ID: 918225163

View in Genome Browser
Species Human (GRCh38)
Location 1:182474553-182474575
Sequence AGATATAACTTATTTCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 283}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918225163_918225167 28 Left 918225163 1:182474553-182474575 CCTCACAGAAATAAGTTATATCT 0: 1
1: 0
2: 1
3: 25
4: 283
Right 918225167 1:182474604-182474626 TCCCATCTGGTCACCTATACTGG 0: 1
1: 0
2: 0
3: 6
4: 77
918225163_918225166 15 Left 918225163 1:182474553-182474575 CCTCACAGAAATAAGTTATATCT 0: 1
1: 0
2: 1
3: 25
4: 283
Right 918225166 1:182474591-182474613 AACTGACTAAAAATCCCATCTGG 0: 1
1: 0
2: 1
3: 11
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918225163 Original CRISPR AGATATAACTTATTTCTGTG AGG (reversed) Intronic
900997852 1:6132009-6132031 AGATGGAACTTAATTCTGTGTGG - Intronic
907038810 1:51239493-51239515 AGACAGATCTTATTTCTTTGGGG - Intronic
907636878 1:56144182-56144204 CCAGATAACTTATTTTTGTGGGG - Intergenic
907649301 1:56279249-56279271 AGATTTAACATAATTCTGAGGGG + Intergenic
908368210 1:63449182-63449204 AGATATTGATTATTTGTGTGTGG - Intronic
909045042 1:70699513-70699535 AGATATAACATTTTTCTGCCTGG - Intergenic
909127682 1:71695196-71695218 AGATATCAGTTATATATGTGTGG + Intronic
910162957 1:84293584-84293606 TGATATAACTTAAAACTGTGTGG + Intergenic
910740948 1:90515629-90515651 ATATGTGACTTATTTCCGTGGGG - Intergenic
910989589 1:93041351-93041373 AGAAATAACAAAATTCTGTGAGG - Intergenic
911171687 1:94776669-94776691 AGATGCAACTAATGTCTGTGTGG + Intergenic
911471946 1:98330028-98330050 GGTTATAACTTATTTCTCTGAGG - Intergenic
915850065 1:159312066-159312088 TGATATAGTTTGTTTCTGTGAGG - Intergenic
916393121 1:164354528-164354550 AGTTATAACTTTTTTTAGTGGGG - Intergenic
916927825 1:169541570-169541592 ACATTTGACTTATATCTGTGGGG + Exonic
917071451 1:171155733-171155755 AGAGATCACTTTTTACTGTGAGG - Intronic
918225163 1:182474553-182474575 AGATATAACTTATTTCTGTGAGG - Intronic
918769740 1:188541243-188541265 AGAAATGACTCATTTCTGTCTGG + Intergenic
919354910 1:196509607-196509629 GGATAGAAATTATTTCTGTGAGG + Intronic
921805663 1:219451509-219451531 ATATATTACTTATTTCTTTTAGG + Intergenic
921809085 1:219491427-219491449 TGAGGTAACCTATTTCTGTGAGG + Intergenic
923477295 1:234346019-234346041 AAAAATAACTAAATTCTGTGGGG - Intergenic
924617541 1:245625601-245625623 AGTTATCACTTATTTGTGTTGGG + Intronic
924673930 1:246156472-246156494 ATATAGAACTTATTTTTATGGGG - Intronic
1062805098 10:413579-413601 AGATTCCATTTATTTCTGTGCGG + Intronic
1063061216 10:2555267-2555289 ATATATAATTTCTTTCTTTGAGG - Intergenic
1063110076 10:3027867-3027889 AGAACTCACTTATTACTGTGAGG - Intergenic
1064729215 10:18312427-18312449 TGATATAAATTATTCCTTTGTGG - Intronic
1068489014 10:57698347-57698369 AGATAAAACTGATTTTTGTGCGG - Intergenic
