic
991713633 5:69431798-69431820 AAGAAAATGGGGAGGAAGACAGG - Intronic
992732132 5:79682531-79682553 CAGCACTTTGGGAGGAAGACGGG - Intronic
995988801 5:118210559-118210581 CAGAAGATTTGGAGGAAGTCAGG + Intergenic
996483866 5:124007513-124007535 CATAACTTGGGGAGACAGCCAGG + Intergenic
996522149 5:124438980-124439002 CAGAACAATGGGGGGAAACCAGG + Intergenic
997512034 5:134460686-134460708 CAGGACATGGGGTGGAAGGATGG - Intergenic
998174680 5:139894522-139894544 CAGGCCATGGGTAGGATGCCTGG - Intronic
1000052536 5:157575435-157575457 CAGAACGTGGGAACAAAGCCCGG + Intronic
1000097770 5:157986419-157986441 CAGCACAAGTGGAGGAAGCCAGG + Intergenic
1002311003 5:178313734-178313756 CAGAACTTTGGGAGGAAGTGGGG + Intronic
1003019310 6:2496230-2496252 CAGCACGAGGGGAGGAACCCAGG + Intergenic
1004594654 6:17087666-17087688 CAGAACTTGGCGTGGAACCCAGG + Intergenic
1006295137 6:33166895-33166917 GAGGACATGGAGAGGGAGCCGGG + Intronic
1006870501 6:37246923-37246945 CAGAAGATGGGGAGACAGCCAGG + Intronic
1007168138 6:39842826-39842848 GAGAAGAGGGGGAGGAAGCAGGG + Intronic
1007183095 6:39944905-39944927 CAGAAGATGGAGGGGAGGCCTGG - Intergenic
1007784598 6:44272399-44272421 CAGAACATGGGGAATGAGACTGG + Intronic
1008015260 6:46511436-46511458 CAGACCATTGGGATGTAGCCAGG + Intergenic
1009464767 6:63955214-63955236 CAGAAGATAGGGATGAAGGCTGG - Intronic
1010370679 6:75103476-75103498 CAGAACATGGGGAAGCAGAGGGG - Intronic
1012551834 6:100470149-100470171 CAAAAAAGGGAGAGGAAGCCGGG + Intergenic
1015551299 6:134414809-134414831 CAGAACCTGGGGAGGGTCCCTGG - Intergenic
1016014984 6:139174515-139174537 GACAACATGGAGAGGCAGCCAGG - Exonic
1016227563 6:141758627-141758649 CATCACATGGTGAGGAAGCATGG - Intergenic
1017197427 6:151716807-151716829 CAGAAAAGGGGGCTGAAGCCAGG - Intronic
1018142563 6:160853809-160853831 GAGAAGACGGTGAGGAAGCCAGG - Intergenic
1018903879 6:168064171-168064193 CACAGCACTGGGAGGAAGCCTGG + Intronic
1019083996 6:169457053-169457075 CAGAACCTAGGGAAGAGGCCAGG + Intergenic
1019672745 7:2290875-2290897 GAGAACAGGAGGAGGAACCCAGG + Intronic
1019722673 7:2582676-2582698 CAGAACACGGGGCGGAAGGCAGG - Intronic
1020519607 7:9169365-9169387 CTGGAAATGGGGTGGAAGCCAGG - Intergenic
1023082106 7:36535610-36535632 TAGACTATGGAGAGGAAGCCAGG - Intronic
1024628026 7:51225058-51225080 CAGACAATGGGGAACAAGCCTGG - Intronic
1024982461 7:55169066-55169088 CAGACGAGGGGGAGGAACCCTGG + Intronic
1025624265 7:63205456-63205478 CTGAACATGGGGTTGGAGCCTGG + Intergenic
1026106973 7:67429134-67429156 CAGAACATGGCTATGAAGCAGGG + Intergenic
1026152414 7:67799473-67799495 CTGATCAGGGGGAGAAAGCCAGG - Intergenic
