ID: 918177819

View in Genome Browser
Species Human (GRCh38)
Location 1:182060780-182060802
Sequence CAGGGACAGCAAAGGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 381}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918177808_918177819 12 Left 918177808 1:182060745-182060767 CCAGCAGGCTTGATCCGGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 124
Right 918177819 1:182060780-182060802 CAGGGACAGCAAAGGGATGCTGG 0: 1
1: 0
2: 2
3: 47
4: 381
918177810_918177819 -2 Left 918177810 1:182060759-182060781 CCGGGGCTGTAGGTCCCCCAGCA 0: 1
1: 0
2: 2
3: 18
4: 179
Right 918177819 1:182060780-182060802 CAGGGACAGCAAAGGGATGCTGG 0: 1
1: 0
2: 2
3: 47
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918177819 Original CRISPR CAGGGACAGCAAAGGGATGC TGG Intronic
900000404 1:11791-11813 CAGGAACAGCAAAGGAAATCCGG - Intergenic
900020118 1:182310-182332 CAGGAACAGCAAAGGAAATCCGG - Intergenic
900270576 1:1785216-1785238 CAGGGACAGCTTAGGGAAGCGGG + Intergenic
900536970 1:3183516-3183538 CAGGGACAGCAAAATGAGACGGG + Intronic
900890697 1:5447752-5447774 AAGGGACAGGACAGGGGTGCAGG + Intergenic
901403863 1:9032949-9032971 CAGGAATAGCAAAGGGAGGAAGG + Intergenic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902279825 1:15366336-15366358 CTGCGACAGCACAGGGAAGCAGG - Intronic
903123884 1:21234832-21234854 CAGGGACAGGACATGGATCCTGG + Intronic
904374329 1:30070439-30070461 CTGGGACAGCAAGGGCAGGCTGG - Intergenic
904821005 1:33244316-33244338 CACAGACAACAAAGGGATCCTGG - Intergenic
905016208 1:34780641-34780663 CAGGGACTCCCAAGGGAGGCTGG + Intronic
905033360 1:34902250-34902272 CAGGGACAGCATAGGGTTCAGGG + Intronic
905124146 1:35705532-35705554 CAGGGGCAGCTAAGGGATACAGG - Intergenic
905248574 1:36631428-36631450 CAGAGAAAGCAAAGGGATGTAGG - Intergenic
906517246 1:46446989-46447011 CCGCGCCAGCAATGGGATGCAGG - Intergenic
907265959 1:53261434-53261456 GAGGGAAAGCAAAGGGATGATGG - Intronic
907342666 1:53747991-53748013 CAGGGAGACCAATGGGAAGCTGG - Intergenic
907552767 1:55318423-55318445 CAAGGAGAGGAAAGGGAAGCGGG - Intergenic
908007964 1:59746171-59746193 CAGTGACAGCAGTGAGATGCAGG + Intronic
908280589 1:62530797-62530819 CAGTTACGGCACAGGGATGCAGG - Intronic
910182119 1:84496445-84496467 CAGGAATAGCTAATGGATGCTGG + Intronic
910438837 1:87231749-87231771 TGGGGACAGCAAAGGGGTGAGGG - Intergenic
910982914 1:92976588-92976610 CAGGAACACCAAAGGGAATCTGG - Intergenic
913674064 1:121124981-121125003 CATGGATGGCAAAGAGATGCAGG - Intergenic
914025848 1:143912302-143912324 CATGGATGGCAAAGAGATGCAGG - Intergenic
914664283 1:149820023-149820045 CATGGATGGCAAAGAGATGCAGG - Intergenic
914671479 1:149873812-149873834 CATGGATGGCAAAGAGATGCAGG + Intronic
915169778 1:153969509-153969531 CAGACAGAGCAAAGGGATGAGGG + Intronic
915244234 1:154544860-154544882 CAGAGACTGCACAGGGATGGTGG - Exonic
915489047 1:156241469-156241491 CAGGCACAGGGAAGGGAGGCAGG - Intronic
916183293 1:162106273-162106295 CACAGACAGCAAAGAGAAGCAGG - Intronic
916192915 1:162196636-162196658 CAGAAACAGGAAAGAGATGCTGG + Intronic
916846331 1:168654372-168654394 CAGCCACAGCTAAGGAATGCCGG - Intergenic
917336126 1:173926086-173926108 GAGAAACAGCAAAGGGAGGCTGG + Intergenic
918177819 1:182060780-182060802 CAGGGACAGCAAAGGGATGCTGG + Intronic
920581156 1:207109129-207109151 CATGCACAGCAGAGGAATGCTGG - Intronic
922694687 1:227723487-227723509 CAGGTCCAGCCAATGGATGCAGG - Intergenic
922703711 1:227777788-227777810 CTGGGACATCCAAGGGAGGCTGG - Intronic
922806194 1:228391318-228391340 CAGGGAAAGCACAGGGATCCGGG + Intergenic
923166591 1:231369760-231369782 CAGATACAGCAAATGAATGCCGG + Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923234408 1:232018820-232018842 CAGGGACAGCCATGGGGTCCTGG - Intronic
924737211 1:246768990-246769012 CAGGGCCAGCAAAGGCATCACGG - Intergenic