1068525647 10:58126458-58126480 AGATAAAACTTTTTTTTCTGTGG - Intergenic
1069214563 10:65803585-65803607 AGAAACAACCTGTTTCTGTGTGG - Intergenic
1071038246 10:81274190-81274212 ATTTATAACTTATTTCTGATTGG + Intergenic
1073134211 10:101211060-101211082 ATATGTAACTGATCTCTGTGGGG - Intergenic
1073709883 10:106024111-106024133 AGATAGAAACTATTTCTGTTTGG + Intergenic
1073906159 10:108282312-108282334 AAATATAATTTATTTCCATGAGG + Intergenic
1073980424 10:109147602-109147624 AGATATATTTTATGTATGTGTGG - Intergenic
1074010138 10:109470119-109470141 AGAAATAATTTAGTTCTGTTTGG + Intergenic
1074938616 10:118212654-118212676 AGATATAAATTCTTCCTGGGAGG - Intergenic
1078009519 11:7561603-7561625 AGATCTTATTTTTTTCTGTGAGG + Intronic
1078864414 11:15283170-15283192 AGCTTGAACTTATATCTGTGAGG + Intergenic
1078877257 11:15411137-15411159 ACATATACCTCATTTCTGTGAGG + Intergenic
1080175815 11:29361626-29361648 AAATATAACTTGTCTCTTTGGGG - Intergenic
1080580945 11:33643268-33643290 ATATATAACATATATATGTGTGG + Intronic
1081585639 11:44381955-44381977 AGAAATAACTTTTTTTAGTGGGG + Intergenic
1083562453 11:63683688-63683710 TGACATAACATATTTCTGTTTGG + Intronic
1084065115 11:66699594-66699616 AGACAGAACATATTCCTGTGTGG + Exonic
1086234115 11:84607305-84607327 AGATAGAACTTATTTCCACGAGG + Intronic
1087460766 11:98444038-98444060 ATACATTACTTATTTGTGTGGGG + Intergenic
1088085477 11:105973572-105973594 AGAAATAAGTTATTTATGTATGG - Intronic
1088652496 11:111970443-111970465 AGATATTTCTTTTTTGTGTGTGG - Intronic
1088831811 11:113543286-113543308 AGATGTAAATAACTTCTGTGAGG + Intergenic
1089915371 11:122150326-122150348 AGATATTAATTATTCCTTTGAGG - Intergenic
1090499619 11:127248684-127248706 GGATAAAAGTTATTTCTGTTTGG + Intergenic
1092258961 12:6942218-6942240 ATATATAAATTATTAGTGTGGGG - Exonic
1092720428 12:11435463-11435485 ATATATAAATAATTTTTGTGGGG + Intronic
1092977484 12:13759343-13759365 AGGCATGCCTTATTTCTGTGAGG - Intronic
1093136904 12:15462535-15462557 ATTTGTAACTTATCTCTGTGAGG + Intronic
1093140523 12:15505260-15505282 ACACATAACTTATTAGTGTGTGG + Intronic
1093213378 12:16333890-16333912 AGGTATATCTAATTTCTGTAAGG - Intergenic
1093860829 12:24165140-24165162 ACATTTGCCTTATTTCTGTGAGG + Intergenic
1094477044 12:30848664-30848686 AGATATAACATTTCTCTTTGGGG - Intergenic
1095172458 12:39052014-39052036 ATTTTTAATTTATTTCTGTGTGG - Intergenic
1096910586 12:54979991-54980013 ACAAATAACGTATCTCTGTGAGG - Intronic
1097312697 12:58138190-58138212 AGTTATTTCTTTTTTCTGTGTGG + Intergenic
1097677970 12:62623291-62623313 AGAACTCACTTATTACTGTGGGG + Intergenic
1098553567 12:71792817-71792839 AGATATAAGTAATTTATCTGGGG + Exonic
1098571728 12:71995477-71995499 GGAGAAAACTTATTTCTGGGTGG - Intronic
1099197076 12:79629650-79629672 ACATATAGTTTATTTTTGTGGGG - Intronic
1103594868 12:122018526-122018548 AAATATAAATTATTTCTAGGGGG + Intergenic
