ID: 918226146 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:182484896-182484918 |
| Sequence | CAGTTTACCCTCAGGGATGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 918226143_918226146 | 2 | Left | 918226143 | 1:182484871-182484893 | CCATCAGGTGGGGGTGGTTTGGC | 0: 1 1: 0 2: 2 3: 16 4: 157 |
||
| Right | 918226146 | 1:182484896-182484918 | CAGTTTACCCTCAGGGATGAAGG | No data | ||||
| 918226134_918226146 | 29 | Left | 918226134 | 1:182484844-182484866 | CCTGCAACTTGGCTTGGGGATGT | 0: 1 1: 0 2: 71 3: 129 4: 239 |
||
| Right | 918226146 | 1:182484896-182484918 | CAGTTTACCCTCAGGGATGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 918226146 | Original CRISPR | CAGTTTACCCTCAGGGATGA AGG | Intronic | ||
| No off target data available for this crispr | |||||