ID: 918227033

View in Genome Browser
Species Human (GRCh38)
Location 1:182493439-182493461
Sequence CTGGAGGCTGAGATTTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 339}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
918227033 Original CRISPR CTGGAGGCTGAGATTTGTGA AGG Intronic
901213339 1:7539019-7539041 CTGGAGGCTGTGATCTCCGAGGG - Intronic
901222731 1:7592793-7592815 ATAGAGGCTGAGGTGTGTGAGGG - Intronic
901746326 1:11376117-11376139 CTGGAGGCTCAGATTGGCAAAGG + Intergenic
901781782 1:11599019-11599041 CTGGAGGGTGGTATTTGTAACGG + Intergenic
902641442 1:17768752-17768774 CTGGAGGCTGGGTTTGGTGGAGG + Intronic
903918268 1:26780260-26780282 CTGGATGCTGAGTTTGCTGAGGG - Exonic
904016795 1:27427920-27427942 CTTGAAGCTGAGATATGGGAAGG - Intronic
905235417 1:36542911-36542933 CTGGAGGCTGTGAGTGGTGATGG + Intergenic
907437691 1:54459911-54459933 CTTCTGGCTGAGATTTGTGCAGG + Intergenic
907917264 1:58882528-58882550 CCAGAGGCTGAGATGAGTGATGG + Intergenic
911404440 1:97419155-97419177 CAGGAGGTAGAGATTTGGGAAGG - Intronic
914349692 1:146830368-146830390 CTGGCAGCTGGGGTTTGTGAAGG - Intergenic
915366406 1:155319343-155319365 TTGGGGACTGACATTTGTGAGGG + Intronic
915940031 1:160113290-160113312 CTGGAGGCTGAGGTTCATGGTGG + Intergenic
916058847 1:161085492-161085514 GTTGAGGCTGTGATTTGGGATGG - Intronic
916500619 1:165383919-165383941 CTGGTGGATGGGATTTGAGAGGG - Intergenic
917300723 1:173571181-173571203 CTGGGGAATGGGATTTGTGAAGG - Intronic
917715828 1:177736279-177736301 CTGGGGGATCACATTTGTGATGG - Intergenic
918029194 1:180787383-180787405 CTGGAGGCTGAGGTAGGTGGAGG - Intronic
918227033 1:182493439-182493461 CTGGAGGCTGAGATTTGTGAAGG + Intronic
919912864 1:202122744-202122766 GTGGAGGACGAGATGTGTGAGGG + Intergenic
920145096 1:203853485-203853507 CTCAAGGTTTAGATTTGTGAAGG + Exonic
921299046 1:213732805-213732827 CTAGGGGCTGAGATTGGGGAGGG - Intergenic
921820204 1:219608520-219608542 CTCAAGGTTTAGATTTGTGAAGG - Intergenic
922678228 1:227566372-227566394 CTGGATTCTCAGACTTGTGAAGG + Intronic
924050359 1:240074305-240074327 CTGGATACTGAGATGTTTGATGG + Intronic
924526310 1:244853749-244853771 GTGGAGGCTCAAACTTGTGAAGG - Exonic
1063792909 10:9475161-9475183 CAGCAGACTGAGATTTGAGAAGG + Intergenic
1064072400 10:12242107-12242129 CTGGAGTGTGAGATATGTGAGGG - Intronic
1064862422 10:19842170-19842192 CTGGAGGCTGAGAATTGACAAGG + Intronic
1065671531 10:28124240-28124262 CTGAAACCTGAGATGTGTGAAGG - Intronic
1066497695 10:35958305-35958327 CTGGATGGTGAGATTCATGAGGG + Intergenic
1067140856 10:43655407-43655429 CTGGAGGCTGAGATCGGCCAGGG + Intergenic
1067716291 10:48693287-48693309 CTGGAGGCAGAGACTTGCTATGG + Intronic
1068851853 10:61751312-61751334 CTGGAGCTCGAGATCTGTGAAGG + Intronic
1070509730 10:77149667-77149689 ATGCAGGCTGAGATTGGAGACGG - Intronic
1070748363 10:78948728-78948750 CAGGAGGCTGGGAAGTGTGAGGG + Intergenic
1070846278 10:79524680-79524702 CAGGAGGCTGAGATGGGAGAAGG + Intergenic
1070927521 10:80235630-80235652 CAGGAGGCTGAGATGGGAGAAGG - Intergenic
1071211214 10:83343578-83343600 CTTGGGGATGAGATCTGTGAGGG + Intergenic
1071730009 10:88238474-88238496 CTGGAGGCTGATGGATGTGAGGG + Intergenic
