ID: 918165055

View in Genome Browser
Species Human (GRCh38)
Location 1:181937051-181937073
Sequence CTGTGTAAGTTCAGCTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918165052_918165055 27 Left 918165052 1:181937001-181937023 CCTTTAATCACTATTAAAAAAAA No data
Right 918165055 1:181937051-181937073 CTGTGTAAGTTCAGCTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918165055 Original CRISPR CTGTGTAAGTTCAGCTCTCT GGG Intergenic
No off target data available for this crispr