1027203661 7:76080126-76080148 GAGAAGTTGGGGAGGAGGCCAGG - Intergenic
1027426038 7:78062293-78062315 CAGAACATGGGGAGGCATGTGGG + Intronic
1028879467 7:95863820-95863842 CAGAACATGTGGAGAAAGCCAGG + Intronic
1029465120 7:100720611-100720633 CAGAGCAGGGGCAGGACGCCTGG - Intergenic
1030952442 7:115808142-115808164 CAGAATATGGGATGGGAGCCAGG - Intergenic
1032524028 7:132565704-132565726 CAGAGCTTTGGGAGGAAGACAGG - Intronic
1033208099 7:139439634-139439656 CAGAAATTGGGGAGGAAGCAGGG - Intergenic
1034690746 7:153011680-153011702 CAGAGCTTGGGCAGGAAGCCAGG + Intergenic
1034909679 7:154985444-154985466 CAGAACGTGGTGAGGACGGCAGG - Intronic
1035459735 7:159031416-159031438 GAGTCCCTGGGGAGGAAGCCCGG - Intronic
1036286064 8:7445070-7445092 CATCCCATGGGGAGGAATCCTGG + Intronic
1036335409 8:7866459-7866481 CATCCCATGGGGAGGAATCCTGG - Intronic
1036379688 8:8228557-8228579 CAGGAGATCGGGCGGAAGCCGGG - Intergenic
1036652431 8:10653974-10653996 CAGCAGCTGGGGAGGGAGCCTGG + Intronic
1036784556 8:11677305-11677327 AAGAAAGTGGGAAGGAAGCCCGG - Intronic
1037729677 8:21513931-21513953 CAGAAAATGGGGAGGGGCCCAGG + Intergenic
1038715101 8:29984461-29984483 CAGGACATTGGGTGGAAGACAGG - Intergenic
1041838355 8:62242213-62242235 CAGAAAAGGGGGCTGAAGCCAGG - Intergenic
1044173123 8:89081729-89081751 AAGGAAATGGGGAGGAAGTCAGG - Intergenic
1044946701 8:97396294-97396316 CAGAAGATGGGGAGGGAAGCGGG - Intergenic
1047225450 8:122952478-122952500 CAGAAGAGGTGGAGGAGGCCCGG + Exonic
1047761241 8:127956069-127956091 CAGAGCTTGGGGAGGTAGACAGG + Intergenic
1049212644 8:141393747-141393769 CAGAACATGGTGAGGGTGGCTGG + Intronic
1049239862 8:141531838-141531860 CAGAGCAGGGGCAGGAAGGCAGG + Intergenic
1049332707 8:142063677-142063699 CAGAACATGGACTGGAACCCTGG - Intergenic
1050519616 9:6483982-6484004 CAGAAAATGATGATGAAGCCGGG - Intronic
1050773039 9:9227427-9227449 CAAAACAGTAGGAGGAAGCCAGG - Intronic
1052512725 9:29441880-29441902 GAGAAACTGGGGAGGAAGCCTGG + Intergenic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053142745 9:35691172-35691194 GAGAACAAGCGGAGGAAGCCGGG + Intergenic
1053157362 9:35790918-35790940 CAGATGGTGCGGAGGAAGCCGGG + Intergenic
1053673749 9:40399237-40399259 CAGCACACTGGGAGGAAGGCAGG + Intergenic
1053923551 9:43025597-43025619 CAGCACACTGGGAGGAAGGCAGG + Intergenic
1054074991 9:60520495-60520517 CAGAACACTGGGATGAAGGCCGG - Intergenic
1054384854 9:64539302-64539324 CAGCACACTGGGAGGAAGGCAGG + Intergenic
1054510878 9:65977053-65977075 CAGCACACTGGGAGGAAGGCAGG - Intergenic