1071812361 10:89197695-89197717 CTGCAGGCTGGGATCTGGGATGG + Intergenic
1071852521 10:89588961-89588983 CAAGAGGCTGAGATTTTTGTTGG + Intronic
1073583554 10:104688285-104688307 CTGGAGGCTGAAAGCTCTGAAGG + Intronic
1075262877 10:120978097-120978119 CTGGAGGCTGAGGGTGGGGAAGG + Intergenic
1075955681 10:126520817-126520839 GTGGAGGCAGAGATTAGAGAGGG - Intronic
1076045891 10:127293901-127293923 CTGGAGGCAGAGAGTTGGGTGGG - Intronic
1076344270 10:129769667-129769689 CAGGAGACTGAGTTTTGTGAGGG + Intergenic
1076414882 10:130278735-130278757 CTGTAGGCAGAGTTTTCTGATGG - Intergenic
1076995825 11:297118-297140 CTGGAGGCAGAGGTGTGTGGAGG - Intergenic
1077194491 11:1272402-1272424 CTGGGGGATGAGATTGGGGAGGG - Intergenic
1077498702 11:2899128-2899150 CTGGAGGCTGGGACCTCTGAGGG - Intronic
1077575118 11:3377471-3377493 TTGGACTCTCAGATTTGTGAAGG - Intronic
1078243442 11:9551454-9551476 GTGGAGGCTGAGAGTGGGGATGG + Intergenic
1079225254 11:18599481-18599503 CTAGAGGCAGAGATTTGGAAAGG - Intergenic
1080154288 11:29090229-29090251 ATGCAGGCTGAGATTAGTGGAGG - Intergenic
1082811243 11:57480369-57480391 CTGGAGTCTGAGATCTGAGGAGG - Intergenic
1083126749 11:60576745-60576767 CTGAAGTCTGAGTTTAGTGAAGG - Intergenic
1084020079 11:66412072-66412094 CTGGAGGCTGAGGTATCTGTTGG + Intergenic
1086293977 11:85344358-85344380 CTCGAGGCTTAGTTTTGTTACGG + Intronic
1088226513 11:107626282-107626304 CAGGAGGTTGAGATTAGTGCTGG + Intronic
1088701927 11:112421005-112421027 CTGGAGTTTTTGATTTGTGATGG - Intergenic
1089209054 11:116788512-116788534 CTTGAGGCTGGGATTGGGGAAGG - Intergenic
1089252234 11:117173082-117173104 TTGGAGGCAGAGATTTGAGACGG + Intronic
1089403091 11:118176122-118176144 CTGGGGGCTGACAATTGTCAAGG - Intronic
1089726222 11:120482766-120482788 CTGGAAGCTGTGTTTTCTGATGG - Intronic
1091311258 11:134576856-134576878 GTGGAGGCTGGGATTTGTCTCGG + Intergenic
1091678454 12:2508905-2508927 CTGGAGATTGAGCTTTCTGAGGG - Intronic
1091696076 12:2629101-2629123 CTGGAGATTGAGCTTTCTGAGGG - Intronic
1092177323 12:6419146-6419168 CTGGACGCTGAGCTCTGTGCTGG - Intergenic
1092241731 12:6839958-6839980 CTGGAGCCTGTGATTTGTCAGGG + Intronic
1092263545 12:6964754-6964776 CTGGTGCCTGAGATTCGGGAAGG + Intergenic
1094264862 12:28545493-28545515 GTGGAAGCTCAGCTTTGTGATGG + Intronic
1095749354 12:45694331-45694353 CTGGAGCTTGAGATTTGTGTTGG - Intergenic
1096444167 12:51673749-51673771 CTGGACCCTGAGATCCGTGAAGG - Intronic
1097657199 12:62380605-62380627 CTGTAGGATGATATTTGTGTTGG - Intronic
1101808258 12:108084186-108084208 CTGGATGTGGAGATTTCTGAGGG + Intergenic
1102619560 12:114183128-114183150 CAGGAGGCTTAGAACTGTGAGGG - Intergenic
1104637997 12:130449924-130449946 CTGGAGGCAGAAGTTTGAGATGG - Intronic
1105686378 13:22786455-22786477 CAGGAGGCTGAGATGGGAGATGG - Intergenic
1108086923 13:46803490-46803512 CTGGAGGCCTAGACTTGCGACGG - Intergenic
1108880871 13:55113946-55113968 GTGGAGACTGAGACTTGTAAAGG + Intergenic
1109625395 13:64967292-64967314 CTAGAGTCTGAGATGTTTGAAGG - Intergenic
1110271535 13:73596641-73596663 CTGAAGTCTGAGATTAGTTAAGG + Intergenic
1110526054 13:76538080-76538102 GTGGGAGCTGAGATTTGTGCAGG + Intergenic
1110994996 13:82096697-82096719 CTGGAGGCTGAGACAGGAGAAGG + Intergenic
