ID: 918220775

View in Genome Browser
Species Human (GRCh38)
Location 1:182434431-182434453
Sequence CCATATTACCTTAATGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918220775_918220778 5 Left 918220775 1:182434431-182434453 CCCTGCTCATTAAGGTAATATGG 0: 1
1: 0
2: 0
3: 11
4: 121
Right 918220778 1:182434459-182434481 CATGACCACACTTAAGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918220775 Original CRISPR CCATATTACCTTAATGAGCA GGG (reversed) Intergenic
904900472 1:33853303-33853325 CCTTATCACCTTGATGAGAATGG - Intronic
905378828 1:37545155-37545177 ACACATTACCTGAATGAGCAGGG + Intronic
906079469 1:43075018-43075040 CTATATTACATTAAGGAGAAAGG - Intergenic
907621472 1:55985431-55985453 CCATATTACCTGGAAGAGGATGG - Intergenic
909154696 1:72058602-72058624 CAATATTATCTTGATGAGCTAGG + Intronic
909627533 1:77734495-77734517 CCAAATTACATTAAGGACCACGG + Intronic
910733162 1:90421085-90421107 CCATATTTCCTTAAGGTCCAAGG - Intergenic
911293633 1:96086963-96086985 CCATAGAAGCTTAACGAGCAAGG - Intergenic
912305529 1:108562291-108562313 CCTAATGACTTTAATGAGCAAGG + Intronic
917478628 1:175390828-175390850 TCATATTAACTTAATGAAGAAGG + Intronic
918220775 1:182434431-182434453 CCATATTACCTTAATGAGCAGGG - Intergenic
918428916 1:184438206-184438228 CTATATTACCTTCATCAGGAAGG - Intronic
919348960 1:196423821-196423843 TCATATTATCTTAATAACCATGG - Intronic
923967576 1:239158819-239158841 CGCTGTTACCTGAATGAGCATGG - Intergenic
1067842894 10:49695979-49696001 CCATTTTTCTTTAATGAGAATGG - Intronic
1068068077 10:52157930-52157952 ACATAATACTTTAAGGAGCATGG - Intronic
1068357935 10:55935554-55935576 CTATATTAGCCTAATGAGAAAGG + Intergenic
1068931986 10:62600278-62600300 CCATATAAAATTAATGAGGATGG + Intronic
1069666112 10:70160766-70160788 CAATATTACCCTATTGAGCTGGG - Intronic
1071987354 10:91065608-91065630 CTAGCTTACCTTAAAGAGCATGG + Intergenic
1075508512 10:123048392-123048414 CCATATTAGCTTTATGACCTTGG - Intronic
1076253819 10:129004313-129004335 CCATATTCCCTGAATGATAAAGG + Intergenic
1078716075 11:13840093-13840115 CCCTATGACATTAGTGAGCAAGG - Intergenic
1082857235 11:57818997-57819019 CCATATTACCTGGATTACCAGGG + Exonic
1088663185 11:112068908-112068930 CTATATTGCCTTAATCAGCTTGG - Intronic
1089615750 11:119693772-119693794 CCAAATTAGCTTAATGAGTGAGG + Intronic
1092060339 12:5545722-5545744 CCATATCACCTTAAAAAGGAGGG - Intronic
1095924318 12:47563417-47563439 CCATTTTCCCTTAATCAGGAGGG - Intergenic
1095924490 12:47564619-47564641 CCATATTCCCTTAAACAGGAGGG + Intergenic
1102631314 12:114283094-114283116 CAATATCACTTTGATGAGCAAGG - Intergenic
1105341779 13:19533107-19533129 CCATATTAACTAAATGATAATGG - Intronic
1108994777 13:56714586-56714608 CTATATTACCTTTATTTGCATGG + Intergenic
1109326314 13:60871337-60871359 CCATATTACCAGCATCAGCATGG - Intergenic
1113242222 13:108350602-108350624 CCAGATTACCATAAAGAGGATGG - Intergenic
1115025493 14:28740278-28740300 AAATATTGCCTTAATGAACAGGG + Intergenic
1115466305 14:33718181-33718203 CCTTATTTCCTTAATGTGCCTGG + Intronic
1116342454 14:43741677-43741699 GCATCTTACTTTCATGAGCAAGG - Intergenic
1119959531 14:78838946-78838968 GCAAATAACCTAAATGAGCAAGG - Intronic
1120604781 14:86560820-86560842 GCATATTACCATCATGAGAATGG - Intergenic
1122031337 14:98914929-98914951 CCATGTTACCATAATTAACATGG + Intergenic