1103889793 12:124229682-124229704 AGATGTAGCTCATTTCTCTGGGG + Intronic
1104781394 12:131422719-131422741 AGGTAGAAATTATTTCTGGGTGG + Intergenic
1107230352 13:38102311-38102333 AGACATAACTGATTTTTCTGTGG + Intergenic
1108804941 13:54142821-54142843 AGATATAATCTTATTCTGTGAGG - Intergenic
1109959172 13:69608269-69608291 AGATATAACTCATTTTTGGGGGG - Intergenic
1110417392 13:75268182-75268204 ATATAGAATTTTTTTCTGTGGGG - Intergenic
1111231781 13:85353879-85353901 ATATTTTACTTCTTTCTGTGGGG - Intergenic
1111725210 13:91998862-91998884 TCATATAACTCAGTTCTGTGTGG - Intronic
1112656997 13:101462007-101462029 TGAGATAATTTAGTTCTGTGTGG + Intronic
1115006458 14:28491519-28491541 AGAGATAGCTGAATTCTGTGTGG + Intergenic
1115164528 14:30432890-30432912 AGATTTAACTTTTTTCTCGGAGG - Intergenic
1116157489 14:41225640-41225662 AGATATAATTTTCTTCTTTGTGG - Intergenic
1116574191 14:46552147-46552169 TGATTTAACTTATTTCAGTCTGG - Intergenic
1116643934 14:47502405-47502427 AGACAGAATTTAGTTCTGTGAGG - Intronic
1116803881 14:49472359-49472381 TGATATAACTACTTTGTGTGTGG + Intergenic
1118450780 14:65900083-65900105 AGAACTAACTCATTACTGTGAGG - Intergenic
1119139090 14:72248980-72249002 TGATAAAACTTATTTCTGTAGGG + Intronic
1121464594 14:94106870-94106892 AGAGCTAACTCATTACTGTGAGG + Intronic
1121694387 14:95900892-95900914 AGATGTAGCTCATTTATGTGCGG + Intergenic
1123686720 15:22803402-22803424 ATATATAACATATATCTGTATGG - Intronic
1124028725 15:25990002-25990024 AAATAGATCGTATTTCTGTGGGG - Intergenic
1127312469 15:57765004-57765026 AGATATATTTTATTTATATGTGG + Intronic
1127850514 15:62908128-62908150 AAATATATAGTATTTCTGTGTGG + Intergenic
1127901233 15:63342402-63342424 AGATTTAACTTTTTTCTGACTGG + Intronic
1127939103 15:63675608-63675630 ACTTATAACTTATTTCAGTGAGG + Intronic
1128040131 15:64564681-64564703 AAGTATAACCTATTTCAGTGTGG + Intronic
1130865419 15:87929523-87929545 AAATTTTATTTATTTCTGTGGGG - Intronic
1135195981 16:20395043-20395065 ATATATAATTTATTTCTTTAAGG + Intronic
1138077716 16:54058658-54058680 AGGTATAACTGATTTAAGTGGGG + Intronic
1138881847 16:61026163-61026185 AGATATATGTTCTTTCTTTGAGG - Intergenic
1140265154 16:73414262-73414284 AGGTAGAAATTATCTCTGTGTGG - Intergenic
1140422568 16:74832638-74832660 AGATAAATCTTGGTTCTGTGAGG + Intergenic
1141707483 16:85675348-85675370 AAAAATAACTTGTTTCAGTGAGG - Exonic
1142907894 17:3058750-3058772 AAAGATAGCTTATATCTGTGAGG - Intergenic
1142926669 17:3245516-3245538 AAAGATAGCTTATATCTGTGAGG + Intergenic
1142953437 17:3503714-3503736 ATCTATAACATATTGCTGTGTGG + Intronic
1146933872 17:36797804-36797826 TTATATTACTTTTTTCTGTGTGG + Intergenic
1147163823 17:38582818-38582840 AGATTTAACTTCTTTCTGCAGGG + Intronic
1149123886 17:53204410-53204432 AGATAAAGATTATTTTTGTGTGG + Intergenic
1150038360 17:61829672-61829694 AGTTCTAATTTATTTTTGTGTGG - Intronic
