ID: 918181348

View in Genome Browser
Species Human (GRCh38)
Location 1:182087946-182087968
Sequence CCAGATGTCCAGATCTGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918181348_918181353 2 Left 918181348 1:182087946-182087968 CCTGGTCAGATCTGGACATCTGG No data
Right 918181353 1:182087971-182087993 CAGCCGCGGATCAGAGCCCCAGG No data
918181348_918181355 6 Left 918181348 1:182087946-182087968 CCTGGTCAGATCTGGACATCTGG No data
Right 918181355 1:182087975-182087997 CGCGGATCAGAGCCCCAGGCTGG No data
918181348_918181356 12 Left 918181348 1:182087946-182087968 CCTGGTCAGATCTGGACATCTGG No data
Right 918181356 1:182087981-182088003 TCAGAGCCCCAGGCTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918181348 Original CRISPR CCAGATGTCCAGATCTGACC AGG (reversed) Intergenic
No off target data available for this crispr