1111146282 13:84185098-84185120 ATGGAGGCTGAGAGAGGTGAGGG - Intergenic
1111668710 13:91301750-91301772 CAGGAGGCTGAGATGGGAGATGG - Intergenic
1113554226 13:111218481-111218503 GTGGGGGGTGGGATTTGTGAAGG + Intronic
1114474621 14:22985083-22985105 CTGGAAGCAGAGATGAGTGAAGG + Intergenic
1117491912 14:56256328-56256350 CTGGAGGCTGAGGTGGGAGAAGG + Intronic
1117757329 14:58989383-58989405 CTGCAGGATGAGATTTGAGTAGG - Intergenic
1118586042 14:67354049-67354071 CTGGAGGCTGAGAAGGGTGAGGG - Intronic
1118586472 14:67358571-67358593 CTGGCGGCTGAGATTATAGATGG - Intronic
1118754425 14:68828965-68828987 CTGGAGGCTGAGAAGGGTAAGGG + Intergenic
1118810496 14:69269961-69269983 CTGGAGGGAGAGTTTTGTGTGGG + Intronic
1119651482 14:76387067-76387089 CAGGAGGCTGACCCTTGTGAGGG + Intronic
1120681741 14:87488290-87488312 CTGGAGGCCGAGAGGAGTGAGGG - Intergenic
1120813843 14:88832294-88832316 CTGGATGCTGTGATTTGCCAAGG - Intronic
1120929233 14:89831647-89831669 CTGGAGAATGAGAATGGTGAAGG + Intronic
1121338389 14:93090877-93090899 CTGGAGGCGCAGGTTGGTGATGG - Intronic
1121378587 14:93438552-93438574 CTGGAGGCTAAAATTTTTGTGGG + Intronic
1121882884 14:97516079-97516101 CTGGTGGCTGGGAGATGTGAGGG - Intergenic
1122059732 14:99128993-99129015 CTGGAGGCTCAGGTGGGTGAAGG + Intergenic
1123232796 15:17145857-17145879 CTGGAAGTTGATATTTGGGAGGG + Intergenic
1123245965 15:17373513-17373535 CTGGAAGTTGATATTTGGGAGGG + Intergenic
1124661878 15:31556349-31556371 CTGGAAGCAGAGATCAGTGAAGG - Intronic
1125679785 15:41523470-41523492 CTGCAGGCTGAGCCTTCTGAAGG + Intronic
1126826603 15:52557118-52557140 CTGGAGGTTCAGATTTCTTAAGG - Exonic
1128553072 15:68610555-68610577 CTGGAGGAGGGGCTTTGTGATGG - Intronic
1128761863 15:70222345-70222367 ATGGATGGTGAGATTAGTGATGG - Intergenic
1130057204 15:80536835-80536857 CTGTCAGCTGAGATTTGTAAAGG + Intronic
1130435830 15:83898459-83898481 CTGGAGTATAAGATTTTTGAGGG + Intronic
1130436456 15:83904341-83904363 CTGGAAGCTGAGATATGTTGCGG - Intronic
1130875600 15:88011280-88011302 CTGGAGACTGAGCTTTCTGTTGG - Intronic
1132303315 15:100789686-100789708 CTGGAGCCTGAGATGTGGGAGGG - Intergenic
1132338093 15:101061502-101061524 CTGGAGGCCGGGATTTGCGATGG + Intronic
1132376462 15:101331493-101331515 CAGGAGGCTGAGCTGTGAGATGG + Intronic
1132727970 16:1346950-1346972 CTGGAGGTAGAGCTCTGTGAAGG + Exonic
1136073792 16:27804799-27804821 GTGGAGGCTGAGATTGGGGGCGG + Intronic
1136990845 16:35150676-35150698 CTGGAGGCTGAGATCTGATTAGG - Intergenic
1138122389 16:54411158-54411180 CTGGAGACTGAGAGAGGTGAAGG + Intergenic
1138348877 16:56335913-56335935 CTGCAGGCAGAGATTAGTGTGGG - Intronic
1139171167 16:64631226-64631248 CTGAAGCCTGAGATTTGAAATGG - Intergenic
1139817054 16:69683424-69683446 CAGGAGGCTGAGGTGGGTGATGG + Intronic
1139984343 16:70885178-70885200 CTGGCAGCTGGGGTTTGTGAAGG + Intronic
1140169397 16:72587383-72587405 CGGGAGGCTAAGATCAGTGAAGG + Intergenic
1140657023 16:77151557-77151579 CTGGAGGATCAGATTAGAGATGG - Intergenic
1140906780 16:79415856-79415878 AGGGAAGCTGAGATTTGTCAAGG - Intergenic
1141039914 16:80664316-80664338 CCGGAGGATTAGATGTGTGAAGG - Intronic
1141458802 16:84163908-84163930 CAGGAGGCTGAGAGGTGGGAGGG - Intronic