1151114307 17:71716677-71716699 AGTTAAAAGTTATTTCTCTGAGG - Intergenic
1153138355 18:1943087-1943109 AGAACTCACTTATTACTGTGAGG - Intergenic
1153909142 18:9691201-9691223 AGTTATTTATTATTTCTGTGTGG - Intergenic
1155417902 18:25620657-25620679 AGATATCACTCATATCTGTTAGG - Intergenic
1157249795 18:46084825-46084847 AGAAATAACTGTTTTCTGTCAGG - Intronic
1157255886 18:46138860-46138882 TGAGATAACTTTTTGCTGTGAGG - Intergenic
1158072058 18:53483108-53483130 AATTATAACTTATTTCTTTAAGG + Intronic
1163229336 19:15989636-15989658 ATATATGACTTCTTTCTGGGGGG + Intergenic
1164697249 19:30254802-30254824 TGATGAAAATTATTTCTGTGGGG - Intronic
1165562185 19:36689181-36689203 AGATAAAGTTTTTTTCTGTGTGG - Intronic
1166089837 19:40501694-40501716 AAGTATAGCTTATTTCTCTGCGG + Intronic
1166833275 19:45651153-45651175 AGATATAAATTATATATGAGTGG + Intergenic
1166912918 19:46173631-46173653 AGAACTCACTTATTACTGTGAGG + Intergenic
1167815025 19:51872561-51872583 AGATATAATTTATTACTGATGGG + Exonic
1168182936 19:54675404-54675426 AGATATAACATTTTCCTTTGGGG - Intronic
928824608 2:35404893-35404915 AGAATTAACTTATCTCTGTATGG - Intergenic
929202690 2:39253888-39253910 GGAGTTAAATTATTTCTGTGAGG + Intronic
929318692 2:40513564-40513586 AGACATAACTCATTTTGGTGTGG + Intronic
929419459 2:41776016-41776038 AGAACTCACTTATTACTGTGGGG - Intergenic
929467904 2:42162281-42162303 ATATCTGACTTATTTTTGTGTGG + Intergenic
931291629 2:60879351-60879373 AGATATAAAATATTTTTGTATGG - Intergenic
933098600 2:78221610-78221632 AGATATAGTTTATTTTTGAGTGG + Intergenic
933565771 2:83948657-83948679 AGATATAACTTTTCTATTTGAGG + Intergenic
933640035 2:84749038-84749060 AGAACTCACTCATTTCTGTGGGG + Intronic
934162456 2:89264606-89264628 ATATATAAAATATTTATGTGTGG + Intergenic
934204818 2:89918110-89918132 ATATATAAAATATTTATGTGTGG - Intergenic
937450264 2:121996454-121996476 AGAACTCACTTATTACTGTGAGG + Intergenic
938327172 2:130417261-130417283 ATATTTAACTGATTTTTGTGGGG + Intergenic
938439156 2:131310828-131310850 ATATTTAACTGATTTTTGTGGGG - Intronic
939606309 2:144259023-144259045 AGGAATAACTTGTTTCTTTGGGG - Intronic
940959459 2:159767401-159767423 AAATATAAATTACTTTTGTGGGG + Exonic
942763244 2:179425201-179425223 AGGTATAACTTACTGCTTTGGGG - Intergenic
942812388 2:180014267-180014289 AGAACTCACTCATTTCTGTGGGG - Intergenic
943489902 2:188538191-188538213 AGATATAACTAAAATCTGAGTGG - Intronic
943574948 2:189620435-189620457 AGATGCAAATTATTTCTGTCTGG - Intergenic
943638526 2:190333329-190333351 AGTTATTAGTTACTTCTGTGAGG - Intronic
945557581 2:211298430-211298452 AGGTATAATTTATTTTGGTGTGG + Intergenic
946932492 2:224684388-224684410 AGAACTAACTCATTACTGTGAGG - Intergenic
947511374 2:230757500-230757522 ATATATAAAATACTTCTGTGTGG - Intronic
1169163262 20:3401136-3401158 AGAGATAACTAACCTCTGTGAGG + Intronic
