ID: 918225167

View in Genome Browser
Species Human (GRCh38)
Location 1:182474604-182474626
Sequence TCCCATCTGGTCACCTATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918225163_918225167 28 Left 918225163 1:182474553-182474575 CCTCACAGAAATAAGTTATATCT 0: 1
1: 0
2: 1
3: 25
4: 283
Right 918225167 1:182474604-182474626 TCCCATCTGGTCACCTATACTGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918225167 Original CRISPR TCCCATCTGGTCACCTATAC TGG Intronic
900308912 1:2024197-2024219 CCCCATCTGCTCACCTGCACTGG - Intronic
900697271 1:4020202-4020224 TCCCAGCTGGTCACCTCACCTGG + Intergenic
901800341 1:11704743-11704765 TTCCATCTTGTCCCCTATCCCGG - Intronic
902207616 1:14880842-14880864 TCACATCTGCTGTCCTATACTGG + Intronic
904246988 1:29194782-29194804 TCAAATCTAGTCATCTATACTGG + Intronic
911359616 1:96860891-96860913 AACCATCTAGTCACCTATAAAGG - Intergenic
916932439 1:169592779-169592801 TCACACCAGGTCACCAATACAGG + Intronic
918225167 1:182474604-182474626 TCCCATCTGGTCACCTATACTGG + Intronic
919590479 1:199495569-199495591 AAGCATCTGGTCACCTATAAAGG + Intergenic
921642228 1:217569164-217569186 TCCCATTTCGTCATCTGTACTGG - Intronic
923789260 1:237097584-237097606 TCCATTTTGGTCTCCTATACTGG - Intronic
1063692780 10:8303156-8303178 TGCCATCTGTTCATCTATTCAGG + Intergenic
1072723748 10:97798260-97798282 TCCCATCTGGTTTCCTATCCCGG + Intergenic
1078792140 11:14555117-14555139 TCCCATCTGTTCTCCTAAAGAGG - Intronic
1081533197 11:43978574-43978596 TCCCATCTGCACACATCTACAGG + Intergenic
1086156341 11:83670643-83670665 TTCCATCTGGTCTGCTAAACAGG + Intronic
1094077423 12:26492373-26492395 TCCCATCTGGTGACCCTTAGTGG + Intronic
1097129665 12:56802697-56802719 TCTCATCTTGTCACCCAGACTGG + Intergenic
1103520347 12:121533741-121533763 TCGCATCTAGTCACCCATGCAGG - Intronic
1104329537 12:127831560-127831582 TCCCAAATGTTCCCCTATACAGG - Intergenic
1104718771 12:131033214-131033236 TCCCATCTGGACACAGCTACAGG - Intronic
1112476127 13:99732209-99732231 TGTCACCTTGTCACCTATACTGG + Intronic
1134273293 16:12753844-12753866 TCCTATCTGGTGACCGATCCAGG + Intronic
1140235323 16:73153567-73153589 TTCCCTCTGGTCACCATTACGGG + Intergenic
1141922726 16:87146785-87146807 TCCCCTTTGGACACCTATTCAGG - Intronic
1144732451 17:17536586-17536608 TCCCATGAGGTCACCTTTGCTGG - Intronic
1164548374 19:29187630-29187652 TCCTCCCTGGTCACCAATACAGG + Intergenic
1164901597 19:31930797-31930819 TTCCATCTGGTCATCACTACCGG + Intergenic
1165089364 19:33374605-33374627 TCGCATCTGGTCACCTCCGCTGG - Intronic
1165939813 19:39409570-39409592 TCCCATCTGGTGACCTCACCTGG - Intergenic
1167956482 19:53069104-53069126 ACCCATCAGGTCATCCATACTGG - Exonic
1167961538 19:53108570-53108592 ACCCATCAGGTCATCCATACTGG - Exonic
1167961547 19:53108654-53108676 ACCCATCAGGTCATCCATACTGG - Exonic
1167965392 19:53140882-53140904 ACCCATCAGGTCATCCATACTGG - Exonic
1167965416 19:53141134-53141156 ACCCATCAGGTCATCCATACTGG - Exonic
1167965430 19:53141302-53141324 ACCCATCAGGTCATCCATACTGG - Exonic
1167968097 19:53164709-53164731 ACCCATCAGGTCATCCATACTGG - Exonic
1168297463 19:55384355-55384377 TCCCGCCTGGTCACCTGAACCGG + Exonic
929557170 2:42932696-42932718 TCACAGCTGGTGTCCTATACAGG + Intergenic
