ID: 918183326

View in Genome Browser
Species Human (GRCh38)
Location 1:182105408-182105430
Sequence CAAACACAGCTAGAAGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918183326_918183328 -1 Left 918183326 1:182105408-182105430 CCTCTGGCTTCTAGCTGTGTTTG No data
Right 918183328 1:182105430-182105452 GGCTAAAGTAAAGTACCAGTAGG No data
918183326_918183330 8 Left 918183326 1:182105408-182105430 CCTCTGGCTTCTAGCTGTGTTTG No data
Right 918183330 1:182105439-182105461 AAAGTACCAGTAGGACCACAGGG No data
918183326_918183329 7 Left 918183326 1:182105408-182105430 CCTCTGGCTTCTAGCTGTGTTTG No data
Right 918183329 1:182105438-182105460 TAAAGTACCAGTAGGACCACAGG No data
918183326_918183335 29 Left 918183326 1:182105408-182105430 CCTCTGGCTTCTAGCTGTGTTTG No data
Right 918183335 1:182105460-182105482 GGAAGGAGGAGAGTGAGATTCGG No data
918183326_918183331 12 Left 918183326 1:182105408-182105430 CCTCTGGCTTCTAGCTGTGTTTG No data
Right 918183331 1:182105443-182105465 TACCAGTAGGACCACAGGGAAGG No data
918183326_918183333 15 Left 918183326 1:182105408-182105430 CCTCTGGCTTCTAGCTGTGTTTG No data
Right 918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918183326 Original CRISPR CAAACACAGCTAGAAGCCAG AGG (reversed) Intergenic
No off target data available for this crispr