1063517644 10:6712304-6712326 CAGGGAGGGGAAAGGGGTGCTGG + Intergenic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1065933272 10:30497971-30497993 CAGGGAAAGCAAGGGAAGGCAGG - Intergenic
1066654131 10:37683362-37683384 CTGGGACAACATAGGGAAGCAGG + Intergenic
1067238924 10:44474146-44474168 CAGGGACTGCTAATGGATACAGG + Intergenic
1069635533 10:69922705-69922727 CAGGGAGAGAAAGGCGATGCTGG + Exonic
1069749676 10:70737194-70737216 CAGAGACAGCATAGGGGTGGGGG - Intronic
1070850453 10:79558606-79558628 GAGGGACAGCACTGGGAGGCAGG - Intronic
1070856766 10:79612690-79612712 GAGGGACAGCACTGGGAGGCAGG + Intronic
1071439348 10:85676633-85676655 CTAGAACAGCAAAGGGAAGCTGG + Intronic
1071464999 10:85931694-85931716 AAGGGATACCAAAGGGATCCAGG - Intronic
1072021625 10:91409470-91409492 AGGAGACAGCAAAGGGTTGCGGG + Intergenic
1072711045 10:97715613-97715635 CCGGGACAGCACAGGGATGCTGG - Exonic
1072758235 10:98035332-98035354 CAGCCCCAGGAAAGGGATGCTGG + Intergenic
1073122890 10:101132897-101132919 CAGGGCCAGCAGAGGAAGGCGGG - Intronic
1074116308 10:110459770-110459792 CAGGGAATGCACAGGGTTGCCGG + Intergenic
1075668268 10:124245831-124245853 CAGGGACTGCAGGAGGATGCTGG + Intergenic
1076166860 10:128289355-128289377 CATGGACAGCAAACTGATTCAGG - Intergenic
1076426627 10:130371708-130371730 CTGTGACAGGAAAGGGAAGCTGG + Intergenic
1076534312 10:131167153-131167175 CAGGCACAGGAGAGGGATGCCGG - Intronic
1076620071 10:131781341-131781363 CAGGCACAACAGAGGGATGCAGG + Intergenic
1076865873 10:133166070-133166092 CAGGCACAGGAAAGGGATGAAGG - Intronic
1076889787 10:133277766-133277788 CAGGGCCAGCAAGGGGCTGGAGG + Intergenic
1077023621 11:430449-430471 GAGGGACAGGAAAGGGATGGGGG + Intronic
1077287269 11:1773128-1773150 CAGGGAGGGGAAAGGGGTGCTGG + Intergenic
1078011282 11:7574971-7574993 AAGGGACAGAAAAGGGAGGAAGG - Intronic
1078079851 11:8196037-8196059 CAAGGAAAGCAAATGGAAGCAGG + Intergenic
1078468970 11:11571890-11571912 GAGGGACAGGAAAGGGACTCTGG - Intronic
1078580407 11:12535324-12535346 AAAGCACACCAAAGGGATGCTGG - Intergenic
1079324348 11:19478776-19478798 TTGGGACAGCAGAGAGATGCTGG - Intronic
1081794616 11:45810953-45810975 CAGGGGCAGGAAGAGGATGCAGG - Exonic
1082142204 11:48622383-48622405 GAGTGCCAGCAAAGGGATGGTGG + Intergenic
1084164003 11:67366751-67366773 CAGGGAAAGAAAAGGGAGGAGGG - Intronic
1084357886 11:68651721-68651743 CAGGGACCGCAGAGGGAGGGAGG + Intergenic
1084477197 11:69395748-69395770 CAGGCCCAGCCAGGGGATGCTGG - Intergenic
1084613107 11:70216739-70216761 AAGTGAAAGCAAAGGGAGGCTGG + Intergenic
1084768229 11:71326071-71326093 CAGCCACAGCAAAGGAATACAGG + Intergenic
1085186392 11:74579411-74579433 CAGGGACAGCAGAGGGGTGGTGG + Intronic
1086843379 11:91717478-91717500 CATAGACACCAAAGAGATGCGGG - Intergenic
1087065833 11:94027102-94027124 CAGCCACAGCCAAGGAATGCTGG - Intronic
1087224463 11:95582445-95582467 CAGGGAAAGCAAAGAGCTGAAGG - Intergenic
1088072932 11:105812184-105812206 CAGAGAAAACAAAGGAATGCTGG - Intronic
1089618819 11:119710677-119710699 CAGGAACAGCAAAGGCATGGTGG + Intronic
1090228314 11:125084771-125084793 CCAGGCCAGCAAAGGGATTCCGG + Intronic
1090387004 11:126363189-126363211 CAGGGACAGGAAGGAGATGGGGG - Intronic
1090859813 11:130643044-130643066 CAGGGGCAGCCAGGTGATGCAGG - Intergenic
1091297702 11:134485534-134485556 CAGGGGCAGCAGAAGGATGTGGG + Intergenic
1091373495 12:11922-11944 CAGGAACAGCAAAGGAAATCCGG - Intergenic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1091596281 12:1881120-1881142 CAGGGACAGGAGAGGGAAGGAGG + Intronic
1091829344 12:3538559-3538581 GAGTGACAGCTAAGGGGTGCTGG + Intronic
1091973920 12:4810096-4810118 GAGGGAGAGCAACAGGATGCGGG + Exonic
1092431783 12:8415653-8415675 CAGGGACAGCAAAGTGAGGACGG + Intergenic
1092434734 12:8438273-8438295 CAGGGACAGCAAAGTGAGGACGG + Intergenic
1095821196 12:46480347-46480369 CAGGCCCAGCAAATGGAAGCTGG - Intergenic