1122219063 14:100223856-100223878 CCATATTCCCCTGATCAGCATGG - Intergenic
1122427190 14:101617941-101617963 CCATTTTATCTTTATGAGCTGGG - Intergenic
1124953310 15:34343042-34343064 CAGTATTACCTCAACGAGCAGGG - Exonic
1126528950 15:49690317-49690339 CCATATTGTCTTAATGATCCTGG - Intergenic
1128442047 15:67719298-67719320 CCACAGTACCTTAATGAACATGG - Intronic
1129909878 15:79218073-79218095 CCAGTTTACCTTTATGTGCAAGG - Intergenic
1136864857 16:33739364-33739386 AAATATTACCTTACTGTGCATGG - Intergenic
1203126354 16_KI270728v1_random:1587504-1587526 AAATATTACCTTACTGTGCATGG - Intergenic
1143728828 17:8868324-8868346 CCTTATTACTTTAAAGAGAATGG + Intergenic
1148464045 17:47853967-47853989 TGATGTTAACTTAATGAGCAAGG + Intronic
1149350084 17:55777749-55777771 CCAGATGACCATAATGAGCAGGG - Intronic
1156010557 18:32492839-32492861 CCATTTTAGCTTAATGATCATGG - Intergenic
1157797701 18:50590234-50590256 GCATCTTACCTTCATGACCAAGG - Intronic
1158171901 18:54609622-54609644 CCATCTTACCTTTACGAGAATGG + Intergenic
1159159183 18:64621549-64621571 CCATTTTTCCTTAACGAGTATGG + Intergenic
1159763590 18:72458855-72458877 CCATAGGACATTAATGACCAGGG + Intergenic
1159932104 18:74323745-74323767 CAATATAACATTAATGAGAAAGG + Intronic
1166607986 19:44162435-44162457 CCATGCTACCTCAATGTGCATGG + Intergenic
1168462300 19:56569217-56569239 CCATGTTTCCTTAATTAGGAAGG - Intronic
926360890 2:12085555-12085577 ACATATTAACTTTATGATCATGG - Intergenic
926655190 2:15396361-15396383 ACAAATTCCCTTAATAAGCATGG + Intronic
931161904 2:59702171-59702193 CCATATTCCCTTAAGGACCAAGG + Intergenic
934132586 2:88963139-88963161 CCAAATGCCATTAATGAGCAGGG - Intergenic
936932206 2:117801668-117801690 CGATATTAGATTAATGAGAAGGG - Intergenic
937468636 2:122156407-122156429 CCAGATTACGTTAATGAGGAGGG + Intergenic
942787278 2:179714293-179714315 CCATGATACCTTCATAAGCAAGG + Intronic
943020778 2:182570954-182570976 CCATATCAACTCAATGAGCTAGG - Intergenic
945443657 2:209910543-209910565 CCATGTTACCTTAGGAAGCATGG - Intronic
946273800 2:218615693-218615715 CCAGATCACCTAAAGGAGCAAGG - Exonic
948664796 2:239528211-239528233 CCATATTGCCTTCACCAGCAGGG - Intergenic
1170141014 20:13124913-13124935 CCAAATCACCTTCATGAGGAAGG + Intronic
1173292598 20:41727667-41727689 CCACACTACCTTTATGAGCCAGG - Intergenic
1175526891 20:59640567-59640589 CCATGTCATCATAATGAGCAGGG - Intronic
1177944717 21:27453739-27453761 ACATAGTACCTTAATGTGCTAGG - Intergenic
1182938921 22:34255163-34255185 CCATATTTCCTCAGTGAGCAGGG - Intergenic
1183840081 22:40492224-40492246 CCACTTTAACTTAAAGAGCAGGG - Intronic
949390946 3:3561598-3561620 GCCTATAACCTAAATGAGCAAGG - Intergenic
951165292 3:19478466-19478488 CCATCTTACATTAGTGAGAATGG - Intronic
952522571 3:34175895-34175917 CCATATTACCTTCATGTGACAGG - Intergenic
958106976 3:89087734-89087756 CCATTTTATCTTAAAGAGAACGG - Intergenic
962494806 3:135928614-135928636 CCAGTTTTCCTTCATGAGCAGGG - Intergenic
964847990 3:161064453-161064475 GAATATGACCTTAATGAGGAAGG + Intronic
965437848 3:168674667-168674689 CCATAGCACCTTCAGGAGCATGG - Intergenic
966109238 3:176377858-176377880 CCATATTACCTAAATGAACTCGG + Intergenic
971540510 4:27810902-27810924 ACATTTTATCTTGATGAGCATGG - Intergenic
977382432 4:96292657-96292679 CCATATTACCATAATAAGTCGGG + Intergenic
