ID: 918167205

View in Genome Browser
Species Human (GRCh38)
Location 1:181961571-181961593
Sequence CTATCTATAAGCCCCTGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918167187_918167205 27 Left 918167187 1:181961521-181961543 CCCACAGCCACCCCTTCCCCCAG No data
Right 918167205 1:181961571-181961593 CTATCTATAAGCCCCTGACTGGG No data
918167193_918167205 15 Left 918167193 1:181961533-181961555 CCTTCCCCCAGGTGCTCTGTCCC No data
Right 918167205 1:181961571-181961593 CTATCTATAAGCCCCTGACTGGG No data
918167190_918167205 20 Left 918167190 1:181961528-181961550 CCACCCCTTCCCCCAGGTGCTCT No data
Right 918167205 1:181961571-181961593 CTATCTATAAGCCCCTGACTGGG No data
918167199_918167205 8 Left 918167199 1:181961540-181961562 CCAGGTGCTCTGTCCCAGGGAGA No data
Right 918167205 1:181961571-181961593 CTATCTATAAGCCCCTGACTGGG No data
918167191_918167205 17 Left 918167191 1:181961531-181961553 CCCCTTCCCCCAGGTGCTCTGTC No data
Right 918167205 1:181961571-181961593 CTATCTATAAGCCCCTGACTGGG No data
918167192_918167205 16 Left 918167192 1:181961532-181961554 CCCTTCCCCCAGGTGCTCTGTCC No data
Right 918167205 1:181961571-181961593 CTATCTATAAGCCCCTGACTGGG No data
918167188_918167205 26 Left 918167188 1:181961522-181961544 CCACAGCCACCCCTTCCCCCAGG No data
Right 918167205 1:181961571-181961593 CTATCTATAAGCCCCTGACTGGG No data
918167197_918167205 10 Left 918167197 1:181961538-181961560 CCCCAGGTGCTCTGTCCCAGGGA No data
Right 918167205 1:181961571-181961593 CTATCTATAAGCCCCTGACTGGG No data
918167202_918167205 -5 Left 918167202 1:181961553-181961575 CCCAGGGAGATGGGAATTCTATC No data
Right 918167205 1:181961571-181961593 CTATCTATAAGCCCCTGACTGGG No data
918167203_918167205 -6 Left 918167203 1:181961554-181961576 CCAGGGAGATGGGAATTCTATCT No data
Right 918167205 1:181961571-181961593 CTATCTATAAGCCCCTGACTGGG No data
918167195_918167205 11 Left 918167195 1:181961537-181961559 CCCCCAGGTGCTCTGTCCCAGGG No data
Right 918167205 1:181961571-181961593 CTATCTATAAGCCCCTGACTGGG No data
918167198_918167205 9 Left 918167198 1:181961539-181961561 CCCAGGTGCTCTGTCCCAGGGAG No data
Right 918167205 1:181961571-181961593 CTATCTATAAGCCCCTGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918167205 Original CRISPR CTATCTATAAGCCCCTGACT GGG Intergenic