ID: 918198299

View in Genome Browser
Species Human (GRCh38)
Location 1:182243178-182243200
Sequence CCCACAGAGTCTGCCAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918198294_918198299 28 Left 918198294 1:182243127-182243149 CCTCTGCTCATATCTTCACAGAT 0: 1
1: 0
2: 0
3: 25
4: 219
Right 918198299 1:182243178-182243200 CCCACAGAGTCTGCCAGCACTGG 0: 1
1: 0
2: 0
3: 14
4: 185
918198297_918198299 -2 Left 918198297 1:182243157-182243179 CCTCTCAAAAAACTGGATTCACC 0: 1
1: 0
2: 1
3: 5
4: 147
Right 918198299 1:182243178-182243200 CCCACAGAGTCTGCCAGCACTGG 0: 1
1: 0
2: 0
3: 14
4: 185
918198296_918198299 -1 Left 918198296 1:182243156-182243178 CCCTCTCAAAAAACTGGATTCAC 0: 1
1: 0
2: 0
3: 23
4: 273
Right 918198299 1:182243178-182243200 CCCACAGAGTCTGCCAGCACTGG 0: 1
1: 0
2: 0
3: 14
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918198299 Original CRISPR CCCACAGAGTCTGCCAGCAC TGG Intergenic
900852028 1:5151455-5151477 CCTCCAGAATCTCCCAGCACAGG - Intergenic
902373857 1:16021124-16021146 CCAACAGAGGATGGCAGCACAGG - Intronic
902378781 1:16042959-16042981 CCAACAGAGGATGGCAGCACAGG - Intergenic
902686185 1:18079226-18079248 GCCCCAGAATCTGCCAGCAAAGG + Intergenic
902821923 1:18948718-18948740 CTCACAGATGCTGCCAGCAAAGG + Intronic
904482616 1:30803546-30803568 CCCAAACAGTCTGGCAGCCCTGG + Intergenic
904956034 1:34284700-34284722 TCCACAGGGCCAGCCAGCACAGG + Intergenic
906153490 1:43601091-43601113 CCAACAGAGTGTCCCAGGACAGG + Intronic
906251305 1:44312881-44312903 ACCCCAGAGTCAGCCAGCATAGG + Intronic
906319404 1:44807104-44807126 CCCACAGATCCTTCCAGCCCTGG + Intergenic
906418352 1:45640816-45640838 GCCACAGGGTTTGCCAGCCCAGG - Intronic
907312661 1:53547887-53547909 CTCACAGAGACAGCCACCACTGG - Intronic
907509620 1:54948535-54948557 CCCACTGAGTCTGCCAGACAGGG + Intergenic
911531854 1:99052272-99052294 CCCACGGAGTTTGCACGCACAGG - Intergenic
912724426 1:112045988-112046010 TCCACAGTGTCTACCTGCACAGG + Intergenic
915279683 1:154813970-154813992 CACACAGAGACTGCCAGGGCTGG + Intronic
915315527 1:155026562-155026584 CCCTCGGAGCCTGACAGCACTGG - Exonic
915924351 1:160004723-160004745 CCCCCAGAGTCAGCCAGTAAAGG + Intergenic
918198299 1:182243178-182243200 CCCACAGAGTCTGCCAGCACTGG + Intergenic
918497638 1:185157430-185157452 CCCACAGAGTCGCCCCGCCCAGG - Intronic
920095058 1:203481147-203481169 CCCAAGGAGGCTCCCAGCACTGG - Intronic
920308523 1:205034168-205034190 CTCACAGCCTCTGCCAGCTCAGG + Intergenic
921994042 1:221397494-221397516 CCCACAGCCACTGCCAGCCCAGG - Intergenic
922351305 1:224736663-224736685 CCCACAGAGTCTGCGGACACTGG - Intronic
922720358 1:227897062-227897084 CACCCAGAGTCCCCCAGCACTGG + Intergenic
923278155 1:232416193-232416215 CCCAGTGAGTCAGTCAGCACAGG + Intronic
1063380594 10:5583115-5583137 GCCGCAGGATCTGCCAGCACAGG + Intergenic
1067156170 10:43782981-43783003 CCCACAGACTCAGCCAGCAAGGG + Intergenic
1069789823 10:71012397-71012419 CATACAGAGTGTGCCAGCACTGG + Intergenic
