ID: 918217528

View in Genome Browser
Species Human (GRCh38)
Location 1:182405628-182405650
Sequence AGTTTTAAGGGGATCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918217528_918217535 -2 Left 918217528 1:182405628-182405650 CCCTCCATGATCCCCTTAAAACT No data
Right 918217535 1:182405649-182405671 CTTCAGCCCAAAATTCCTCAGGG No data
918217528_918217538 12 Left 918217528 1:182405628-182405650 CCCTCCATGATCCCCTTAAAACT No data
Right 918217538 1:182405663-182405685 TCCTCAGGGAGATAGATTTGAGG 0: 3
1: 30
2: 68
3: 163
4: 336
918217528_918217534 -3 Left 918217528 1:182405628-182405650 CCCTCCATGATCCCCTTAAAACT No data
Right 918217534 1:182405648-182405670 ACTTCAGCCCAAAATTCCTCAGG No data
918217528_918217540 13 Left 918217528 1:182405628-182405650 CCCTCCATGATCCCCTTAAAACT No data
Right 918217540 1:182405664-182405686 CCTCAGGGAGATAGATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918217528 Original CRISPR AGTTTTAAGGGGATCATGGA GGG (reversed) Intergenic
No off target data available for this crispr