1096595176 12:52690601-52690623 CAGGTACAGCAAAGGGAGCTTGG + Exonic
1096621611 12:52869102-52869124 CAGTGACAGCACAGGGAAGTAGG - Intergenic
1097008884 12:55938530-55938552 CACGGACAGAAATGGGATCCTGG + Exonic
1097173940 12:57132138-57132160 CTGGGACAGAAGAGGGAGGCAGG - Intronic
1097187327 12:57202820-57202842 GAGGCACAGCACAGGGATGGGGG - Intronic
1097245483 12:57605318-57605340 CTGGCACAGAAAAGGGAGGCGGG - Intronic
1099497136 12:83363128-83363150 CAGGAACAGCAAAGAGTAGCGGG + Intergenic
1099533047 12:83810417-83810439 GAGGCAAAGCCAAGGGATGCAGG + Intergenic
1101252101 12:102946557-102946579 AAGGGACAGCAAAGGGATTGTGG - Intronic
1102744093 12:115234338-115234360 CAGCAAGAGCAAAGGAATGCAGG + Intergenic
1102854795 12:116284187-116284209 CAGGGAAAGCAAATGCAGGCTGG - Intergenic
1103173416 12:118841906-118841928 CCAGGCCAGCAGAGGGATGCTGG + Intergenic
1103584539 12:121942231-121942253 CAGAGACAGATAATGGATGCAGG - Intronic
1104022758 12:125004706-125004728 CTGGGACAGAAAAGGGTGGCAGG - Intronic
1104201178 12:126590903-126590925 CATGAACAGCAAATGGAGGCAGG - Intergenic
1104272471 12:127294367-127294389 CAGGTACAGCATAGTGCTGCGGG + Intergenic
1104588509 12:130066267-130066289 CAGGGACAGGATAAGGATGGGGG + Intergenic
1104715469 12:131013317-131013339 CAGCAACAGCAATGGGATGCTGG - Intronic
1105070732 12:133232949-133232971 CAGGGACAGAAAAGGGGTAACGG + Intronic
1106190961 13:27452091-27452113 GACGGACTGCAAATGGATGCTGG - Intergenic
1107018925 13:35731734-35731756 CAGAGACAGGTAAGGGATGCAGG - Intergenic
1107686333 13:42903430-42903452 GAGGGAGAGCTAATGGATGCTGG + Intronic
1108889907 13:55244579-55244601 GAGGGACAGCAAAGTGATTGTGG + Intergenic
1111791250 13:92858316-92858338 AAGGAAGAGCAAAGGGATGGTGG - Intronic
1113728316 13:112622358-112622380 CAGGGACAGCTAGGGGAGGCAGG - Intergenic
1114715160 14:24816813-24816835 CAGGGACAGGGAAGGAATGGAGG - Intronic
1116101459 14:40442526-40442548 CAAGGACAGCAAAGAAATCCTGG + Intergenic
1116534603 14:46014847-46014869 AAGTGAAAGCAAAGGGAGGCTGG + Intergenic
1117152155 14:52900749-52900771 ATGGAACAGGAAAGGGATGCTGG - Intronic
1118458274 14:65964564-65964586 CAGGGGAAGCCAAGGAATGCTGG + Intronic
1118701628 14:68439254-68439276 TGGGGACAGCAAAGGGATCGTGG - Intronic
1119381562 14:74232710-74232732 CAAGGAAAGGAAAGGGATGTGGG - Intergenic
1119619082 14:76118209-76118231 TGGGGCCAGCAAAGGGATGCAGG + Intergenic
1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG + Intronic
1120519879 14:85514100-85514122 CATGTACAGCTAAGGGACGCAGG + Intergenic
1120844710 14:89115674-89115696 CACAGAGAGCAAACGGATGCTGG + Intergenic
1121706683 14:96001700-96001722 CACGGAGAGCAAAGAGAAGCAGG + Intergenic
1123028084 14:105438032-105438054 CAGGGACAGCAACAGGCAGCAGG - Intronic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1124243659 15:28052152-28052174 CAGGGACAGCAAAGCTGAGCTGG - Intronic
1124453985 15:29823230-29823252 GAGGGACAGCATTGGAATGCAGG - Intronic
1124515163 15:30361612-30361634 CAAGGAGATCAAAGGGACGCAGG - Exonic
1124727759 15:32169115-32169137 CAAGGAGATCAAAGGGACGCAGG + Intronic
1125584510 15:40810538-40810560 CAGGGAAAGGAGAGGGATCCAGG - Intronic
1125995378 15:44154791-44154813 TAGTGACAGCTAAGGGGTGCAGG + Intronic
1126644205 15:50858901-50858923 CAAGGACTGCAAATGGAAGCTGG - Intergenic
1126742979 15:51796963-51796985 CAGGGACAGCACGGAGATGCTGG + Intronic
1126786504 15:52181153-52181175 CCGGGACAGCAAGTGGAGGCTGG - Intronic
1127127032 15:55821704-55821726 CAAGAACAGCTAATGGATGCTGG - Intergenic
1127249342 15:57214118-57214140 AAGGGACAGCCAAGAGATGCAGG + Intronic
1128234807 15:66060073-66060095 GATGGACAGCAGAGGGATGAAGG + Intronic
1128339103 15:66808201-66808223 CAGGGACAGGGAGGGGAGGCGGG - Intergenic
1128635320 15:69298995-69299017 CGGGGACAGCACAGGCAGGCCGG - Exonic
1129652610 15:77501947-77501969 CTGGGCCTGGAAAGGGATGCTGG - Intergenic