1070307418 10:75247954-75247976 CCCAGAGAGGCTGCCAGGGCTGG - Intergenic
1072539279 10:96385907-96385929 CCCCCAGATTCTGCTAGCGCAGG + Intronic
1074576369 10:114673543-114673565 GCCACAGAGACTGCCTGCAGAGG - Intronic
1075031380 10:119026877-119026899 CCCAGAGAGGCGGCCAGAACAGG + Intergenic
1075198681 10:120383082-120383104 CCTACAAAGACTGGCAGCACTGG + Intergenic
1075926340 10:126254538-126254560 CTCACAGAGTCCACCTGCACAGG + Intronic
1076270654 10:129149535-129149557 CCCATAGAGTCTGTATGCACCGG - Intergenic
1076621383 10:131790488-131790510 CCCACAGGGACTGCCATCATTGG + Intergenic
1078358967 11:10653740-10653762 CCCACAGAGGCCACCTGCACGGG + Intronic
1084451398 11:69240987-69241009 CCCACAAATTCTGCCACCACTGG - Intergenic
1084785368 11:71438826-71438848 CCCCCAGAGCCTGCCGGCATCGG + Intronic
1086387572 11:86325434-86325456 CCCACAGATTGTTCCAGCAACGG - Intronic
1088477089 11:110251922-110251944 CCAAGAGAGTCTAGCAGCACAGG + Intronic
1088583183 11:111334792-111334814 CCTCCAGAGTCTGCAAACACAGG + Intergenic
1089208488 11:116784575-116784597 CCCACAGAGTCCTCCAGAAGAGG + Intronic
1090412043 11:126515931-126515953 AACTCAGAGTCTGCCAGCAAAGG - Intronic
1090749968 11:129737832-129737854 TCCACAGTCTCTGCTAGCACAGG - Intergenic
1091475359 12:767204-767226 CCCAGAAAGTCTGCCACAACAGG - Intronic
1092063423 12:5569293-5569315 CCCACTGAGTTCCCCAGCACTGG + Intronic
1094807149 12:34105668-34105690 CCCAGAACGTCTGCCTGCACTGG - Intergenic
1096146728 12:49283741-49283763 CCCACATAGCCTGCAAGCAGAGG + Intergenic
1096430477 12:51538890-51538912 CCCACATGGTCTGTCAGCACGGG + Intergenic
1096564801 12:52469501-52469523 CCCACCGAGGCTGCCCACACTGG - Intronic
1102255120 12:111410607-111410629 CCAGCACAGTCTGCCAGAACAGG - Intronic
1102313758 12:111868800-111868822 TTCACAGAATCAGCCAGCACCGG + Exonic
1104096166 12:125559983-125560005 CCCAGAGAGGCTGGCAGCGCTGG - Intronic
1105821844 13:24087178-24087200 CTCCCAGAGCCTGCCAGCCCAGG + Intronic
1113798935 13:113076688-113076710 GCCACAAAGTCTGCCAGCGGAGG - Intronic
1114529777 14:23388481-23388503 GGAACAGAGTCCGCCAGCACGGG + Intronic
1115145863 14:30224910-30224932 GCCACACAGCCTGGCAGCACTGG + Intergenic
1115707866 14:36016534-36016556 GCCACACAGTCTCCTAGCACAGG - Intergenic
1116948104 14:50854893-50854915 CCCACAGAGCCTAGCAGCAGAGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118906435 14:70027131-70027153 CCCACAGAGCCTTCTAGCTCTGG - Intronic
1121465021 14:94110249-94110271 CTCACAGAGTTTACCAGCAATGG - Intronic
1122246172 14:100404972-100404994 CAGACAGATTCTGCGAGCACAGG - Intronic
1123042345 14:105495576-105495598 CCCACCCAGTCAGCCTGCACTGG + Intronic
1134242940 16:12519008-12519030 CCCACGGAGGCTGCCAGGACGGG + Intronic
1134916118 16:18072464-18072486 ACCACAGAGTCTTCCATCAAAGG + Intergenic
1137016925 16:35386319-35386341 AACACAGAGTCACCCAGCACAGG - Intergenic
1139391939 16:66610713-66610735 GCCACAGGCACTGCCAGCACAGG - Intronic
1139430220 16:66907148-66907170 CCCACAGAATCTGCCAATAGTGG + Intergenic
1140770062 16:78195242-78195264 TCCAGTCAGTCTGCCAGCACTGG - Intronic
