ID: 918210235

View in Genome Browser
Species Human (GRCh38)
Location 1:182343912-182343934
Sequence CTGGTGTTCTTAAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918210230_918210235 -6 Left 918210230 1:182343895-182343917 CCCTAAATCCAATCTGACTGGTG No data
Right 918210235 1:182343912-182343934 CTGGTGTTCTTAAAGGAAGAGGG No data
918210231_918210235 -7 Left 918210231 1:182343896-182343918 CCTAAATCCAATCTGACTGGTGT No data
Right 918210235 1:182343912-182343934 CTGGTGTTCTTAAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918210235 Original CRISPR CTGGTGTTCTTAAAGGAAGA GGG Intergenic
No off target data available for this crispr