1129674146 15:77623269-77623291 CAGTGAGAGCAAAGGTGTGCAGG + Intronic
1131123845 15:89841414-89841436 CAGGGAGAGGACAGGGAAGCTGG + Intronic
1131217447 15:90550750-90550772 CATGGAAAGCAAAGGGGTTCTGG - Intronic
1131476868 15:92747276-92747298 CAGGGAATGCCAAGGGCTGCTGG - Intronic
1132146235 15:99431655-99431677 TGGGGACAGCACAAGGATGCTGG + Intergenic
1132453103 15:101979154-101979176 CAGGAACAGCAAAGGAAATCCGG + Intergenic
1132453791 16:11472-11494 CAGGAACAGCAAAGGAAATCCGG - Intergenic
1132931108 16:2459715-2459737 CAGGGACAGGACGGGGTTGCTGG - Intergenic
1133341045 16:5036264-5036286 CAGGGACCTCAAAGGGGTCCCGG + Intronic
1133739446 16:8640505-8640527 AAGGGACAGAAAATGGATGATGG + Intronic
1134176465 16:12010821-12010843 CAGGAACAACAAAGGGCAGCTGG - Intronic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1136186377 16:28591098-28591120 CAGGGCTGGCAAAGGGATGGTGG - Intronic
1136536545 16:30902970-30902992 CAGGCAAAGCAAAGAGAGGCTGG - Exonic
1137955375 16:52824190-52824212 AAGGAATAGCTAAGGGATGCTGG + Intergenic
1138647962 16:58438933-58438955 GAGGGATAGAAAACGGATGCGGG - Intergenic
1143879952 17:10022447-10022469 CATGGTCAGAAAAGGGGTGCAGG + Intronic
1144376614 17:14649070-14649092 CTGGGACAGCACAGGGTTGCTGG + Intergenic
1144668087 17:17115656-17115678 CGGTGGCAGCTAAGGGATGCAGG - Intronic
1147235861 17:39057045-39057067 CAGGCTCAGCGAAGGGAGGCTGG + Intergenic
1147330417 17:39696037-39696059 CAGGGAAGGGAAAGGGGTGCTGG - Intronic
1147341428 17:39755020-39755042 CTGGGAGAGGAAAGGGAGGCCGG - Intergenic
1148148958 17:45384870-45384892 CACGGACAGCAGAGGCATCCCGG + Intergenic
1148208089 17:45792120-45792142 CACGGGCAGCTGAGGGATGCCGG - Intronic
1148776620 17:50099293-50099315 CTGGGAGAGCTGAGGGATGCAGG + Intronic
1149661457 17:58336232-58336254 GAGGGGCAGCCAAGGGAAGCAGG + Intergenic
1150077628 17:62206735-62206757 CAGGGGCACCAAAGGGCAGCTGG - Intergenic
1150887260 17:69101616-69101638 CAGCAGCAGCAAAGGAATGCTGG + Intronic
1151719489 17:75847285-75847307 CATGGATAGCTAAGGGATGGGGG + Intronic
1152259546 17:79259674-79259696 CAGGCTCAGCAAAGGGAGCCCGG - Intronic
1152522132 17:80862743-80862765 CAGGGACGGCTGAGGGCTGCAGG - Intronic
1153136283 18:1921000-1921022 CAGATACAGCAAAGGGAAGAAGG - Intergenic
1153796178 18:8624166-8624188 AAGGGAAACAAAAGGGATGCTGG - Intronic
1155526527 18:26721514-26721536 CAGGGAAAGCCTAGGGATGCAGG - Intergenic
1156397971 18:36716438-36716460 CTGAGACAGCAAAGGATTGCAGG + Intronic
1156654765 18:39272137-39272159 TAGTGACAGCAAAGGGAGGCAGG - Intergenic
1157305697 18:46515863-46515885 CAGGGACAAAATAGGGAAGCTGG - Intronic
1158783874 18:60685362-60685384 CAGGGGCAGGAAGGGGTTGCGGG + Intergenic
1158973328 18:62688364-62688386 CAGGGAATGCCAAGGGCTGCAGG - Intergenic
1160293393 18:77616231-77616253 CAGGCACAGCACCGGGGTGCAGG + Intergenic
1160408589 18:78659777-78659799 CAGGGACAGCTGGGGGATGGTGG - Intergenic
1160527437 18:79545867-79545889 TAGTGACAGCAAAGGGAGGCAGG + Intergenic
1160782791 19:885226-885248 CAGGGACAGCAAAGGGACACAGG + Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1161043497 19:2122295-2122317 CACGGACAGCTAAGGGTGGCTGG + Intronic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1163362685 19:16857695-16857717 CAGGGACTGGAATGGTATGCGGG - Intronic
1163648607 19:18504181-18504203 CAGGGACGGCACAGAGAGGCTGG + Intronic
1164426666 19:28147748-28147770 TAGGGAGAGCTAAGGGAGGCTGG + Intergenic
1165052124 19:33148302-33148324 AAGGGACAGAAAAGGCCTGCAGG - Intronic
1165180570 19:33963937-33963959 CTGGCCCACCAAAGGGATGCAGG - Intergenic
1165284881 19:34833257-34833279 CAGAGACAGCGAGGTGATGCAGG - Intergenic
1165408050 19:35642672-35642694 CAGCGACAGCAGAGACATGCTGG + Exonic
1166142962 19:40815195-40815217 CAGGGATGGCAAAGAGATCCTGG - Intronic
1166144194 19:40823098-40823120 CAGGGACATGCAAGGGATGGAGG - Intronic
1166302753 19:41921689-41921711 CAGAGGCAGGAGAGGGATGCAGG + Intronic