1141892432 16:86935341-86935363 GTGGAGGCTGTGTTTTGTGCGGG - Intergenic
1142532304 17:588853-588875 ATGGAGGATGAGGATTGTGAGGG + Intronic
1142758546 17:2029832-2029854 CTGCAGGCCGAGTCTTGTGAAGG - Intergenic
1143374133 17:6457555-6457577 CTGGAGGCGGGGAGTTGTGAGGG - Intronic
1144500712 17:15784799-15784821 ATGGAGGCTGTGATTGATGAAGG + Intergenic
1147719180 17:42527875-42527897 CTGGAGGCTGAGACAGGAGATGG + Intergenic
1148821902 17:50364712-50364734 CCTGGGGCAGAGATTTGTGAGGG - Intergenic
1150436674 17:65159515-65159537 TTGGAGGCTGAGCTATGGGATGG + Intronic
1150720112 17:67607263-67607285 CTGAAAGCTGAGATTTCAGAAGG - Intronic
1151936654 17:77266098-77266120 CTGGAGGATGAGATTCTAGATGG + Intergenic
1152245861 17:79184237-79184259 CAGGAGGCTGGGATGTATGATGG - Intronic
1152310235 17:79545490-79545512 CTGGAGGCTGAGTGTTGCCAAGG - Intergenic
1153415160 18:4838308-4838330 CTGGAGGCCCAGACTTGAGATGG - Intergenic
1153821728 18:8837874-8837896 CTTGAGCCTGAGAGCTGTGATGG - Intergenic
1153904573 18:9649892-9649914 GTGATGGGTGAGATTTGTGAGGG + Intergenic
1153960992 18:10140219-10140241 GAGGAGGCTGAGATTTGAGAAGG - Intergenic
1155087310 18:22471074-22471096 CTGGAAGCTGAGCTCTGTGCTGG - Intergenic
1155118818 18:22797766-22797788 CTGGAGTCTGATATTTGAGCAGG - Intergenic
1155266765 18:24102197-24102219 CAGGATTCTGACATTTGTGACGG - Intronic
1155431976 18:25769017-25769039 CTGTAGGCTGAGTTTCTTGAGGG + Intergenic
1157847011 18:51013417-51013439 TTGGAGGCAGAGATTTGGGGAGG + Intronic
1159636271 18:70808972-70808994 GAAGAGGCTGAGATATGTGACGG + Intergenic
1160941103 19:1620890-1620912 GGGGAGGCTGAGGTCTGTGAAGG - Intronic
1160941114 19:1620923-1620945 GGGGAGGCTGAGGTCTGTGAGGG - Intronic
1161828099 19:6583032-6583054 CTGCAGGGCTAGATTTGTGAGGG + Intergenic
1163115102 19:15184530-15184552 CTGCAGGCCGAGATGGGTGAAGG + Intronic
1165942490 19:39422141-39422163 CTGGTGGCTGAGATTCTGGAGGG - Exonic
1166043482 19:40216519-40216541 CTGGAGGATGAGAAGTGTGACGG - Intronic
1166684605 19:44788821-44788843 CCTGAGGCAAAGATTTGTGATGG - Intronic
1166921112 19:46229833-46229855 GTGGTGGCTGAGATTGGAGATGG - Intronic
1168168811 19:54573222-54573244 CAGGAGGCTGAGGTGGGTGAAGG - Intronic
1168262896 19:55206949-55206971 TTGGGGGCTGAGAATTGGGAAGG + Exonic
925234454 2:2265895-2265917 CTGAAGGCTGTGAGCTGTGAAGG + Intronic
925588579 2:5487574-5487596 CTGGAGGGAGAGACTTGGGACGG + Intergenic
926891506 2:17643174-17643196 CTCCATGCTGAGCTTTGTGAGGG - Intronic
926938264 2:18108007-18108029 CTGGAGGCATAGGTTTTTGAGGG + Intronic
928148649 2:28806244-28806266 CGGGAGGCTGAGTTTCTTGAAGG + Intronic
929838916 2:45435396-45435418 CTGGAGGTTGGGATTCCTGAAGG + Intronic
930961030 2:57261808-57261830 CTGGATTCTGAGTTCTGTGATGG - Intergenic
931119884 2:59204404-59204426 CTGGAGGTTGAAATTGGTGGAGG + Intergenic
931319237 2:61159902-61159924 CTGGAGGCAGACAGTGGTGATGG - Intronic
933283332 2:80356702-80356724 CTGGATGGTGAGATTAATGATGG - Intronic
935158706 2:100509404-100509426 CTGGAGGTTCAGATTTCTTAAGG + Intergenic
936061053 2:109295989-109296011 TTGGAGACTGACATCTGTGAAGG + Intronic
937767072 2:125673927-125673949 GTGAAGGCTGAGATTGGTGAGGG + Intergenic
938884140 2:135625700-135625722 CTGGATGAGGAGATTGGTGAAGG + Intronic
