ID: 918202152

View in Genome Browser
Species Human (GRCh38)
Location 1:182277715-182277737
Sequence CAAGGTGGACTCTTTGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918202152_918202157 3 Left 918202152 1:182277715-182277737 CCAGGACCAAAGAGTCCACCTTG No data
Right 918202157 1:182277741-182277763 TTCTGACCCACCATTCTTTCAGG No data
918202152_918202159 5 Left 918202152 1:182277715-182277737 CCAGGACCAAAGAGTCCACCTTG No data
Right 918202159 1:182277743-182277765 CTGACCCACCATTCTTTCAGGGG No data
918202152_918202158 4 Left 918202152 1:182277715-182277737 CCAGGACCAAAGAGTCCACCTTG No data
Right 918202158 1:182277742-182277764 TCTGACCCACCATTCTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918202152 Original CRISPR CAAGGTGGACTCTTTGGTCC TGG (reversed) Intergenic
No off target data available for this crispr