1169292033 20:4361108-4361130 AGATTGGACTCATTTCTGTGTGG + Intergenic
1170685082 20:18562525-18562547 AGAACTCACTCATTTCTGTGAGG - Intergenic
1170934008 20:20794245-20794267 AGATATAATTTATTTAGATGAGG - Intergenic
1172475379 20:35233431-35233453 AGATATAACTGACTCCTGAGTGG - Intronic
1177910671 21:27027040-27027062 AGATAAAGTTTATTTCTGTTAGG - Intergenic
1179028048 21:37696413-37696435 AGATTTAGGTTATGTCTGTGGGG - Intronic
1180110883 21:45649431-45649453 ACTTAGAACTTATTTTTGTGTGG + Intronic
951786647 3:26427730-26427752 AGAAATAACTTATTTCATTTTGG - Intergenic
951942821 3:28099777-28099799 TGGTATTACATATTTCTGTGAGG + Intergenic
952057042 3:29460065-29460087 AGAATTAACTTTGTTCTGTGTGG - Intronic
952312696 3:32204758-32204780 AGATGTAAATAATTTCTGTCTGG - Intergenic
952586744 3:34902232-34902254 AAATATAACTTATTTCTACATGG - Intergenic
954079822 3:48207094-48207116 GGAGATAACTCATTTCAGTGGGG + Intergenic
956156059 3:66298433-66298455 AAATATGATTTATTTCTTTGTGG + Intronic
956307440 3:67841360-67841382 ACATATAGATGATTTCTGTGGGG + Intergenic
957951862 3:87137622-87137644 AGAGATAAATTGTTTTTGTGTGG + Intergenic
957963386 3:87289804-87289826 ACATTAAACTTATTTCTTTGAGG - Intergenic
959423302 3:106154238-106154260 AGATAGAACTTTTTTCTGTAGGG + Intergenic
960131934 3:114066127-114066149 TGATGTAACTTATTTGGGTGAGG + Intronic
960831562 3:121854908-121854930 ATATAGGAGTTATTTCTGTGTGG + Intronic
963626111 3:147675802-147675824 AGAAAAATCTTATTACTGTGTGG + Intergenic
963885210 3:150573821-150573843 ATAAAAAACTTTTTTCTGTGAGG - Intronic
964114619 3:153122939-153122961 AGATATTTCTTTTTTGTGTGAGG + Intergenic
965533238 3:169797891-169797913 TTAGTTAACTTATTTCTGTGAGG - Intronic
968354342 3:198092335-198092357 AGAAACTACTTATTTCTGGGTGG - Intergenic
968981080 4:3849891-3849913 AGAAATCACTCATTACTGTGGGG + Intergenic
970726257 4:19048575-19048597 AAATATAACTTATTGCTCGGGGG + Intergenic
971261408 4:25060145-25060167 AGATATATCTTTTTTGGGTGAGG + Intergenic
972554351 4:40166205-40166227 GGAAAAAACTTATTACTGTGGGG - Intergenic
973198175 4:47469344-47469366 AAATATAACTTAGCTGTGTGTGG + Intergenic
973312637 4:48726112-48726134 AGATATAAGTTCTTTTTGTGGGG + Intronic
973902966 4:55496238-55496260 AGCTCTAACTTATTTATGTTGGG + Intronic
973991815 4:56416573-56416595 AGAAATAATTTTTTTCAGTGTGG - Intronic
974790417 4:66681343-66681365 AGATATACATGATTTCTGTGTGG + Intergenic
975473881 4:74799538-74799560 AGATATAACTGAATTGTTTGGGG - Intergenic
975934376 4:79560706-79560728 AGATATAAGTTGTGTCTATGGGG + Intergenic
977192766 4:94021473-94021495 AAATATAACTTGTTTCTCAGAGG + Intergenic
977336845 4:95710286-95710308 AAATATAACTTTTTACTCTGAGG - Intergenic
977361115 4:96006570-96006592 AGTTAAAACTTTTTTCTTTGTGG + Intergenic
979368483 4:119853882-119853904 AGATTTCACTTATTTGTGTGTGG + Intergenic