1054602580 9:67141382-67141404 CTGACTATGGGGAGGAAGACGGG + Intergenic
1056570020 9:87806708-87806730 CAGTGCCTGCGGAGGAAGCCAGG - Intergenic
1056765335 9:89441568-89441590 CAGACCATGGGAAGGAAGTGAGG + Intronic
1056779585 9:89539175-89539197 CAGAGCAAGGAGAGGCAGCCAGG - Intergenic
1057054307 9:91949474-91949496 AAGACCTCGGGGAGGAAGCCCGG + Intronic
1057250823 9:93500259-93500281 CAGATGATGGGGAGGAAGCAAGG - Intronic
1057848893 9:98549239-98549261 CAAAACATGGAAAAGAAGCCAGG - Intronic
1058128573 9:101224278-101224300 CAGAAAATAGGGGGGATGCCAGG + Intronic
1060070683 9:120544468-120544490 CATAACCTGGAGAAGAAGCCTGG + Intronic
1060759218 9:126234279-126234301 CAGAGCATGGAGGGGCAGCCAGG + Intergenic
1061144702 9:128790848-128790870 CAGAACAGGAGGAAGAAGCCAGG - Intronic
1061410358 9:130417703-130417725 CAGAACCTCTGGAGGAAGCAGGG + Intronic
1061543573 9:131290936-131290958 CAGACCCTGGGGAAGAAGCCTGG - Intronic
1061617043 9:131787194-131787216 CAGACCTTGGGGAGGGACCCGGG + Intergenic
1062263175 9:135673440-135673462 CAGAAGCTGGGGAGGCAGCAAGG - Intergenic
1062353665 9:136151949-136151971 CAGCGCTTGGGGAGGAACCCTGG + Intergenic
1062425288 9:136503434-136503456 CAGGACATGGTGAGGCAGCCTGG + Intronic
1187267237 X:17746797-17746819 CAGTGCATGGGGAGGCAGGCTGG - Intronic
1187740397 X:22349270-22349292 AAGGACATGGGAAGGGAGCCAGG + Intergenic
1188148028 X:26638491-26638513 CAGAAGGTGAGGAGGAAGCAAGG + Intergenic
1189214566 X:39311896-39311918 GAGGGCATGGGTAGGAAGCCTGG + Intergenic
1189892436 X:45618142-45618164 CAGAAGATGAAGAGGAAGCAAGG - Intergenic
1190062716 X:47221538-47221560 TGGAGGATGGGGAGGAAGCCAGG - Intronic
1190597555 X:52063573-52063595 CAGGACTTGAGGAGGATGCCTGG - Intronic
1190611269 X:52190500-52190522 CAGGACTTGAGGAGGATGCCTGG + Intronic
1192156967 X:68753876-68753898 CAGAACCTGGGCAGGATGCGTGG - Intergenic
1192501740 X:71658682-71658704 CAGAATATGGTGGGGAATCCTGG - Intergenic
1193721256 X:84990187-84990209 CAGAAAATGGGAAGGGAGCTGGG + Intergenic
1196055720 X:111352593-111352615 CAGAGCCTGGGAAGGATGCCAGG - Intronic
1197067572 X:122252211-122252233 CAGACCATGAGGAGGTATCCTGG + Intergenic
1197936313 X:131743330-131743352 GGGAACCTGGGGAGGAAGTCAGG - Intergenic
1198716458 X:139562777-139562799 CAGAACATAGGGATGAAGTAAGG + Exonic
1199072066 X:143488792-143488814 CAGAACATTGTAAGGAATCCTGG + Intergenic
1199320055 X:146427370-146427392 CAGAAAAGGAGGAGGAGGCCGGG - Intergenic
1199500927 X:148504822-148504844 CAGAACAGGAGGAGGCAGCCGGG - Intronic
1200571764 Y:4840886-4840908 CAGAAGATGAGGGGGAAGCAAGG + Intergenic
1200758139 Y:7011038-7011060 CAGAACTTGTGGAAGAAGCTTGG + Intronic