940895747 2:159080726-159080748 CTGGAGCCTGAGATTTGCTTTGG + Intronic
944087590 2:195867516-195867538 CTGGAGGGAGATAGTTGTGATGG - Intronic
944810368 2:203321747-203321769 CAGGAGGCTGAGATAGGAGATGG - Intergenic
944919618 2:204398061-204398083 CAGAAGGCTGAGAGCTGTGAGGG + Intergenic
945096067 2:206220731-206220753 TGGGAGGCTGAGATGTGAGACGG + Intergenic
948369832 2:237481630-237481652 CAGAAGGCTGAGATTTCTGATGG + Intergenic
948460073 2:238124985-238125007 CTGGAAGCTGAGCTTTGAGATGG + Intronic
948638269 2:239354858-239354880 CTGTCATCTGAGATTTGTGAGGG - Intronic
948642684 2:239385526-239385548 CTTGAGGCTGAGACTTCAGAGGG - Intronic
1168923069 20:1557306-1557328 CTGGAGGGTGAGAGCTGTGATGG + Intronic
1169498341 20:6135478-6135500 CTAGAGGCAGAGCTTTGAGACGG + Intergenic
1170430106 20:16267875-16267897 CTGGGGGCTGGGAGTTGGGAGGG - Intergenic
1170761384 20:19254280-19254302 GTGGAGCCTGTGACTTGTGAGGG - Intronic
1171349084 20:24489034-24489056 GTGGAGGCTGAGATTCCTGCAGG + Intronic
1171873733 20:30551579-30551601 CTGCAGGCTGACATTATTGATGG - Intergenic
1171995990 20:31731767-31731789 GTGGAGGATCAGATTTGTTAGGG + Intergenic
1172025794 20:31947469-31947491 CTGGAGGCTAAGCTTTCAGAGGG - Intronic
1172283100 20:33721945-33721967 GTGGTGGCTGTGACTTGTGAGGG + Intergenic
1173947299 20:46961856-46961878 CTAGAGGCTGAGAATGGTGCAGG + Intronic
1174568664 20:51485354-51485376 CTGGAAGCTGAGAGTGGAGAGGG - Intronic
1174821191 20:53727809-53727831 CTGGGGGCTCAGATGGGTGAGGG - Intergenic
1175245873 20:57581626-57581648 CTGAAGGATGAGGTTCGTGATGG - Intergenic
1175296594 20:57913092-57913114 CTGGAGTCTAAGATTCCTGAGGG - Intergenic
1178280238 21:31276120-31276142 CTGGAGGCTGAGCTTGAAGACGG + Intronic
1179243083 21:39609014-39609036 CTGGAGTCTGAGGTGTGTGCCGG - Intronic
1179268977 21:39833893-39833915 CTGGAGACGGAGGTTGGTGATGG - Intergenic
1179289954 21:40009666-40009688 CTTGAGGAGGAGACTTGTGATGG - Intergenic
1179961106 21:44767320-44767342 CTGCAGGCTGGAATTTGTGCTGG - Intergenic
1180180368 21:46116197-46116219 CTGGAGGCTGGGTTTTGGGACGG - Intronic
1181452615 22:23034001-23034023 CTGGAGGCTGACTTGTGGGATGG + Intergenic
1181906406 22:26200674-26200696 CTGGAGGCTGAGAAGGCTGATGG - Intronic
1183504222 22:38200186-38200208 CTGGAGGCTCAGAGAGGTGAAGG - Intronic
1184792451 22:46708457-46708479 CTCTCGGCTGAGATTTCTGACGG - Intronic
1184953190 22:47860761-47860783 CTGGAGGCTGGAAGTTGTGGTGG - Intergenic
1185011707 22:48318284-48318306 CTGGAGGCGGAGGGTGGTGATGG - Intergenic
949820413 3:8110170-8110192 ATGGAGTCTCAGCTTTGTGAAGG - Intergenic
949857197 3:8472747-8472769 AGGGAGTCTGAGACTTGTGAGGG + Intergenic
950259692 3:11535124-11535146 CTTGAGGCTGACATTTCTGCTGG + Intronic
951648553 3:24921960-24921982 CTGTCCGCTGAGATCTGTGAGGG - Intergenic
952198456 3:31100553-31100575 CTGGACTGTGAGATCTGTGAAGG - Intergenic
952299304 3:32089829-32089851 CTGGAGGGTCATGTTTGTGATGG - Intergenic
952656453 3:35792272-35792294 GTGGAGACTGAGATGTCTGAAGG + Intronic
953943718 3:47126907-47126929 CAGGAAGCTGAGCTTTTTGAGGG - Intronic
956456017 3:69421105-69421127 AGTGAGGATGAGATTTGTGAGGG + Intronic
956745505 3:72307804-72307826 CTGGACGCTGAGCACTGTGACGG + Intergenic
957273899 3:78065426-78065448 CTGGAGGCTTACATTTGTGGTGG - Intergenic
