ID: 918185772

View in Genome Browser
Species Human (GRCh38)
Location 1:182126517-182126539
Sequence CTGTGTTCTGAGATAAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918185772_918185779 28 Left 918185772 1:182126517-182126539 CCTTGCTTTATCTCAGAACACAG No data
Right 918185779 1:182126568-182126590 TAGAAGGAGGTCCCCTCCCTGGG No data
918185772_918185776 12 Left 918185772 1:182126517-182126539 CCTTGCTTTATCTCAGAACACAG No data
Right 918185776 1:182126552-182126574 GTAGGAAAGAATGCTCTAGAAGG No data
918185772_918185780 29 Left 918185772 1:182126517-182126539 CCTTGCTTTATCTCAGAACACAG No data
Right 918185780 1:182126569-182126591 AGAAGGAGGTCCCCTCCCTGGGG No data
918185772_918185777 15 Left 918185772 1:182126517-182126539 CCTTGCTTTATCTCAGAACACAG No data
Right 918185777 1:182126555-182126577 GGAAAGAATGCTCTAGAAGGAGG No data
918185772_918185775 -6 Left 918185772 1:182126517-182126539 CCTTGCTTTATCTCAGAACACAG No data
Right 918185775 1:182126534-182126556 ACACAGACATCAGGGACTGTAGG No data
918185772_918185778 27 Left 918185772 1:182126517-182126539 CCTTGCTTTATCTCAGAACACAG No data
Right 918185778 1:182126567-182126589 CTAGAAGGAGGTCCCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918185772 Original CRISPR CTGTGTTCTGAGATAAAGCA AGG (reversed) Intergenic
No off target data available for this crispr