1140985680 16:80156270-80156292 GTCAGAGACTCTGCCAGCACTGG + Intergenic
1141177520 16:81730622-81730644 CTCACAGAGCCTCCCAGCCCGGG - Intergenic
1141470946 16:84237993-84238015 CCCTTACAGACTGCCAGCACAGG + Intronic
1141596680 16:85101158-85101180 CCCACAAAGCCTGCCATCCCTGG - Intronic
1142409035 16:89907104-89907126 GCCACAGAGTCTGACAGAAACGG - Intronic
1142710860 17:1723256-1723278 ACCACAGAGCCTGCCAGCTGTGG - Intronic
1143264911 17:5629039-5629061 CCCACAGTGTCAGCCCGAACTGG + Intergenic
1144739701 17:17574959-17574981 CCCACAACGTCTTCCAGCAGGGG + Intronic
1148328525 17:46798590-46798612 CACACAGTGACTGCCAGCCCTGG + Intronic
1148466474 17:47868087-47868109 GCCACAGTGTATGCCTGCACTGG - Intergenic
1150533809 17:66014265-66014287 CTGGCACAGTCTGCCAGCACAGG + Intronic
1151942150 17:77299681-77299703 CCCACAGAGCCTCCCTGCAAAGG - Intronic
1152270260 17:79320335-79320357 CTGGCAGAGGCTGCCAGCACTGG - Intronic
1152403601 17:80083753-80083775 CCCACAGAGGAGGCCAGCACTGG + Intronic
1152532128 17:80924809-80924831 CACACAGACTCTGACAGCCCTGG + Intronic
1154200933 18:12300083-12300105 CACACAGAACCTTCCAGCACGGG - Intergenic
1156375497 18:36511712-36511734 CCAACAGAGACTGGCAGCAAGGG - Intronic
1156781874 18:40859850-40859872 CACACACAGTCTGCCAGCTAGGG - Intergenic
1158284214 18:55861454-55861476 CCCTCAGAGACAGCCAGCAGAGG - Intergenic
1159666706 18:71170431-71170453 ACCACAGAGTTGGCCAGCAAGGG + Intergenic
1162806209 19:13139147-13139169 CGCACACACTCTGCCAGCCCTGG - Exonic
1163650511 19:18515189-18515211 CCTGCAGAGACTGCCAGCTCGGG + Intronic
1165045888 19:33104619-33104641 CCCAGAGAGTCTGCTATAACTGG - Intronic
1165754723 19:38286182-38286204 CCCACAGAGCCTGCCTGCCTGGG - Intronic
1166543413 19:43620205-43620227 ACCACAGAATCCGCCAGCATGGG - Intergenic
1166747142 19:45146775-45146797 CCCCCAGAGTCTTCCAGTGCTGG - Exonic
1166996349 19:46721404-46721426 CCACCAGAGGCTGCCAGCACAGG + Intronic
1167321355 19:48799057-48799079 TCCCCAGCTTCTGCCAGCACAGG + Intronic
1168340767 19:55621863-55621885 CCTCCAGAGTCTCCCAGCCCCGG + Exonic
925365414 2:3308057-3308079 CCGACAGCGTCGGCCAGCGCTGG - Intronic
926196358 2:10765812-10765834 CCCACTGAGTCTGGCATCCCTGG - Intronic
932514840 2:72335005-72335027 CCCACAGAGTTTGCCAGATCCGG - Exonic
934119160 2:88823678-88823700 CCCAGAGAGTCTGCTTGAACAGG + Intergenic
934520947 2:95019837-95019859 CACACAGGCTCTGCGAGCACAGG - Intergenic
934658729 2:96131945-96131967 CACACAGCCGCTGCCAGCACAGG + Intronic
935553415 2:104481698-104481720 ACTACAGTGTCTGCCAGCACAGG - Intergenic
936162615 2:110096184-110096206 CCCAGAGAGTCTGCTTGAACAGG + Intronic
938370291 2:130764083-130764105 GCCACACAGCCTGCCAGCATGGG - Exonic
938908111 2:135858529-135858551 CTCACAAAGTCTGCTACCACAGG + Intronic
939012346 2:136861520-136861542 GTCACAGAGTATGCCAGGACTGG + Intronic
940178671 2:150907167-150907189 ACCACAGTGTATGGCAGCACAGG - Intergenic
944484871 2:200195067-200195089 CACCCAGATTATGCCAGCACTGG + Intergenic
