ID: 918186291

View in Genome Browser
Species Human (GRCh38)
Location 1:182130387-182130409
Sequence CACTTGCCCTGGGTTGTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918186291_918186301 14 Left 918186291 1:182130387-182130409 CCCAGAACAACCCAGGGCAAGTG No data
Right 918186301 1:182130424-182130446 TGGGTGGAGATGGGCCATCATGG No data
918186291_918186298 -2 Left 918186291 1:182130387-182130409 CCCAGAACAACCCAGGGCAAGTG No data
Right 918186298 1:182130408-182130430 TGGAGATAAGATAGTCTGGGTGG No data
918186291_918186303 29 Left 918186291 1:182130387-182130409 CCCAGAACAACCCAGGGCAAGTG No data
Right 918186303 1:182130439-182130461 CATCATGGCTTGATTCCCTTTGG No data
918186291_918186300 5 Left 918186291 1:182130387-182130409 CCCAGAACAACCCAGGGCAAGTG No data
Right 918186300 1:182130415-182130437 AAGATAGTCTGGGTGGAGATGGG No data
918186291_918186296 -6 Left 918186291 1:182130387-182130409 CCCAGAACAACCCAGGGCAAGTG No data
Right 918186296 1:182130404-182130426 CAAGTGGAGATAAGATAGTCTGG No data
918186291_918186299 4 Left 918186291 1:182130387-182130409 CCCAGAACAACCCAGGGCAAGTG No data
Right 918186299 1:182130414-182130436 TAAGATAGTCTGGGTGGAGATGG No data
918186291_918186297 -5 Left 918186291 1:182130387-182130409 CCCAGAACAACCCAGGGCAAGTG No data
Right 918186297 1:182130405-182130427 AAGTGGAGATAAGATAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918186291 Original CRISPR CACTTGCCCTGGGTTGTTCT GGG (reversed) Intergenic
No off target data available for this crispr