ID: 918171542

View in Genome Browser
Species Human (GRCh38)
Location 1:182002859-182002881
Sequence TCTGGCGCCCAGGAAGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918171530_918171542 24 Left 918171530 1:182002812-182002834 CCTGCAGCAGCATCCAAGCCCCT No data
Right 918171542 1:182002859-182002881 TCTGGCGCCCAGGAAGAATCAGG No data
918171537_918171542 -1 Left 918171537 1:182002837-182002859 CCTCTTGGCACCCGAGTTCTTGT No data
Right 918171542 1:182002859-182002881 TCTGGCGCCCAGGAAGAATCAGG No data
918171534_918171542 5 Left 918171534 1:182002831-182002853 CCCTGCCCTCTTGGCACCCGAGT No data
Right 918171542 1:182002859-182002881 TCTGGCGCCCAGGAAGAATCAGG No data
918171536_918171542 0 Left 918171536 1:182002836-182002858 CCCTCTTGGCACCCGAGTTCTTG No data
Right 918171542 1:182002859-182002881 TCTGGCGCCCAGGAAGAATCAGG No data
918171533_918171542 6 Left 918171533 1:182002830-182002852 CCCCTGCCCTCTTGGCACCCGAG No data
Right 918171542 1:182002859-182002881 TCTGGCGCCCAGGAAGAATCAGG No data
918171535_918171542 4 Left 918171535 1:182002832-182002854 CCTGCCCTCTTGGCACCCGAGTT No data
Right 918171542 1:182002859-182002881 TCTGGCGCCCAGGAAGAATCAGG No data
918171532_918171542 11 Left 918171532 1:182002825-182002847 CCAAGCCCCTGCCCTCTTGGCAC No data
Right 918171542 1:182002859-182002881 TCTGGCGCCCAGGAAGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918171542 Original CRISPR TCTGGCGCCCAGGAAGAATC AGG Intergenic
No off target data available for this crispr