977483848 4:97616310-97616332 CAATGTAACCTTAATTAGCAAGG + Intronic
984845470 4:184104460-184104482 CCATCCTACCTTTGTGAGCATGG + Intronic
985701177 5:1373841-1373863 CCATTTTTCTTTAATCAGCAGGG - Intergenic
989622615 5:43399716-43399738 CCTTATTACTTCAATGTGCAGGG - Intronic
992243907 5:74797926-74797948 ATATATAAGCTTAATGAGCATGG + Intronic
995272268 5:110235294-110235316 CCATATTACCTTAAAGCCCAAGG - Intergenic
996807326 5:127470911-127470933 CGATCTTACCTTAATGTGGATGG + Intergenic
997576741 5:134984521-134984543 CCATATGACACTAATCAGCATGG + Intronic
1001395333 5:171415355-171415377 CAGTACTAGCTTAATGAGCAAGG + Intergenic
1002966245 6:1969458-1969480 CCATAACACATTAATGAGTAAGG + Intronic
1005351081 6:24936215-24936237 TCATATTTCCTTAAAGAGGAAGG + Intronic
1005451790 6:25980941-25980963 TCATATTACCTGAATGACCCAGG - Intronic
1008345078 6:50416745-50416767 CCTTATTGCCATAAAGAGCAAGG + Intergenic
1008721237 6:54356118-54356140 CCATATAACCTTAAAAAGTAGGG - Intronic
1009281085 6:61752706-61752728 GAATATGACCTCAATGAGCATGG - Intronic
1012169355 6:95999578-95999600 CTAACTAACCTTAATGAGCAAGG + Intergenic
1012424898 6:99103078-99103100 AAATGTTACCTTAATGAGAAAGG + Intergenic
1014508845 6:122294992-122295014 CCTTATGACCTCACTGAGCAGGG + Intergenic
1016180901 6:141147320-141147342 CCATATTAACTAAGTGATCAAGG - Intergenic
1016353610 6:143194464-143194486 CCCTATTATGTTGATGAGCACGG + Intronic
1017700438 6:157064277-157064299 CAAAGTTACCTTAAAGAGCAAGG - Intronic
1023702471 7:42905980-42906002 CCATATTACCTTTTAGAGCACGG + Intergenic
1024106421 7:46092278-46092300 GCAAATAACCTTGATGAGCATGG - Intergenic
1027404245 7:77842892-77842914 CTATATAAAATTAATGAGCATGG + Intronic
1027729419 7:81851200-81851222 CTATATTACTTTTATTAGCATGG - Intergenic
1027865826 7:83645305-83645327 CAATATTACCCTATTGAGCTGGG + Intronic
1028419681 7:90618978-90619000 AAATATTAACTTAATGAGCTTGG - Intronic
1031075266 7:117206334-117206356 AAATATTACCTTGATGTGCAAGG + Intronic
1032023759 7:128424949-128424971 CCATATTAGCTATATGACCATGG + Intergenic
1034997058 7:155584228-155584250 CCACATTACCTTAAGGATAAGGG + Intergenic
1037502101 8:19496126-19496148 CCATATTATCTTAAAAAGTAAGG - Intronic
1037693095 8:21199593-21199615 CCATATTTCCTTAGTAAACAGGG + Intergenic
1043851118 8:85218011-85218033 CCATATTACCTCTATGTGAACGG + Intronic
1047339599 8:123967972-123967994 TCTTATTATCTTAATGAGAATGG + Intronic
1047441313 8:124880833-124880855 CCATATTTTCTTTATGAACATGG + Intergenic
1047897130 8:129378781-129378803 AAATATTACCTTAATGTGCTAGG - Intergenic
1051161657 9:14214939-14214961 CCACATTTTCTTAATGGGCATGG - Intronic
1051411898 9:16798337-16798359 CCAAATTACCTAAATTAGAATGG - Intronic
1057967992 9:99523215-99523237 CCATCTGACATGAATGAGCAAGG - Intergenic
1060213621 9:121725319-121725341 CCATATTCCCCTAACGAGCCAGG + Intronic
1060327617 9:122632800-122632822 TCATATTATCTTTATCAGCAGGG - Intergenic
1186857536 X:13640359-13640381 CCATCTCACCGTAATCAGCAAGG - Intergenic
1190644227 X:52509998-52510020 CCATATTATCTGAATGACCAAGG + Intergenic
1193856467 X:86609971-86609993 CCATATTTACTTAATGACCTGGG + Intronic
1194862386 X:99016761-99016783 CAATATTACCTTTATATGCATGG + Intergenic
1198987196 X:142468607-142468629 CCATAGTAACTAAAAGAGCATGG + Intergenic
1202590524 Y:26478516-26478538 CCATATTAACTAAATGATAATGG + Intergenic