979398155 4:120214614-120214636 ATATATAACTTATTGCTTTGTGG - Intergenic
979647119 4:123082895-123082917 AGTTATAACTCATTTTTTTGGGG + Intronic
979836979 4:125382574-125382596 AGACATAGCATACTTCTGTGGGG + Intronic
981074573 4:140578273-140578295 AAATATAACTTATTTTTTTCAGG + Intergenic
981699139 4:147589438-147589460 ATTTTTACCTTATTTCTGTGAGG + Intergenic
981957671 4:150499339-150499361 AGCTATAAAGTATTTCTGTCAGG + Intronic
983056997 4:163109679-163109701 TGCTATGACTTGTTTCTGTGAGG + Intergenic
983810896 4:172060786-172060808 AGAAATAACATTTTTCTGCGTGG + Intronic
986268074 5:6207600-6207622 AGATTTGACATATTTCTGTAAGG + Intergenic
986591726 5:9377450-9377472 AGAAATAATTTCTTTCTGCGTGG - Intronic
986764389 5:10911612-10911634 AGAGATAACTTAGTGCTGAGAGG + Intergenic
987130120 5:14852479-14852501 AAAAATAACTCATTTCTGTATGG - Intronic
987582565 5:19813368-19813390 AGTTAAAACTCATTTCTATGTGG + Intronic
988947203 5:36216790-36216812 AGAAGTAACTTCTTTCAGTGAGG + Intronic
989091184 5:37733946-37733968 ATTTATAACTTATTTGTGTATGG + Intronic
989172818 5:38490249-38490271 AGATATAATTTTTTCCTGTATGG - Exonic
989488206 5:42017097-42017119 AGATATAACATATGTATCTGAGG + Intergenic
989504965 5:42216514-42216536 AGATATAGCATATTCATGTGTGG + Intergenic
989594140 5:43140678-43140700 AGATAAAATTTATTTCTCTGAGG + Intronic
989979890 5:50631067-50631089 AGATATTACTGATTTATATGTGG + Intergenic
990120067 5:52440697-52440719 AGATATAACCTATTGCTGTATGG + Intergenic
991606768 5:68410117-68410139 AGGTATAATGTATTTATGTGAGG - Intergenic
992962919 5:81973044-81973066 AGATGCAAATTATTTCTGAGTGG + Intronic
993458238 5:88149874-88149896 AAATATAAGTTATTATTGTGTGG + Intergenic
993640352 5:90396190-90396212 ACTCATAGCTTATTTCTGTGAGG - Intronic
994255449 5:97588622-97588644 AGATATAATTAATTTCTTTGTGG + Intergenic
995363758 5:111330171-111330193 AAATACAACTTATTTTTGTATGG - Intronic
995534944 5:113125854-113125876 AGCAATAACTTATTTCTTTGGGG + Intronic
996004082 5:118400161-118400183 AAATATAATCTATTTCTTTGAGG - Intergenic
996221218 5:120935379-120935401 AGATATATGTTATATATGTGAGG + Intergenic
997217289 5:132123400-132123422 AGGTAAAAATAATTTCTGTGGGG + Intergenic
997328196 5:133039584-133039606 AGATGTAAATTATTTGTGTCTGG - Intergenic
997755187 5:136389520-136389542 AAATATTAGATATTTCTGTGTGG + Intronic
999164072 5:149532691-149532713 AGAAATCACTGATTTTTGTGGGG - Intronic
999283076 5:150377540-150377562 AGAAATGACTAATTTCTGAGTGG - Intronic
1000187978 5:158879473-158879495 CTATATAACTTCTTCCTGTGAGG - Intronic
1000690025 5:164306232-164306254 ATATATAAATTATTTGGGTGCGG + Intergenic
1000772736 5:165377093-165377115 AGATATAGCTTATTTTTCTTAGG + Intergenic
1000782094 5:165494968-165494990 AGATATTACTCTGTTCTGTGTGG + Intergenic
1003367723 6:5492301-5492323 AGATCTCACTTCTTTCTGTAAGG - Intronic
1004655404 6:17655427-17655449 AGATTAAAGTTATTTTTGTGGGG - Intronic
