ID: 918180692

View in Genome Browser
Species Human (GRCh38)
Location 1:182084243-182084265
Sequence ACTATGCAGACACTTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918180688_918180692 19 Left 918180688 1:182084201-182084223 CCTGGGAATTCATTGTAAGGCTG No data
Right 918180692 1:182084243-182084265 ACTATGCAGACACTTCCCTCTGG No data
918180690_918180692 -8 Left 918180690 1:182084228-182084250 CCAGAGCTTCCTGGCACTATGCA No data
Right 918180692 1:182084243-182084265 ACTATGCAGACACTTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918180692 Original CRISPR ACTATGCAGACACTTCCCTC TGG Intergenic
No off target data available for this crispr