1166328320 19:42064873-42064895 GAGGGTCAGCAAAGGCATTCTGG - Intronic
1166851941 19:45765433-45765455 CAGGGACAGGAATGGGAGGGGGG - Exonic
1167608009 19:50492145-50492167 CAGGGAGAGGAAGGGGAGGCAGG + Intergenic
1168428303 19:56257310-56257332 CTGGGAGAACAAAGGGAGGCAGG + Intronic
925508889 2:4602665-4602687 GAAGGATAGCTAAGGGATGCTGG - Intergenic
926511189 2:13781529-13781551 CAGGGAGAGAAAGGGGAGGCAGG - Intergenic
926820744 2:16849061-16849083 CAAGAACAGCTAATGGATGCTGG - Intergenic
927142712 2:20140862-20140884 AGGGGTCAGCAAAGGGATGCTGG + Intergenic
929712508 2:44279340-44279362 CAGGCACAGCAAAGGAAAGGAGG - Intronic
929999466 2:46851047-46851069 TACGGCCAGCAAAGGCATGCAGG + Intronic
930551113 2:52836018-52836040 CAGGGAATGCCAAGGGTTGCAGG - Intergenic
930712210 2:54559627-54559649 CAGGGACAGCTGAGGGGTGCAGG - Intronic
931635909 2:64340697-64340719 CTTGGACAGCAATGGGATGTGGG + Intergenic
932099807 2:68888520-68888542 CATTGACAACAAAAGGATGCAGG - Intergenic
934590585 2:95546660-95546682 CAGGGACAGCCCAGGGAGGACGG - Intergenic
934910073 2:98244295-98244317 AAGGGATAGCAAAGAGATACAGG - Intronic
935322380 2:101901800-101901822 CAGGGACAGACAAGGGAGTCAGG - Intergenic
935576644 2:104717901-104717923 CTGGGGCAGCTAAGGGATGCTGG - Intergenic
935720120 2:105972611-105972633 CAGGTGCAGCAAAGGGAGCCAGG - Intergenic
936569319 2:113601626-113601648 CAGGAACAGCAAAGGAAATCCGG + Intergenic
936870544 2:117130878-117130900 GAGAGACAGCAAAGGGAGACAGG - Intergenic
937909765 2:127069802-127069824 AAGGGACAGGAAAGGAATGGGGG + Intronic
937984854 2:127633804-127633826 CAGGGGCAGCAAAGACAAGCGGG + Intronic
938697587 2:133848583-133848605 CAGAGACAGCCAACGGAGGCTGG - Intergenic
939117172 2:138073589-138073611 CAGGGACACCAAAGAGAGGGAGG - Intergenic
941291216 2:163678149-163678171 CTGGGACAGAAAAGGAATACTGG - Intronic
941819250 2:169828023-169828045 CGGGGACAGCAACGTGATGCGGG + Exonic
943786976 2:191888124-191888146 CAGTGACTGAAAAGGGATGCAGG + Intergenic
945200420 2:207275546-207275568 GAAGGCCAGCAAAGGGAGGCAGG - Intergenic
945572594 2:211487774-211487796 CACTGACAGTAAAGGGCTGCGGG + Intronic
945913705 2:215680349-215680371 GAAGAACAGCTAAGGGATGCTGG + Intergenic
946023822 2:216659927-216659949 CAGTGACAGCAGGGGGATGCTGG + Intronic
946576786 2:221084267-221084289 CAGAGAGAGCAAAGAGCTGCTGG + Intergenic
947907446 2:233775670-233775692 CAGCCACAGCAATGGGATGGTGG - Exonic
948125676 2:235563276-235563298 CAGACACAGCAAAGGGGGGCAGG - Intronic
1169437069 20:5602162-5602184 GAGGGACAGCAAGGGGATACTGG - Intronic
1169738719 20:8866711-8866733 CAGGGAGAGCAAACTGAGGCAGG - Intronic
1169853361 20:10077336-10077358 CAGAGACAGTAAAGGAATGGGGG - Intergenic
1173575575 20:44111188-44111210 CAGGGACCCCAAAGGGATGGAGG - Intergenic
1174063514 20:47848707-47848729 GAGGGAGAGAAAAGGGGTGCAGG - Intergenic
1174092069 20:48057421-48057443 CAGGTGCAGCTAAGGGAAGCCGG - Intergenic
1175736155 20:61388688-61388710 CACAGACAGCAGGGGGATGCTGG + Intronic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176301606 21:5101478-5101500 CAGGGGCAGGGCAGGGATGCAGG + Intergenic
1176301676 21:5101673-5101695 CACGGACAGGGCAGGGATGCGGG + Intergenic
1178145892 21:29739399-29739421 TAGAGACAGGAAAGGGATGTGGG + Intronic
1178694756 21:34783192-34783214 CAGGCACAGGAAGGGGATGCAGG + Intergenic
1179124107 21:38576639-38576661 CTGTGACAGCAAAGGGAGGTTGG - Intronic
1179551551 21:42146790-42146812 GAGGGACAGAGACGGGATGCGGG - Intergenic
1179855355 21:44160226-44160248 CACGGACAGGGCAGGGATGCGGG - Intergenic
1179855425 21:44160421-44160443 CAGGGGCAGGGCAGGGATGCAGG - Intergenic
1180139928 21:45887003-45887025 AAGGGACAGCACAGTGAGGCTGG - Intronic
1180874835 22:19170309-19170331 CAGGGACCCCAAAGGGAAGATGG - Intergenic
1181596995 22:23922189-23922211 CAGGGCCAGAAAATGGGTGCTGG - Intergenic
1182690587 22:32158908-32158930 GAGGGACTGCAAAGGGGTGGGGG + Intronic