1005264449 6:24096725-24096747 AGATGTATTTTATTTCTCTGTGG + Intergenic
1008171245 6:48209761-48209783 AGATATAACTGATTTTTGTGTGG + Intergenic
1008371479 6:50736632-50736654 AGATTTCATTCATTTCTGTGTGG + Intronic
1008413774 6:51215370-51215392 ATATACAATTTATTTCTATGTGG + Intergenic
1009344123 6:62592559-62592581 AGAAATAACTTCTTTCTTTCTGG + Intergenic
1009680719 6:66888497-66888519 ATAAATAACTTATTTCTATGTGG - Intergenic
1010236346 6:73578063-73578085 AGATTCAACTTGGTTCTGTGAGG - Intergenic
1010274410 6:73952520-73952542 GAATATATCTTATTTCTTTGTGG + Intergenic
1010549923 6:77209099-77209121 AAATATAACACATTTCTGGGAGG - Intergenic
1010621526 6:78082639-78082661 AGATATTTATTATTTCTTTGTGG - Intergenic
1010880681 6:81166328-81166350 TGATATAACATTTTTGTGTGTGG - Intergenic
1011653481 6:89528486-89528508 AGATATAACTTACTTTTTGGTGG - Intronic
1013821641 6:114160690-114160712 AGATATTATTTATTTCTTTTTGG - Intronic
1014368069 6:120570023-120570045 AGCAATACCTTACTTCTGTGTGG - Intergenic
1015614299 6:135058934-135058956 AGGTATAACTTATTACTGAAAGG - Intronic
1018554159 6:165033401-165033423 AGAACTCACTTGTTTCTGTGAGG + Intergenic
1020382622 7:7563656-7563678 AGGTGTCACTTATTCCTGTGAGG + Intergenic
1021220865 7:17973922-17973944 AGCTATTACTTATTCCTATGTGG - Intergenic
1021696520 7:23281427-23281449 ACATATATCTTATTTCTCTTGGG - Intergenic
1023079001 7:36510290-36510312 ATATATAACTGTTTTCCGTGTGG - Intergenic
1023204424 7:37732837-37732859 AGATAAAACTTAGTTCTGATTGG + Intronic
1024193854 7:47039447-47039469 AGATATAATTTACTTCTTTGAGG - Intergenic
1025159954 7:56648277-56648299 AGATATTACTTATACCTGTTAGG + Intergenic
1025621508 7:63175519-63175541 AGAGAAAACTTATTTCTTTGTGG - Intergenic
1025966830 7:66280971-66280993 AGATATCACTTATTGTTTTGAGG + Intronic
1026246792 7:68627574-68627596 AGATACAACTTCTTTCTCTAAGG + Intergenic
1027751442 7:82152269-82152291 AGATCTAATTTATTTTTGGGGGG - Intronic
1031771029 7:125843842-125843864 AGCTACAAATTATTTCTGTGAGG + Intergenic
1031795378 7:126168144-126168166 AAATATAGTTTATTTTTGTGGGG + Intergenic
1032337896 7:131043277-131043299 AGAGATAACTGATTCCTGTCTGG + Intergenic
1032965847 7:137096572-137096594 AGGTTTATTTTATTTCTGTGAGG - Intergenic
1035910472 8:3560144-3560166 TTATATAACTTATCTCTGTAAGG + Intronic
1036731365 8:11268493-11268515 AGAAATAACTTATATCTATGTGG + Intergenic
1038608729 8:29038782-29038804 AGATCAAACTTATTTTTGTAGGG - Intronic
1039344764 8:36691622-36691644 AGAGATGACTAAGTTCTGTGAGG + Intergenic
1040477174 8:47789307-47789329 ATATATAACTTATATATGTATGG - Intronic
1041902704 8:62999403-62999425 AGAACTCACTCATTTCTGTGGGG + Exonic
1042211537 8:66386128-66386150 AGAAATAACTTTTTTTGGTGGGG + Intergenic
1042429693 8:68690835-68690857 AAATATAACTTAACTATGTGGGG + Intronic
1042612775 8:70616213-70616235 AGTTCTAACTTATTTCTATTAGG - Intronic
