ID: 918163731

View in Genome Browser
Species Human (GRCh38)
Location 1:181924862-181924884
Sequence GAGAGTGGCAAAAGTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918163731_918163744 22 Left 918163731 1:181924862-181924884 CCCTCCACACTTTTGCCACTCTC No data
Right 918163744 1:181924907-181924929 CCTGCCTCATTACCTGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918163731 Original CRISPR GAGAGTGGCAAAAGTGTGGA GGG (reversed) Intergenic
No off target data available for this crispr