1183573970 22:38675217-38675239 CAGTGAGAGCAAAGGGAGCCTGG - Intergenic
1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG + Intronic
1184458772 22:44625671-44625693 CAGGGAGATGAAAGGGATGGGGG + Intergenic
1184744138 22:46446287-46446309 CAGGTACAGCCAGGGGATGCGGG - Intronic
1184851880 22:47125740-47125762 AAGGGACATCAAAGAGATGCTGG - Intronic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185072934 22:48667151-48667173 CAGGGGCAGCACAGGGCAGCAGG + Intronic
1185238292 22:49727151-49727173 CAGGGACAGGAAGGGCATGAGGG - Intergenic
1185342580 22:50298258-50298280 CAAGGGCAGCACAGGGATGCTGG + Intronic
949247461 3:1942215-1942237 CAGGGAAAGAAAAGGGAACCCGG - Intergenic
949605831 3:5652493-5652515 CAGGGATGGCAAAGGGACCCTGG + Intergenic
949910679 3:8904383-8904405 CAGGCACAGCAAAGACATTCAGG + Intronic
950076880 3:10193724-10193746 CAGGGATAGGAAGGGGACGCAGG - Intronic
950707640 3:14792890-14792912 CAGGGAGAGCACAGGCATCCAGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
950790316 3:15466418-15466440 CAGGGACAGAAAGGGGATAGTGG - Exonic
951536968 3:23749169-23749191 CAGGGACAACAGGGGTATGCAGG - Intergenic
953056034 3:39387878-39387900 CAGGGACAGGAACGGGGTCCTGG + Intronic
954687862 3:52380288-52380310 CAGAGAGAGCAAGGGCATGCCGG - Intronic
954708890 3:52495333-52495355 CAGGCACAGCACAGGCAGGCGGG - Exonic
954856214 3:53646091-53646113 CAGGGACGGCAAAGACATGGAGG + Intronic
956212364 3:66814940-66814962 CAGGGAGAGAAAAGGGCTGAAGG - Intergenic
956433291 3:69208662-69208684 GGGGGACAGTAATGGGATGCAGG - Intronic
956729949 3:72187351-72187373 AGGGGTCAGCAAAGTGATGCTGG - Intergenic
957034719 3:75283154-75283176 CAGTGACCTCAAAGGGATTCTGG - Intergenic
958914322 3:100031594-100031616 CAGGAGGAGCCAAGGGATGCGGG - Intronic
960630413 3:119725153-119725175 CAGGTAAAGGAAAGGGAGGCTGG - Intronic
961875776 3:130022429-130022451 CAGGGACAGCAAAGCGAGGACGG + Intergenic
962599382 3:136979450-136979472 CTGTAACAGCAAAGGGAGGCAGG + Intronic
962667813 3:137673226-137673248 GAAGGACAGCAAATGGGTGCTGG - Intergenic
962676805 3:137763923-137763945 AAGGGACAGCAAAGGGAGCGAGG - Intergenic
964183871 3:153919344-153919366 CAGGAATAGCTAATGGATGCTGG + Intergenic
965664747 3:171081341-171081363 AAGAGACAACACAGGGATGCTGG - Intronic
965781321 3:172289205-172289227 CAGACAAAGCCAAGGGATGCAGG - Intronic
966861698 3:184234195-184234217 CAGGGACAGCAAATGTTGGCAGG - Intronic
967427192 3:189340714-189340736 CAGGGAAAGCCAAGGGCTCCAGG - Intergenic
967884229 3:194322377-194322399 GAGGGACAGAAAAGGGAAGCAGG + Intergenic
968467855 4:761870-761892 CAGTGACACCATGGGGATGCAGG + Intronic
968727621 4:2255640-2255662 CAGGGACAGCCGTGGGGTGCTGG - Intronic
969433837 4:7172585-7172607 CAGCCTCAGGAAAGGGATGCAGG - Intergenic
969504771 4:7578454-7578476 CAGGGACAGACAAGAGCTGCTGG - Intronic
974349088 4:60721894-60721916 CAGGGATAGCAACTGGAAGCAGG + Intergenic
976015093 4:80542891-80542913 CAGGGGCAGCAGGGGCATGCAGG - Intronic
976587981 4:86820056-86820078 GAGGGACACCAAAAGGATGAGGG - Intergenic
976778989 4:88737837-88737859 CAGGGGCAGCGATGGGAGGCAGG - Intronic
977080666 4:92523707-92523729 CAGGTTCAGCAGAGGGACGCAGG + Intronic
981545144 4:145885947-145885969 CTGGGGCAGCAAAGGGAAGGAGG - Exonic
982197867 4:152934743-152934765 CAAGGAGATCAAAGGGATGAGGG + Intergenic
984045373 4:174791266-174791288 CGGCCACAGCAAAGGAATGCTGG + Intronic
984929114 4:184831090-184831112 CTGGGACAGAAAAAGGACGCTGG - Intergenic
985732388 5:1556537-1556559 CAGGGCCAGCAGTGGGGTGCGGG + Intergenic
986329461 5:6706876-6706898 GAGGGCCAGCAAAGGGGTGAGGG - Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
988276641 5:29089583-29089605 TATGGACAGCAAAGGGAGACAGG - Intergenic
990889289 5:60631559-60631581 CAGGGAAAGCAAGTGGATTCTGG + Intronic
991656076 5:68904982-68905004 CAGGAACAGCACATGGATGTGGG + Intergenic