959222047 3:103532602-103532624 ATTGAGGCTGAGATGAGTGAGGG + Intergenic
959932784 3:112001248-112001270 CTGGTAGCTGTGATTTGTTATGG - Intronic
960651335 3:119953847-119953869 CTGCAGGGAGAGATTGGTGATGG - Intronic
962240499 3:133747325-133747347 CTGGAGGCAGGGCTTTGTGGAGG + Intronic
962637443 3:137345592-137345614 CTGGAGGCTGAGAGAGGAGAAGG + Intergenic
963004092 3:140710005-140710027 CTGGAGGCTGTGATGCATGAGGG + Intergenic
963238851 3:142982910-142982932 CTGGAGCCAGAGAGTAGTGATGG - Intronic
963308136 3:143676855-143676877 CTAGAGGTTAAGATCTGTGAAGG + Intronic
965551245 3:169966997-169967019 CTGCAGGCTGCGCGTTGTGAGGG + Intronic
966399878 3:179537316-179537338 CAGGAGTCTGAGCTTTGTGGAGG - Intergenic
967834465 3:193949310-193949332 CTGAATGCTGAGGGTTGTGAAGG + Intergenic
969013944 4:4090576-4090598 CTGGAGACAGAGATTTGGGCGGG - Intergenic
969496933 4:7531550-7531572 CTGGAGGGTGAGCTTGGTGTAGG - Exonic
970095631 4:12460238-12460260 CTTGAGCCTGTGATTTGTGGAGG - Intergenic
971329340 4:25669820-25669842 CTGGACAATGAGCTTTGTGAAGG - Exonic
972993178 4:44847472-44847494 CTGGAGACTGAGAATGGTAAAGG - Intergenic
973327726 4:48880185-48880207 CAGGAGGATGAGATTTTTGTTGG + Intergenic
973814530 4:54607019-54607041 CTGGAGGGTGAGATTGGAGGAGG + Intergenic
973909566 4:55565731-55565753 TTGGAGGCTGAGGTTTTTCAAGG - Intronic
976533261 4:86180836-86180858 CTGGAGGCTGAGATGGGTAAGGG + Intronic
977136084 4:93306412-93306434 CTGGAGGCAGAGATGTGACATGG + Intronic
977447342 4:97147766-97147788 CTGAAGGCAGAGAATTCTGAAGG - Intergenic
977904151 4:102456342-102456364 ATGGAGGCTGAGATGTCTCAGGG + Intergenic
978530205 4:109704519-109704541 ATGGAGGCTGAGAGAGGTGAGGG + Intergenic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
978944475 4:114478902-114478924 CTGTATGCTGTGATTAGTGATGG + Intergenic
982490946 4:156028854-156028876 CTGGAGGCTGAGGTGGGAGATGG + Intergenic
983513850 4:168636553-168636575 ATAGAGGTTGAGAATTGTGAGGG - Intronic
983807327 4:172011267-172011289 CTGGAGACTGAAATTTGCGGAGG + Intronic
984479957 4:180287369-180287391 CTGCAGGGTGAGATTTGGGTGGG + Intergenic
985551163 5:534355-534377 CAGGAGGTTGAGGTTTGTGCTGG - Intergenic
985747607 5:1655933-1655955 CTGGAGGCTGAGAGTCGGGCCGG - Intergenic
986129897 5:4919873-4919895 ATGGATGCTGGGTTTTGTGAAGG - Intergenic
987279866 5:16402072-16402094 CTGAAGGCTGAGAGAGGTGAGGG - Intergenic
987334122 5:16883718-16883740 CAGGAGGTTAAAATTTGTGATGG - Intronic
990218098 5:53556824-53556846 TTGGAGGCTGCTATATGTGAGGG + Intergenic
990941338 5:61205856-61205878 CTACAGGATGAGATTTGTGGGGG + Intergenic
990954551 5:61330417-61330439 CTGCAGCCTGGGACTTGTGAAGG + Intergenic
992626169 5:78637632-78637654 CTGGCGGCTGAGAAATGTCAGGG - Intronic
992854737 5:80848766-80848788 CTAGAAGATGAGATTTGTGTGGG + Intronic
993777974 5:92025765-92025787 CTGGAGGCAGAGATTGTTGTGGG + Intergenic
994552073 5:101247602-101247624 CTGGAGGCTGGGAAGTCTGAGGG - Intergenic
994669258 5:102746995-102747017 CTGGAGGGTGGTATTAGTGAGGG - Intergenic
997801674 5:136868930-136868952 CTGGAAACTAAGATTTGGGAAGG + Intergenic
999182998 5:149683171-149683193 CTGGAGGGTGGGATTCCTGAGGG + Intergenic
