ID: 918215172

View in Genome Browser
Species Human (GRCh38)
Location 1:182387082-182387104
Sequence CAGCATTCACAGATTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918215162_918215172 25 Left 918215162 1:182387034-182387056 CCTAGTCTTCCCAATGCTGATTT 0: 1
1: 0
2: 1
3: 17
4: 239
Right 918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 199
918215164_918215172 15 Left 918215164 1:182387044-182387066 CCAATGCTGATTTCAGAATGTCT 0: 1
1: 0
2: 3
3: 13
4: 229
Right 918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 199
918215163_918215172 16 Left 918215163 1:182387043-182387065 CCCAATGCTGATTTCAGAATGTC 0: 1
1: 0
2: 3
3: 13
4: 216
Right 918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918215172 Original CRISPR CAGCATTCACAGATTGAGGA GGG Intronic
900251367 1:1671906-1671928 GAGCGTTCACAGAATCAGGAAGG - Intronic
900933501 1:5751149-5751171 CTTCTTTCACAGATTGAGGGAGG + Intergenic
901454909 1:9357708-9357730 CTGCATTCACAGTCTGAGAAAGG - Intronic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902028939 1:13407014-13407036 CACCATCCCCAGATTGGGGAAGG + Intergenic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
903778883 1:25809447-25809469 CAGCCTTCACAGCTTCTGGAGGG - Intronic
905421796 1:37851717-37851739 CAGTAATCACTGATGGAGGATGG + Intronic
906780716 1:48570704-48570726 CAACATTTACAGCATGAGGAAGG - Intronic
909698937 1:78499039-78499061 CAGCTTTCTCACATTGGGGAAGG + Intronic
909847725 1:80417036-80417058 AAGCATTCCCAGATTGAGTCAGG - Intergenic
911380077 1:97103647-97103669 CAACATTCACATAGTGATGAGGG + Intronic
911545015 1:99206135-99206157 CTGCATCCACATATGGAGGAAGG + Intergenic
912716321 1:111986541-111986563 TTGCTTTCACAAATTGAGGATGG - Intronic
912900906 1:113647258-113647280 GAGCAGGAACAGATTGAGGAAGG + Intronic
918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG + Intronic
918623021 1:186626487-186626509 CAGGAGTCACAGATTTGGGAAGG + Intergenic
920611430 1:207441968-207441990 CAGCATTCACATATTGTAGAAGG - Intergenic
920854652 1:209652711-209652733 CAGAATTCACAGGGTGGGGAAGG + Intergenic
921293874 1:213683848-213683870 CAGCTTTCCCAGGGTGAGGAGGG - Intergenic
922088204 1:222370806-222370828 CAGAAATTAAAGATTGAGGAGGG + Intergenic
924567994 1:245213808-245213830 CAGAATTTCCTGATTGAGGATGG + Intronic
1063235626 10:4112538-4112560 CATCCTTGACAGAATGAGGAAGG - Intergenic
1063953437 10:11244892-11244914 CACCAGACACAGATGGAGGAAGG - Intronic
1067735995 10:48851294-48851316 AAGCATCCACATATGGAGGAGGG - Intronic
1068372599 10:56137409-56137431 CAGAAATCACACAGTGAGGAAGG - Intergenic
1071249590 10:83803428-83803450 GAGCTTTCACTCATTGAGGAAGG + Intergenic
1075003125 10:118812372-118812394 TAGCATGCTCAGATTGGGGATGG + Intergenic
1075130318 10:119732379-119732401 CAGGTTTTACAGATTGAGGGAGG + Intronic
1080758511 11:35225412-35225434 CAGCAATCACACAGTGTGGAAGG - Intronic
1081290022 11:41313226-41313248 CAGCCTTGACATGTTGAGGAAGG - Intronic
1082731024 11:56797879-56797901 GTGCAGTCACAGGTTGAGGAGGG - Intergenic
1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG + Exonic
1084974518 11:72789538-72789560 CAGCTGTCAGACATTGAGGAGGG - Intronic
1085171124 11:74450853-74450875 AAACATTCAGAGACTGAGGATGG - Intergenic