991734413 5:69618658-69618680 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991780565 5:70128067-70128089 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
991810847 5:70473793-70473815 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991859853 5:71003490-71003512 TAGGGGCAGCAGAGGGAAGCTGG + Intronic
991873013 5:71128386-71128408 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
992004125 5:72461146-72461168 CGGGAACAGCAAAGGGAGGTTGG + Exonic
992265848 5:75017652-75017674 GAGGGACAGCGAAGGGAGGCAGG + Intergenic
992348880 5:75909249-75909271 CTGGGATAGCAAAAGGATTCAGG - Intergenic
992554667 5:77891723-77891745 CAGGAACAGCACAGGGGAGCTGG + Intergenic
992669768 5:79047598-79047620 CAGGTACAGCTCAGGGACGCGGG - Intronic
993151368 5:84166687-84166709 GAGGAACAGCAAAGAGATGGTGG + Intronic
993560595 5:89402590-89402612 CAGGGGCAACAAAGGGAGACAGG + Intergenic
995332902 5:110965467-110965489 CAGGGACAGCCTAGGGCTGATGG + Intergenic
995373920 5:111452161-111452183 CAGGGAGAGCAAAGTCATGGAGG + Intronic
996659857 5:125988955-125988977 GAGGGACAGCAAAGTGATTGTGG - Intergenic
996876037 5:128241750-128241772 CATGGGCACAAAAGGGATGCTGG + Intergenic
997049232 5:130358943-130358965 CAAGAACAGCTAATGGATGCTGG + Intergenic
997375320 5:133393603-133393625 GAGGGACAGGAAAGGGAGTCTGG + Intronic
997588382 5:135057991-135058013 CAAGGAAAGCCAAGGGTTGCCGG - Intronic
999683873 5:154085085-154085107 CAGGAACAGCAAATGGACACTGG + Intronic
999684426 5:154089484-154089506 CAGGGCTAGCAGAGGGATCCAGG - Intronic
1001184376 5:169554110-169554132 GAAGAACAGCTAAGGGATGCTGG + Intergenic
1001581551 5:172801877-172801899 AAGGGCCAGCAAAGAGATGAGGG + Intergenic
1001936470 5:175709219-175709241 AAGGGACAGAAAAGGGAGGTCGG - Intergenic
1002719099 5:181247029-181247051 CTGGGTCAGCAAAGGGAGCCCGG + Intronic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1003158514 6:3616657-3616679 CAGGCACAGGAAAAGGATCCAGG + Intergenic
1004325907 6:14673880-14673902 AAGTGACAGCAAAGGGGTACAGG - Intergenic
1004337303 6:14775912-14775934 AAGGGTCAGGAAAGGGATTCTGG - Intergenic
1006553199 6:34842406-34842428 GAGTGACAGCAAATGGATACAGG - Intronic
1006815784 6:36848925-36848947 CAGGTACAGCCAGGGGAGGCAGG - Intergenic
1008235971 6:49050537-49050559 CAGTGACAGCAGATGAATGCAGG - Intergenic
1012553080 6:100482016-100482038 CAGGGACTCCAGAGGGAAGCGGG + Intergenic
1012571684 6:100737346-100737368 GAGGAATAGCTAAGGGATGCTGG - Intronic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1013647209 6:112156780-112156802 CAGGGACTGGAACTGGATGCTGG - Intronic
1014014866 6:116518480-116518502 CAGGGACAGAACAGGGATTAGGG + Exonic
1014229241 6:118884040-118884062 CAGTAACAGCAAAAGAATGCAGG + Intronic
1015890771 6:137967813-137967835 CTGGGACAGCAGAGTGATGGTGG - Intergenic
1015890788 6:137967883-137967905 CTGGGACAGCAGAGTGATGGTGG - Intergenic
1016100981 6:140099869-140099891 CAGGGAGAGAGAAGAGATGCTGG + Intergenic
1017405898 6:154117714-154117736 CAGGGTCAGCAAGGGTGTGCAGG + Intronic
1018135885 6:160778168-160778190 AAGTGAAAGCAAAGGGAGGCTGG - Intergenic
1018160642 6:161038887-161038909 CAGGAACAGCTGAGGGCTGCTGG + Intronic
1018898125 6:168035399-168035421 CCAGGGCGGCAAAGGGATGCCGG + Intronic
1019486839 7:1293294-1293316 CAGGGCCGGCAAAGGGGTGCAGG + Intergenic
1023202277 7:37711732-37711754 CAGGGACAAGAGAGGGATACAGG - Intronic
1023539548 7:41250877-41250899 CAGGGACAGCACAGGGTGGGAGG + Intergenic
1024752456 7:52483501-52483523 CAGGGACAACAAAGGCCGGCAGG + Intergenic
1024984456 7:55183097-55183119 CAGCCACAGCCCAGGGATGCTGG - Intronic
1026952201 7:74355069-74355091 CAGGGACTGCACAGGGACTCAGG - Intronic
1027425387 7:78056694-78056716 GAAGAACAGCTAAGGGATGCTGG + Intronic
1027616802 7:80433861-80433883 AAGGGACAGGAAAGGTATACTGG - Intronic
1028357080 7:89923523-89923545 CAGGTACAGCAAGAGGATGGTGG - Intergenic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1029710411 7:102296115-102296137 CAGGGACAGAACAGGGCTCCCGG - Intronic