1043744575 8:83857715-83857737 AGATATAGCATATTTCTTTAAGG + Intergenic
1044312157 8:90706333-90706355 AAAGATAACTTATTACTTTGAGG + Intronic
1044988803 8:97777115-97777137 ATATATAACTTTTTTCAGTGAGG + Intronic
1046250336 8:111623401-111623423 AAACACAACTTATTTCTGTCTGG + Intergenic
1047146942 8:122212589-122212611 AGATATAATTCATCTCTCTGTGG - Intergenic
1050413801 9:5393741-5393763 AGAAATTACTTAATTCTTTGAGG - Intronic
1050936773 9:11407443-11407465 AGACATAACATATTTCAGGGAGG + Intergenic
1051388075 9:16531805-16531827 AAATATAATTGATTTCTTTGGGG - Intronic
1051800369 9:20926084-20926106 AGATACATCTTATTTCTTTTGGG + Intronic
1054947976 9:70817020-70817042 AGACATATCTTATTTATGAGTGG + Intronic
1055878124 9:80967449-80967471 TGATATAACATTTTTATGTGTGG - Intergenic
1057324913 9:94053226-94053248 AGATATAACACATTTCTAGGTGG + Intronic
1057922574 9:99109431-99109453 AGATAAATCTTGTTCCTGTGAGG + Intronic
1059826023 9:118029884-118029906 AGATATACCTATTTTCTGGGAGG + Intergenic
1186023743 X:5285718-5285740 CCATATGACTCATTTCTGTGTGG + Intergenic
1187999237 X:24963815-24963837 AGGTATAACTTATTTCTAAGTGG - Intronic
1188149137 X:26650761-26650783 AGATATAACATTTCTCTTTGGGG + Intergenic
1188386955 X:29573410-29573432 ATATATAACTTATTTGAGTTGGG - Intronic
1188406024 X:29810633-29810655 AAATATATCTTATTTCTAAGTGG - Intronic
1188757611 X:33983226-33983248 AAATATTTCTTATTTCTTTGTGG - Intergenic
1188967934 X:36578065-36578087 AGCAAGAACTTATTACTGTGAGG + Intergenic
1190539291 X:51460509-51460531 AGATATAACATTTTCCTTTGGGG - Intergenic
1190908908 X:54754379-54754401 TGAAATAACCTATTTCTGGGAGG - Intronic
1191204309 X:57818199-57818221 AGATATAACATTTTCCTGTGGGG + Intergenic
1191209909 X:57873773-57873795 AGATAACACTTATTACTTTGGGG - Intergenic
1191216673 X:57939305-57939327 ATATATATTTTACTTCTGTGAGG + Intergenic
1192733378 X:73824087-73824109 AGATATAGCTTATATATGGGTGG + Intergenic
1193018845 X:76768087-76768109 AGATGTAAAGTATGTCTGTGTGG + Intergenic
1193679686 X:84502620-84502642 AGATGTAGCTGATTTGTGTGAGG - Intergenic
1193999143 X:88405511-88405533 AGATAAAACTTATTATTTTGAGG + Intergenic
1194454649 X:94087177-94087199 AGACTTAACTGATTTCTCTGTGG + Intergenic
1194735491 X:97508040-97508062 ACAGATAACTTATTTAGGTGGGG - Intronic
1195805213 X:108757923-108757945 AGATATTACTTCTTTTTTTGTGG - Intergenic
1196357782 X:114813565-114813587 AGACAAAACTTACTTCTGTCTGG - Intronic
1197534349 X:127668862-127668884 AGATAATAATAATTTCTGTGTGG - Intergenic
1197637640 X:128933005-128933027 AGGAATATATTATTTCTGTGTGG - Intergenic
1199639529 X:149846994-149847016 AGATATCACTTATGCCTGTTAGG + Intergenic
1201898822 Y:19024986-19025008 AAATCTAACTTATTTTTGTAGGG + Intergenic
1202346638 Y:23935635-23935657 ATAAATAGCTTATTTATGTGGGG + Intergenic
1202524133 Y:25734458-25734480 ATAAATAGCTTATTTATGTGGGG - Intergenic