1085321047 11:75574242-75574264 CATCATGCACATATCGAGGAAGG + Intergenic
1087429643 11:98036412-98036434 CTGCATTCTCACATGGAGGAAGG - Intergenic
1089404031 11:118182667-118182689 CAGCATGCACAGATTGCGGCTGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092395574 12:8122498-8122520 CGGCACTCTCAGAGTGAGGAGGG + Intergenic
1093172274 12:15874383-15874405 CAGACTTCACAGGTTGGGGAAGG + Intronic
1094613076 12:32012253-32012275 CAGCAATCATACATTGATGAAGG + Intergenic
1096754727 12:53789684-53789706 CAGCATTGAAAGATGGAGGAAGG - Intergenic
1096879858 12:54658708-54658730 CAGCCTCCACATATTGAGAACGG - Intergenic
1096919386 12:55067917-55067939 CAGCAGCAACAGTTTGAGGAAGG + Intergenic
1097589752 12:61560347-61560369 CAACATTTACAGTTTGAGAAAGG + Intergenic
1097652396 12:62317468-62317490 TAGCATACACAGATTGTGTAAGG - Intronic
1098646001 12:72901669-72901691 GAGCATTCACAGAGTCAGGTAGG - Intergenic
1100871233 12:98912559-98912581 CAGAGTTCACAGATTAATGAGGG - Intronic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1104709535 12:130975939-130975961 AAACATTCACAGAGGGAGGAAGG - Intronic
1105881785 13:24612352-24612374 CAGCCTGGAAAGATTGAGGAAGG + Intergenic
1110789846 13:79575663-79575685 CAGCATGGACAGATTGGGGCAGG + Intergenic
1110820568 13:79910515-79910537 GAGAATTCCCAGATTGAGGCAGG + Intergenic
1112534522 13:100238330-100238352 CAGCATTAAAATATTGAGGGAGG - Intronic
1113576080 13:111396214-111396236 CAGCATGCACCGAGGGAGGAGGG + Intergenic
1118827906 14:69400462-69400484 CAGCGTTCAAAGATTTAGGGGGG + Intronic
1121283123 14:92713721-92713743 CAGCACCCACAGTTGGAGGACGG + Intronic
1121507795 14:94489885-94489907 CTCCATCCACAGAATGAGGAGGG + Intronic
1122878593 14:104679883-104679905 CAGCATTCACACTTTGCAGAGGG - Intergenic
1124047033 15:26159990-26160012 CAGGATTCAAAGACTGAGAAGGG + Intergenic
1124556634 15:30731874-30731896 CAGCCTTCACAGACAGAAGAAGG + Intronic
1124674644 15:31673863-31673885 CAGCCTTCACAGAGAGAAGAAGG - Intronic
1127130920 15:55862421-55862443 CAGCACGCACAGATCAAGGACGG - Intronic
1127312671 15:57766627-57766649 CAGCCTTGACTGATTCAGGAGGG - Intronic
1128719136 15:69933202-69933224 CAGCATCCACAATTTGAGAAGGG - Intergenic
1129770369 15:78199882-78199904 CAGCATGCACACAATGAGGCAGG - Intronic
1138918564 16:61498701-61498723 CAGCATTCTCACATGGTGGAAGG + Intergenic
1139542201 16:67626572-67626594 CAGCATTCCTATATTGAGCAAGG + Exonic
1140971451 16:80016966-80016988 GAGCATTGACTGTTTGAGGAAGG - Intergenic
1141318885 16:82988088-82988110 CAGTCTTCAATGATTGAGGAAGG - Intronic
1145255255 17:21318717-21318739 CAGCATTCATCCATTCAGGAGGG - Intergenic
1145321351 17:21769238-21769260 CAGCATTCATCCATTCAGGAGGG + Intergenic
1147445543 17:40473152-40473174 CAGCATTCACAGAAAGCAGATGG - Intergenic
1149614122 17:57983871-57983893 CAGAAAACTCAGATTGAGGAAGG + Intronic
1154130466 18:11732708-11732730 CAACATTTACAAATGGAGGAGGG + Intronic
1155620991 18:27779463-27779485 CATCTTCCACAGATAGAGGAAGG - Intergenic
1156621530 18:38857354-38857376 CAGGATTCCCAGACTGAGCATGG - Intergenic
1156945335 18:42822651-42822673 CAGGATGCACAGTTTTAGGAAGG - Intronic
1157096554 18:44690541-44690563 CACCATTTATAAATTGAGGAAGG - Intronic
1157257813 18:46154037-46154059 GAGAATTCAAAGATGGAGGAAGG + Intergenic