1001409942 5:171504153-171504175 TTGGAGGCTGAAGTTTGGGATGG + Intergenic
1002050467 5:176567867-176567889 CGGGAGGCTGAGATGGGGGATGG - Intronic
1002167408 5:177356971-177356993 CTGGAGGCTGAGATGTCCAAGGG - Intergenic
1002173481 5:177388167-177388189 CTGGATGATGAGCTTCGTGAAGG - Exonic
1002682974 5:180982400-180982422 CTGGAGGTTCAGATTTCTTAAGG + Intergenic
1002686913 5:181020056-181020078 ATGGAGGTTGGGATTTTTGAGGG - Intergenic
1003445932 6:6184390-6184412 CTTGCGGCTCAGATTTCTGAGGG + Intronic
1003822718 6:9917927-9917949 CTGAAGGCTGAGAGTAGGGAAGG - Intronic
1005130453 6:22501482-22501504 TTGGAGGCTGTCATCTGTGAGGG - Intergenic
1006263352 6:32895020-32895042 TTGCAGGGTGAGATTTGAGACGG + Intergenic
1006575361 6:35041342-35041364 TTGCAGGCTGAGATTGGAGATGG + Intronic
1006883541 6:37360366-37360388 CTGGTTGATGAGATTTGTAAAGG + Intronic
1007472041 6:42097272-42097294 CTGGAGGCTGTGACCTATGATGG + Intergenic
1008360279 6:50609345-50609367 CTTAAGGCTCAGAGTTGTGAGGG - Intergenic
1008778380 6:55069607-55069629 TTGGAGGTTAAAATTTGTGATGG + Intergenic
1009565429 6:65306042-65306064 CTCAAGGTTTAGATTTGTGAAGG + Intronic
1009844334 6:69116790-69116812 CCTGAGGCAGAGCTTTGTGAAGG + Intronic
1009899828 6:69797142-69797164 CTGCAAGCTGAGATGTGGGAGGG + Intergenic
1010814372 6:80339694-80339716 GTGTAGGCTAAGATATGTGAAGG - Intronic
1011511789 6:88109226-88109248 CTGGAGGCTTTAATTTGTCATGG + Intergenic
1012176373 6:96091055-96091077 CTGCAGGGTGATATTTGAGATGG - Intronic
1013721524 6:113035188-113035210 ATGCAGGCTGAGATTAATGAAGG - Intergenic
1014511892 6:122332693-122332715 CTGCTGGCTGGGTTTTGTGAGGG + Intergenic
1014794847 6:125713177-125713199 CTGAAAGATGAGATTTGTGTGGG + Intergenic
1015237868 6:130991510-130991532 CTGTAGGATTAGATTTATGAGGG - Intronic
1015570616 6:134617797-134617819 GTGGAGGCAGAGATTTTCGACGG + Intergenic
1015916156 6:138219280-138219302 ATGGAAACTGAGATTAGTGAGGG + Intronic
1016133780 6:140512065-140512087 CTGCAGGCTGAGAAATATGAGGG - Intergenic
1016524490 6:144986270-144986292 CTGCTGGCTGGGAATTGTGAGGG + Intergenic
1017806936 6:157954221-157954243 CTGGAGGCTGAGCCTTCTGAGGG - Intergenic
1021094605 7:16521363-16521385 CAGGAGGCAGAGATTACTGAGGG + Intronic
1022311649 7:29201946-29201968 CTGGAGGATGATATTGGGGAGGG + Intronic
1022486898 7:30786025-30786047 CTGGAGGCTGAGAACTGGGCTGG + Intronic
1022610914 7:31872208-31872230 CTGGAGGCTGGGATGTGTGTGGG + Intronic
1023315430 7:38931294-38931316 CTGGAGGCTGTGTTTGGAGAGGG - Intronic
1023370593 7:39508847-39508869 CTGGAGGGCGAGAGTTCTGAGGG - Intergenic
1023978883 7:45054368-45054390 CAGGATTCTGAGATTTGGGATGG - Intronic
1024835012 7:53506729-53506751 GTGGAGGCTCAAACTTGTGAAGG + Intergenic
1027997925 7:85449829-85449851 ATGAATGCTGAGATTTGTGTTGG + Intergenic
1028037760 7:86006037-86006059 CTAGAGGCTGAGAAATGTGGGGG + Intergenic
1028385713 7:90250809-90250831 CTGGAGGAAGAGGTTTGTGTTGG - Intronic
1028525514 7:91781135-91781157 CTAGGGACTGAGTTTTGTGATGG + Intronic
1031500830 7:122513778-122513800 ATGGAGACTGAGATTGGTGCAGG - Intronic
1033061109 7:138108635-138108657 CCGGAGGCTGAGATTATTGAAGG + Intronic
1033421712 7:141209896-141209918 CTGGAGCCTGGGGTATGTGAAGG + Intronic
1034565218 7:151908700-151908722 CTGAAGGCTGAGATCAGAGATGG - Intergenic
