ID: 918226146

View in Genome Browser
Species Human (GRCh38)
Location 1:182484896-182484918
Sequence CAGTTTACCCTCAGGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
918226143_918226146 2 Left 918226143 1:182484871-182484893 CCATCAGGTGGGGGTGGTTTGGC 0: 1
1: 0
2: 2
3: 16
4: 157
Right 918226146 1:182484896-182484918 CAGTTTACCCTCAGGGATGAAGG No data
918226134_918226146 29 Left 918226134 1:182484844-182484866 CCTGCAACTTGGCTTGGGGATGT 0: 1
1: 0
2: 71
3: 129
4: 239
Right 918226146 1:182484896-182484918 CAGTTTACCCTCAGGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918226146 Original CRISPR CAGTTTACCCTCAGGGATGA AGG Intronic
No off target data available for this crispr