1157694289 18:49708564-49708586 AAGCATTCACAGACTGATGAAGG - Intergenic
1158212574 18:55067693-55067715 TAGCATTCAGAGATGGAGGATGG - Intergenic
1161759277 19:6159366-6159388 CAGCATTCCCAGCTGGAAGAAGG - Intronic
1161846218 19:6713305-6713327 CTCCCTTCTCAGATTGAGGATGG - Exonic
1164881742 19:31738649-31738671 TAGCTTTCACAGATTCTGGAAGG - Intergenic
1168618434 19:57856880-57856902 AAGCATTGTCAGATAGAGGAAGG - Intronic
1168625069 19:57911726-57911748 AAGCATTGTCAGATAGAGGAAGG + Intronic
926081454 2:9989889-9989911 CAGAATTCACAAAGTGAAGATGG - Intronic
926252471 2:11163286-11163308 CAGAATACACAGAATGAGGTGGG + Intronic
926888404 2:17618355-17618377 CAGAATTTAAAGATGGAGGAGGG - Intronic
929050208 2:37829992-37830014 CAGTTTTCTCAGTTTGAGGAGGG - Intergenic
929726480 2:44434152-44434174 CAGCATACACATAATGAAGACGG - Intronic
932024197 2:68116932-68116954 CAGCATTCAGAGCTCCAGGAAGG + Intergenic
933021477 2:77198913-77198935 CAGCATTTACAGTCTGCGGAAGG - Intronic
933527396 2:83459527-83459549 CAGCATCCACAGATTAATAATGG + Intergenic
933786003 2:85842065-85842087 CAGAGTTCACAGATTCAGGTGGG + Intronic
934646799 2:96063655-96063677 CAACATTCACAGCTGCAGGATGG - Intergenic
934840201 2:97619737-97619759 CAACATTCACAGCTGCAGGATGG - Intergenic
934845867 2:97660991-97661013 CACCATCCACAGACTGAGGGAGG + Intronic
936434254 2:112489980-112490002 CAGTATTCACTGATGGAGAAGGG - Intronic
936717352 2:115203464-115203486 CAGCATGAACAGATTGGAGAGGG + Intronic
937473450 2:122193061-122193083 CTGCATTCCCAGATTCAGGGTGG + Intergenic
937967153 2:127521924-127521946 CAGCATTCAGAGATTAATCATGG - Intronic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
939093565 2:137806335-137806357 AAGCATTCATAGATTTAGGGAGG + Intergenic
939224952 2:139353430-139353452 AAGCATTCAGTTATTGAGGAAGG + Intergenic
939651750 2:144771208-144771230 GAGCATTCACAGCTTCAGGCTGG + Intergenic
940853239 2:158707784-158707806 TAGAAGTCACAGATTCAGGATGG - Intergenic
941287353 2:163630637-163630659 CTGCATTCCCAGATTTAGCAAGG + Intronic
941618843 2:167754527-167754549 CAGATTTCACAGAAAGAGGAAGG + Intergenic
946761160 2:222994514-222994536 CAGGAATCACAGACTGAGGCTGG - Intergenic
948421301 2:237862026-237862048 CAGCATTCCCTGAGTGAAGATGG - Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169997721 20:11577196-11577218 CAGCTTTCTCAGGTTGAGGAAGG + Intergenic
1171135148 20:22688853-22688875 CAGCATGCACAGATGGGGAAAGG - Intergenic
1172587885 20:36097570-36097592 CAGTATTCACAGGTTGGGGGTGG + Intronic
1172681343 20:36718198-36718220 AAGCATTCACATACTGGGGAGGG + Intronic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1176259740 20:64173296-64173318 CAGCAGTCACAGACAGAGGTGGG + Intronic
1179459401 21:41523568-41523590 CAACATCCATACATTGAGGAAGG - Intronic
1180588342 22:16914005-16914027 CAGCAGTCACAGCCTGGGGAAGG - Intergenic
1180855394 22:19041874-19041896 CAGCAGTGACAGGATGAGGAAGG + Exonic
1182604796 22:31494842-31494864 CAGCTTTGACAAATTTAGGAGGG - Intronic
1182720698 22:32396542-32396564 ATGCATTCACATATTGAGAAAGG - Intronic
1184268546 22:43364058-43364080 CTGCATTCAGAGCTTGGGGAAGG + Intergenic
950454794 3:13086246-13086268 CAGAATGGACAGACTGAGGAGGG + Intergenic
950637252 3:14323813-14323835 CAGCACTCACAGACTGATGGAGG + Intergenic