1029910590 7:104142850-104142872 GATGGACAGCCAAGGGATCCAGG + Intronic
1030140788 7:106302305-106302327 AACGGACAGCAAAGAAATGCAGG - Intergenic
1030574437 7:111268323-111268345 CAGAGATAGAAAAGGGAGGCAGG + Intronic
1030627583 7:111860637-111860659 CAGGGCCAGCGTAGGGAAGCTGG - Intronic
1031876729 7:127150307-127150329 CAGGGACTTCAAAAGGAGGCTGG + Intronic
1032188350 7:129747084-129747106 CAGGCAGAGCACAGGGCTGCAGG - Intronic
1033582702 7:142751619-142751641 CATGGGCAGCAGAGGGATGTGGG - Intronic
1033789320 7:144772217-144772239 CCTGGACAGTAAAAGGATGCTGG + Intronic
1035239120 7:157518476-157518498 GGGGGACAGCAACGGGATGGTGG - Intergenic
1035876463 8:3195228-3195250 CATGCACATCAGAGGGATGCGGG + Intronic
1036858964 8:12328491-12328513 CAGGGCCAGTAAGGGGATGGGGG + Intergenic
1040300836 8:46187216-46187238 CAGTGAGACCACAGGGATGCTGG - Intergenic
1041635960 8:60144805-60144827 CTGGAACAGAAAAAGGATGCTGG + Intergenic
1041783802 8:61608862-61608884 CAGTGAGAGCAAAGGACTGCAGG - Intronic
1046873544 8:119229198-119229220 CAGGGACAAGGAAGGGATACGGG - Intronic
1048593729 8:135845111-135845133 CAGGGACAGGATAGGGAAGCTGG + Intergenic
1049495090 8:142926328-142926350 CAGGGACAGCAAAGGCATAGAGG - Intergenic
1049572618 8:143376351-143376373 CAGGGGCAGCAGTGGGATCCGGG - Intronic
1049642622 8:143722321-143722343 CAGGGAGGGCTAAGGGGTGCAGG - Exonic
1049883210 9:11904-11926 CAGGAACAGCAAAGGAAATCCGG - Intergenic
1050743892 9:8855779-8855801 GAAGGACAGCAAGGGGATGGGGG - Intronic
1051605879 9:18917445-18917467 AAGGGAAAGAAAAGGGAGGCAGG + Intergenic
1051995203 9:23207650-23207672 GAGGAGGAGCAAAGGGATGCGGG + Intergenic
1053055572 9:34991458-34991480 CAGGGACACCAAAAGGAGGTGGG + Intronic
1055427772 9:76213836-76213858 CAAGGAAAGCAAAGGGTTGAAGG - Intronic
1056699416 9:88889617-88889639 AGTGGACAGCACAGGGATGCAGG + Intergenic
1058728725 9:107828736-107828758 CAGAGACTGGAAAGGGAAGCTGG - Intergenic
1059082211 9:111262098-111262120 CAGGGAAAGCAAAGCCAGGCTGG + Intergenic
1059421339 9:114194401-114194423 CAGGGACAGAAAGGGGACCCAGG + Exonic
1059466255 9:114470627-114470649 CAGGGACAGAACAGAGAGGCTGG + Intronic
1059932441 9:119274280-119274302 TAAGGCCAGCAAAGGGACGCTGG - Intronic
1060978205 9:127777554-127777576 CTGGGGCAGCAGAGGGATGGGGG - Intronic
1061034463 9:128105993-128106015 CAGGGACAGCAGGGCGAGGCAGG + Intronic
1061237625 9:129351834-129351856 CAGGGCCAGCAAGGGGGAGCCGG - Intergenic
1061274668 9:129562786-129562808 CAGACACAGCGAAGGAATGCAGG + Intergenic
1061618258 9:131794127-131794149 CCAGGACAGCAAAGGGGAGCAGG + Intergenic
1061822493 9:133236387-133236409 AATGGAAAGCAAAGGGATGGGGG - Intergenic
1061926979 9:133810752-133810774 CAGGGACAGCAGCGGGCTCCAGG + Intronic
1062209777 9:135357213-135357235 CAGAGAAAGCCAAGGGATCCAGG + Intergenic
1062236808 9:135514151-135514173 AATGGAAAGCAAAGGGATGGGGG + Intergenic
1185449617 X:275418-275440 CCGGGACAGAAATGGGGTGCAGG + Intergenic
1185492861 X:532098-532120 CACTGACAGCAAAAGCATGCTGG - Intergenic
1185991227 X:4894869-4894891 AAGTGAAAGCAAAGGGAGGCTGG - Intergenic
1186359097 X:8820904-8820926 CAGGGACAGTGAAAGGATGCAGG - Intergenic
1187288810 X:17932292-17932314 CAGGGTGAGCAAAGGCTTGCTGG - Intergenic
1187933950 X:24318090-24318112 CAGGGATCACAAAGGGAAGCTGG + Intergenic
1189993382 X:46615362-46615384 CAAGGACAGCAAAGGGGAGCTGG - Intronic
1190136376 X:47803209-47803231 CAGCGACAGCAAGGGCAGGCTGG - Intergenic
1190284747 X:48954702-48954724 CAGGGACAGGAAAGGGGTTTGGG - Intronic
1192960559 X:76126609-76126631 CATGGAGAGCAAAGAGAAGCAGG + Intergenic
1195311639 X:103637806-103637828 CAGCATCAGCAAAGGCATGCAGG - Intergenic
1198027890 X:132726636-132726658 CAGGGACAGCTAAAGGGTACAGG - Intronic
1200402604 X:156028244-156028266 CAGGAACAGCAAAGGAAATCCGG + Intergenic