947789061 2:232852181-232852203 CCCTCAGAGCCTTCCAGCCCTGG + Intronic
948599658 2:239101040-239101062 CCCACAGACTCCGACAGCTCAGG - Intronic
948786802 2:240356957-240356979 GCCACAGGGGCTACCAGCACAGG + Intergenic
1169928833 20:10810357-10810379 CCCACCTAGTCTGCCACCTCTGG - Intergenic
1170287474 20:14725919-14725941 CCCACAGTGTGTGCTAGAACAGG + Intronic
1170324780 20:15144781-15144803 CCCCTGGAATCTGCCAGCACTGG + Intronic
1175819243 20:61899776-61899798 CCCACAGGGTCTCCGAGGACAGG + Intronic
1175917643 20:62434321-62434343 CACACAGAGGCTGCCAGAGCTGG - Intergenic
1176025274 20:62982391-62982413 CCCCCAGAGCCTGTGAGCACAGG - Intergenic
1176101120 20:63365037-63365059 CCCACAGCGCGTCCCAGCACTGG - Intronic
1181170583 22:21006812-21006834 CCCACAGTGCCTGCCAGCTAAGG + Intergenic
1181469386 22:23128410-23128432 CACACACAGGCTGCCAGCCCAGG - Intronic
1181757982 22:25038942-25038964 CCCACACAGTCTGGAAGCTCCGG - Exonic
1182401028 22:30078193-30078215 CCTACTGTGTGTGCCAGCACTGG + Intergenic
1183406143 22:37631576-37631598 CCCACAGTGTCTCCCAGCAGTGG + Intronic
1184932484 22:47691611-47691633 ACCACACACTCTGCCAGCCCAGG - Intergenic
951217590 3:20040058-20040080 CTCACGGTGTCTGCCAGCGCTGG - Exonic
955103568 3:55875020-55875042 TCCCCAGAGTCAGCCAGCAAGGG + Intronic
955104034 3:55878758-55878780 CCCCCAAAGTCTGCATGCACTGG + Intronic
955559000 3:60168537-60168559 GCCAGAGGCTCTGCCAGCACAGG + Intronic
956469764 3:69554501-69554523 CCCACAGAGGGTGCAAGCCCCGG - Intergenic
959413935 3:106061311-106061333 CCCACAAACTCTGCCACCAAGGG + Intergenic
960823662 3:121760177-121760199 CCCACAGAATCTGGCACTACTGG + Intergenic
964713627 3:159698235-159698257 CAAACAGTGTCTGCCAGCAATGG + Intronic
965716704 3:171612466-171612488 CCAACAGTGTCTGCCACAACAGG - Intronic
965860327 3:173141159-173141181 GCCACAGCATCTGCCAACACCGG + Exonic
968830403 4:2930729-2930751 CCCACAGGGTCTCCCTGGACTGG + Exonic
971345318 4:25806613-25806635 AGCTCAGGGTCTGCCAGCACAGG - Intronic
971911388 4:32800737-32800759 CCCAATGAGTCTGCCAGGACTGG + Intergenic
972045490 4:34660646-34660668 CCCACAGTGCCTACCAGCCCTGG + Intergenic
974062210 4:57045575-57045597 CCTACAGATTCTTCCAACACAGG - Intronic
975095603 4:70453397-70453419 CCCACAGCCACTGCCACCACAGG + Intronic
975395539 4:73869697-73869719 CCTGCAGGGTCTGCAAGCACTGG - Exonic
975401451 4:73944085-73944107 CCTGCAGGGTCTGCAAGCACTGG + Intergenic
975409950 4:74038363-74038385 CCTGCAGTGTCTGCAAGCACTGG + Exonic
975415335 4:74098872-74098894 CCTGCAGGGTCTGCAAGCACTGG + Exonic
975947404 4:79724153-79724175 GCCACAGACTCAGCCAGCAGAGG - Intergenic
977123863 4:93139409-93139431 CCCACATAATCTGCCAGGTCAGG + Intronic
978596160 4:110379514-110379536 CAGACACTGTCTGCCAGCACAGG - Intronic
985866889 5:2520876-2520898 CGCACAGAGTCTGCGAGCAGAGG - Intergenic
992487692 5:77211273-77211295 CCCACGGCGTGTGCCAGCGCGGG - Intronic
998411734 5:141916336-141916358 ACCCAAGAGTCAGCCAGCACAGG + Intergenic
998845123 5:146301129-146301151 CCAACAGAGGCTGGCAACACTGG + Intronic