950787729 3:15450065-15450087 CAGCATTGCCAGATGGAGGGAGG - Intronic
951510922 3:23501153-23501175 AAGGATGCACAGAGTGAGGAAGG + Intronic
951993003 3:28696856-28696878 AAGATTTCACAGATTGAGAAAGG - Intergenic
952198993 3:31105942-31105964 CAGGGATCACAGATTGAGGATGG + Intergenic
957156691 3:76552600-76552622 AACCTTTCACAGACTGAGGAAGG + Intronic
961030644 3:123600463-123600485 CAGCATTCAAAGAATTAGGTTGG - Intergenic
961083126 3:124043423-124043445 CAGAAGTAATAGATTGAGGAAGG + Intergenic
961514602 3:127424864-127424886 CAGCATTCACAGTCTGGGGTAGG - Intergenic
964507662 3:157417278-157417300 CAGCATTCCCTGAGTCAGGAAGG - Intronic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
965745236 3:171917987-171918009 CAGCAGTCAATGATTGAGCATGG - Intronic
966077260 3:175952468-175952490 CATGATTCAAAGATTGAGGCAGG - Intergenic
971783980 4:31076783-31076805 CCACATTAACAGATTAAGGAAGG + Intronic
979701997 4:123679753-123679775 CTGCATTCTCAGAATTAGGATGG - Intergenic
980162131 4:129177552-129177574 CTGCATGAAGAGATTGAGGATGG + Intergenic
984080361 4:175241202-175241224 CAGCATTCACAGAAGAAGCAGGG + Intergenic
985428909 4:189858632-189858654 CAGCTTTCACACCTTGTGGAGGG + Intergenic
985750346 5:1670011-1670033 CAGCACTCTCAGCTTGAGGAAGG + Intergenic
985937656 5:3109074-3109096 CAGAATGCACACATCGAGGATGG - Intergenic
986676342 5:10189015-10189037 TAGCATTCCCAGAGTGAGAAAGG - Intergenic
987685455 5:21193767-21193789 CAGCAATCACAGAATGAATATGG - Intergenic
990452768 5:55951504-55951526 CAGCATACACAGATGAAGGTGGG - Exonic
990563625 5:57007667-57007689 CAGCACTCACAAACTGAGAAAGG + Intergenic
991012635 5:61899932-61899954 CAGCATTCAGAGATTCAGTCAGG + Intergenic
992041454 5:72837323-72837345 CAGCATCCTCACATGGAGGAAGG + Intronic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992144764 5:73835081-73835103 CAGCATCCACGGAAGGAGGAGGG + Intronic
994052762 5:95381200-95381222 CAACATTCAGAGGTAGAGGAGGG + Intergenic
994427694 5:99614442-99614464 CAGCATTGACATATTTATGAGGG + Intergenic
995891887 5:116963217-116963239 CAGCAGTCACAGCTGGAGAAGGG - Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
998072094 5:139205900-139205922 CAGCTTTCACTCATGGAGGAAGG - Intronic
998354354 5:141522383-141522405 CAGAACTCACAGGTGGAGGAAGG - Intronic
998919902 5:147056564-147056586 CAGGGTTCACAGATTGATGAAGG - Intronic
999340698 5:150768484-150768506 TAGCATTCACATTTTGTGGAAGG + Intergenic
999689278 5:154132790-154132812 CAGCATTGATTGAGTGAGGAAGG + Intronic
1000451341 5:161391848-161391870 CAGCATTCACTGATCTAAGAAGG + Intronic
1001284966 5:170416153-170416175 CAGCCTTCCCAGAGTGAGGCTGG - Intronic
1002467616 5:179415516-179415538 CAGTTTTCACTGAATGAGGAAGG + Intergenic
1003011008 6:2427577-2427599 CAGCCTCCACAGAGTGGGGAGGG + Intergenic
1003752238 6:9072144-9072166 TGGAATTGACAGATTGAGGATGG + Intergenic
1005488115 6:26320364-26320386 CAGCCTTCTAAGATGGAGGAAGG + Intergenic
1007167957 6:39841545-39841567 CATCGTTCACAACTTGAGGAGGG + Intronic
1007301223 6:40869359-40869381 CAGGACTCAGAGAGTGAGGAGGG + Intergenic
1010138881 6:72589110-72589132 CACCACACACAGGTTGAGGAAGG + Intergenic
1013893771 6:115059336-115059358 CAGAACTCACAGACTGAGCAGGG - Intergenic
