ID: 918158612

View in Genome Browser
Species Human (GRCh38)
Location 1:181875331-181875353
Sequence GAGCAAAAATTGGCATTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918158610_918158612 -2 Left 918158610 1:181875310-181875332 CCTACATCAAAAAGGCTGAAAGA 0: 8
1: 569
2: 733
3: 1157
4: 2311
Right 918158612 1:181875331-181875353 GAGCAAAAATTGGCATTCTAAGG No data
918158608_918158612 7 Left 918158608 1:181875301-181875323 CCATAAACACCTACATCAAAAAG 0: 83
1: 129
2: 332
3: 318
4: 526
Right 918158612 1:181875331-181875353 GAGCAAAAATTGGCATTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918158612 Original CRISPR GAGCAAAAATTGGCATTCTA AGG Intergenic
No off target data available for this crispr