929776545 2:44934155-44934177 TCCCAACAGGTTAGCTATACTGG + Intergenic
932171980 2:69565680-69565702 TCCCACCTGATCAGCTAGACAGG - Intronic
932757769 2:74420697-74420719 TCCCTTCTGGTCACCATCACGGG - Intronic
933410886 2:81923413-81923435 TACCATCAGGTAACCTATAAAGG + Intergenic
939121482 2:138122973-138122995 TCCCATCATGTTACCTAGACAGG - Intergenic
948581315 2:238988891-238988913 TCCCATCTGCTCACTCACACAGG + Intergenic
1171981138 20:31630052-31630074 TCTCATATGGTCACCCAGACTGG - Intergenic
1172502392 20:35436682-35436704 TCCCATCTGTACACCTATATGGG - Intronic
1174147840 20:48464479-48464501 TCCCATGTGGTCACCTGGTCTGG - Intergenic
1174754292 20:53142413-53142435 TCCCACCAGGTCACATGTACAGG + Intronic
1174974462 20:55316245-55316267 TCTCATTTGGTCACCCAGACTGG + Intergenic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1183819814 22:40337111-40337133 TCCAATCTGGTCTCCTATTTTGG - Intergenic
1184456871 22:44615940-44615962 ACCCACCTGGCCACCTATAGAGG - Intergenic
949805066 3:7945897-7945919 TCTACTCTGGTCACCTATATGGG - Intergenic
955396866 3:58563729-58563751 TCCCAACTGGTCTCCCCTACTGG - Intergenic
957988752 3:87604675-87604697 TCCCATCTGCTCACTTATATTGG - Intergenic
966203171 3:177378369-177378391 TCCCATCTTGTCACGTAGGCAGG + Intergenic
967233452 3:187363106-187363128 TCTCAACTGGTCACCTCTCCAGG + Intergenic
969457471 4:7308356-7308378 TCTCCTCTGGTCACCTTTCCAGG + Intronic
970555768 4:17231077-17231099 TCCCCTCTGCTCAGCAATACTGG - Intergenic
972944019 4:44230932-44230954 GCCCATCTGGTCATCTGTGCTGG + Intronic
974010899 4:56606480-56606502 TCTCATCAGGGCACCTATATGGG - Intergenic
976243133 4:82979974-82979996 TCTCATCTCGTCACCCAGACTGG + Intronic
978407373 4:108394751-108394773 TCCCAGCTGCTCTCCTATACTGG + Intergenic
982787525 4:159553385-159553407 TGCCATCTGGACACCTACACAGG - Intergenic
984071399 4:175117905-175117927 TGCCATATGGTCACTTATAAAGG + Intergenic
987544689 5:19298127-19298149 TCCCATGAGGTCACCTTTTCTGG - Intergenic
993293268 5:86102228-86102250 TCCCACCTGGACACCTCTGCAGG + Intergenic
1000924167 5:167173409-167173431 GCCCATCTGGGAACCTCTACAGG - Intergenic
1006265924 6:32923436-32923458 TCTCATCTTGTCACCTAGGCTGG - Intergenic
1007746489 6:44046496-44046518 TCCCATCTGCTCTCCTCCACAGG + Intergenic
1007937547 6:45746794-45746816 TCAATTCTTGTCACCTATACTGG + Intergenic
1008435181 6:51467506-51467528 TCCCATCTTCTCCCCTATAAAGG + Intergenic
1013067386 6:106696896-106696918 TCTCCTCTGGTCATCTAGACAGG - Intergenic
1022152302 7:27620362-27620384 AAGCATCTGGTCACCTATAAAGG + Intronic
1023488953 7:40717017-40717039 TGTCATCTGCTCACCTCTACTGG + Intronic
1026425179 7:70284452-70284474 CCTCATCTGTTCACCAATACAGG + Intronic
1037774343 8:21823101-21823123 TCCCTCCTGGCCACCCATACAGG + Intergenic
1042920683 8:73916238-73916260 TTCCCTCTTGTCACCTAGACTGG - Intergenic
1060888133 9:127170237-127170259 TCCCACCTGGTCAGCTTTACAGG + Intronic
1061493233 9:130957610-130957632 TCCCCTCCTGTCACCTAGACTGG + Intergenic
1190243843 X:48677546-48677568 TGCCTTCTGGTAACCTCTACAGG - Intronic
1190967140 X:55311627-55311649 TCCCTTCTGGTGACCTCTTCTGG - Intergenic
1197515383 X:127421670-127421692 AAGCATCAGGTCACCTATACAGG - Intergenic