ID: 918183333

View in Genome Browser
Species Human (GRCh38)
Location 1:182105446-182105468
Sequence CAGTAGGACCACAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918183326_918183333 15 Left 918183326 1:182105408-182105430 CCTCTGGCTTCTAGCTGTGTTTG No data
Right 918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918183333 Original CRISPR CAGTAGGACCACAGGGAAGG AGG Intergenic
No off target data available for this crispr