999247877 5:150165031-150165053 GCCAGAGACTCAGCCAGCACAGG - Intergenic
1001399394 5:171437634-171437656 CCCATAGAGGCAGCCAGCAGAGG - Intronic
1002452986 5:179330295-179330317 CCCCCAGAGTCTATCAGGACAGG + Intronic
1003142302 6:3481646-3481668 CACCCAGAGTCTGGCAGCAGTGG - Intergenic
1003471576 6:6440411-6440433 CACACACAGTCTGTCAGCAAAGG + Intergenic
1004595222 6:17093382-17093404 TCCACAGATTCAGCCACCACAGG - Intergenic
1005085431 6:22001512-22001534 CCCACACTGTCCGCCAGGACTGG + Intergenic
1005086505 6:22012980-22013002 TCCACACCGTCTGCAAGCACAGG - Intergenic
1005440484 6:25862232-25862254 CCCAAAGAGTCTTCCTGCAAAGG - Exonic
1007125454 6:39422366-39422388 CACACAGTTTCTGCCAGCTCTGG - Intronic
1007723626 6:43900930-43900952 CCCGCTGACTCTGCCATCACAGG + Intergenic
1009498001 6:64374302-64374324 GCCACAAAGCCTGCCAGCACTGG - Intronic
1010159416 6:72834653-72834675 CCAACAGAGTCTTGCAGCAAAGG - Intronic
1017376348 6:153773803-153773825 TCCACAGAGTGTGCCATCAGGGG + Intergenic
1017745526 6:157443584-157443606 CTCACAGTGGCTGCCATCACTGG + Intronic
1019440323 7:1042721-1042743 CCCACAGAGCCTGGCATTACAGG + Intronic
1019784854 7:2968858-2968880 CCCACAGACTCTTCCACCTCTGG - Intronic
1020089602 7:5331536-5331558 ACCACAGAGTCTTGCAGCAACGG + Intronic
1023857675 7:44194707-44194729 CAGACAGAGTCTGCCACCAAAGG - Intronic
1028192640 7:87870621-87870643 ACCACAGGCTCAGCCAGCACAGG + Intronic
1028245282 7:88469316-88469338 CCCTGAGAGTCTTCTAGCACTGG + Intergenic
1028908302 7:96178887-96178909 CCCAAAGAGCCTGTCAGAACTGG - Intronic
1029559102 7:101290593-101290615 CACACAGAAGCTGCCAGCAGGGG - Intergenic
1034491209 7:151394071-151394093 CTCACAGGGTCTGTCCGCACAGG - Intronic
1035577319 8:716170-716192 CCCCCAGACTCTGCCCGCAGAGG + Intronic
1036007838 8:4687081-4687103 ACCACAGAGTTAGCCTGCACAGG - Intronic
1036074282 8:5477510-5477532 CCCACAGCCACTGCCACCACAGG + Intergenic
1037360062 8:18063739-18063761 CCCACAAAATCTGAGAGCACGGG + Intronic
1037464816 8:19149716-19149738 CCCACACTGTCTTCCAGCAATGG - Intergenic
1037825478 8:22158195-22158217 TCCCCAGACTCTGCCAGCAGGGG + Intronic
1042739474 8:72027338-72027360 CCCACTGAGCCTGGCACCACTGG + Intronic
1045328028 8:101131357-101131379 CCCACAGCGTCCGCCTGCTCTGG + Intergenic
1045583426 8:103501577-103501599 CCCACAGTGGCTGCGAGCAGCGG + Intronic
1050255419 9:3787859-3787881 TTCACAGAGTCTCCCATCACAGG - Intergenic
1054159806 9:61665804-61665826 CACACAGAGTCTTACAGCAAAGG - Intergenic
1054161294 9:61673652-61673674 CACACAGAGTCATCCAGCAGAGG + Intergenic
1055394082 9:75854922-75854944 CACCCAGAGTTGGCCAGCACTGG + Intergenic
1056685761 9:88758109-88758131 CCCAGAGAGCCTGCTAGGACAGG - Intergenic
1058617085 9:106842094-106842116 CCTTCAGAGTCAGCCAGAACAGG - Intergenic
1058877210 9:109254660-109254682 CCCACAGATTCTGACTGCAAAGG + Intronic
1062419718 9:136474345-136474367 TCCAGAAAGTCTGCCCGCACAGG - Exonic
1195912725 X:109904814-109904836 CCCACAGAGGCATCCTGCACTGG - Intergenic
1200919325 Y:8599149-8599171 ACCACAGAGACTGCCAGAAGGGG + Intergenic