1014777803 6:125530424-125530446 CAGCAATCACAGATTGAGATGGG + Intergenic
1016839941 6:148516179-148516201 CAGGCTTCACAGATGGAAGATGG + Intronic
1016938872 6:149468480-149468502 AAGCAGTCACATATGGAGGAAGG + Intronic
1019056898 6:169230445-169230467 CAGCACTTACAGATTAAGAAAGG + Intronic
1019267665 7:127458-127480 CAACATCCACAGATTCAGCAGGG - Intergenic
1024684099 7:51726255-51726277 GAGCATTCACACACAGAGGAGGG + Intergenic
1024923692 7:54588812-54588834 CAGCAGTTACAGATTGGAGATGG + Intergenic
1029916881 7:104219344-104219366 AAGCAGTCACAGATTGATGATGG - Intergenic
1031489181 7:122366759-122366781 CTGGATTCACAGAAAGAGGATGG - Intronic
1032049921 7:128642102-128642124 CAGAATTCAAAGACTTAGGAGGG - Intergenic
1032186277 7:129729453-129729475 TGGCAGTCACAGACTGAGGATGG - Intronic
1032456435 7:132076522-132076544 CAGCATTCACAGGAAGAGGAAGG - Intergenic
1034164091 7:149012557-149012579 CAGCATTCACACACTGGGGGTGG + Intronic
1036067307 8:5396200-5396222 CGGCATTCTCACATGGAGGAAGG + Intergenic
1036280291 8:7394324-7394346 AAGAATTCACAGTTTGAGGCAGG + Intergenic
1036341236 8:7917559-7917581 AAGAATTCACAGTTTGAGGCAGG - Intergenic
1036402736 8:8424877-8424899 CAGCAATCCCAGATTGACAAAGG - Intergenic
1039958924 8:42229709-42229731 CAGCATTTACAGATTGCACATGG + Intergenic
1042613137 8:70619576-70619598 CAGCAATCACAGATAGAGGAAGG + Intronic
1042670613 8:71258894-71258916 CAGCTTACAAACATTGAGGAAGG + Intronic
1042798370 8:72689068-72689090 TAACTTTCACATATTGAGGAAGG + Intronic
1045683120 8:104683637-104683659 CATCATCCACAGATTGTGGGAGG + Intronic
1046906972 8:119583856-119583878 CAGTATTCATAAATAGAGGAAGG - Intronic
1046950694 8:120016907-120016929 CAGAATTCATACATTGAGGTTGG - Intronic
1047132157 8:122033601-122033623 GAGCATCCCCAGATTGAGGGTGG + Intergenic
1049582733 8:143420220-143420242 AAGCCTTCTCAGATTGACGAAGG + Intronic
1050683629 9:8142356-8142378 CAGCATTCCAAGAATGTGGAAGG + Intergenic
1051508238 9:17848384-17848406 CTGAATTCTCAGATTGTGGAAGG - Intergenic
1055077106 9:72227481-72227503 CAGCTTTCACATACTGAGAAGGG + Intronic
1055150828 9:72997411-72997433 CAGCATTTACAAACTGAGTATGG - Intronic
1055718059 9:79140501-79140523 TTGCATTCACAGAGTGAGGTAGG + Intergenic
1059037356 9:110769431-110769453 CAGCATTGACAGAATAAGAAGGG + Intronic
1059670448 9:116485958-116485980 CAAGGTTCACAGATTGTGGAAGG + Intronic
1062391282 9:136334921-136334943 CAGCAGTTACAGTTTGAGGAGGG + Intronic
1185870109 X:3657791-3657813 CAGCAATGAGAGATTGAGGAAGG + Intronic
1187950601 X:24466244-24466266 CGGCTTTCACGGATTGAGGTGGG + Intronic
1188848573 X:35104094-35104116 GTGCATTCCCAGATTGAGGATGG - Intergenic
1191069694 X:56386898-56386920 CAGCATTTAAAAATTGAGTAAGG - Intergenic
1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG + Intronic
1193774740 X:85628169-85628191 CATCATCCCCAGGTTGAGGAGGG - Intergenic
1195574938 X:106439023-106439045 CAGATTCCACAGATTGGGGAGGG - Intergenic
1196003114 X:110807603-110807625 CACCTTTTACAGGTTGAGGAAGG + Intergenic
1197947988 X:131861497-131861519 CAGTATCCACAGAGTGATGAAGG + Intergenic
1198080273 X:133233208-133233230 CAGCATTCAAGGATCCAGGAAGG + Intergenic
1200037184 X:153339423-153339445 CAGCATTCGGAGATTGAGGTGGG + Intronic
1200142882 X:153910496-153910518 CAGCACTCACTGGTTGAGGAAGG + Exonic