1034743338 7:153498704-153498726 GTGGAGGCTGAGAGAGGTGAGGG + Intergenic
1035718907 8:1776109-1776131 CTGGAAGCTGGAATCTGTGAGGG + Intronic
1035718924 8:1776245-1776267 CTGGAAGCTGGAATCTGTGAGGG + Intronic
1035718944 8:1776395-1776417 CTGGAAGGTGAAATCTGTGAGGG + Intronic
1036117372 8:5972717-5972739 CTAGAGATGGAGATTTGTGATGG - Intergenic
1037940213 8:22945590-22945612 CTGGAGGCAGAGAGTGGGGATGG - Intronic
1038427131 8:27471008-27471030 CCACAGGCTGAGCTTTGTGAAGG + Exonic
1038946451 8:32366351-32366373 CTAGAGGCTGAGATGGGTGGAGG - Intronic
1039287934 8:36062729-36062751 TTGGAGGCTGAGGTTTTTCAAGG - Intergenic
1039471401 8:37815617-37815639 CTGGTGGCTGTGAGTTGTTAGGG + Intronic
1040618276 8:49061856-49061878 CCAGACACTGAGATTTGTGATGG + Intronic
1042732194 8:71948409-71948431 CAGTAGGCTGAGTTTTGTGAGGG - Intronic
1045037336 8:98185797-98185819 CTGGAGAGTGAGATTTTGGATGG + Intergenic
1046792024 8:118332773-118332795 CTGGAGTTTGTGGTTTGTGATGG - Intronic
1047228775 8:122978439-122978461 CTGGAGTGTGAGCTTTGAGAGGG - Intergenic
1047735726 8:127763396-127763418 CTGGAGGCTGATATCTGGGGTGG - Intergenic
1048135816 8:131745463-131745485 TTGGTGGCTGAGCTTGGTGAGGG - Intergenic
1048448683 8:134512301-134512323 CTGGAGGCAGAGATCTCTGGGGG + Intronic
1049150956 8:141035200-141035222 CTGGAGGCAGAGATTGGAGTGGG + Intergenic
1049395096 8:142396410-142396432 ATGGAGGTTGAGATTTCTGATGG - Intronic
1051720014 9:20027634-20027656 TTAGAGGCTGAGGTTTTTGAAGG + Intergenic
1052316604 9:27122324-27122346 CAGGAGGGTGACATTTGAGAAGG + Intronic
1053754553 9:41291948-41291970 CTGGAAGATGTGATTAGTGAGGG - Intergenic
1054260073 9:62856254-62856276 CTGGAAGATGTGATTAGTGAGGG - Intergenic
1055077968 9:72236851-72236873 CTGGAGGCTGAGGTTGCAGAGGG - Intronic
1055638496 9:78300307-78300329 GTGGTGAATGAGATTTGTGAAGG + Intronic
1056436942 9:86583724-86583746 CTTGAGGCTCTGATTTGTCAGGG - Intergenic
1056849483 9:90070326-90070348 CTGGAGGCTGAGCTCTGAAAAGG + Intergenic
1057335210 9:94149979-94150001 GTAGAGGCAGAGATTTGAGAAGG + Intergenic
1057799463 9:98181282-98181304 CAGGAGGCTGGGATTAGTGATGG - Intronic
1058382327 9:104390716-104390738 GTGGAGGCTTAAATTTATGAAGG - Intergenic
1058799903 9:108535441-108535463 ATGGAGGCTGAGTTTTAGGAGGG + Intergenic
1059059225 9:111017351-111017373 CTCGAGTCTGAGTTTTTTGAAGG + Intronic
1059333239 9:113549899-113549921 CAGGAGGCTGAGATGGGAGATGG + Intronic
1060557492 9:124516167-124516189 CTGGAGGCTGAGGAATGGGAAGG + Intergenic
1060857470 9:126926511-126926533 CTGGAGTGTGAGATTTATGGTGG + Intronic
1061606844 9:131717185-131717207 CTGGAGGCGGGGAGTTGTAAAGG - Intronic
1186360330 X:8834738-8834760 TGGGAGGCAGAGACTTGTGAAGG + Intergenic
1186459640 X:9738019-9738041 CTGGAGGCTGCTCTCTGTGAGGG - Intronic
1188346522 X:29073122-29073144 CTGGAGGCAGATATAGGTGAGGG - Intronic
1188586568 X:31783466-31783488 CTGGTGGATGAGGCTTGTGAGGG - Intronic
1192220930 X:69196850-69196872 CTGGAGGCTGAGAGGTCTGGTGG + Intergenic
1192658111 X:73013596-73013618 CTGGAGGCTGAGAAGTCTAAGGG + Intergenic
1193130375 X:77913496-77913518 CTGAAGACTGAGATTTAAGAGGG - Intronic
1194666190 X:96680157-96680179 CTGAAGGCAGAGCTTTGTGCAGG - Intergenic
1195509211 X:105694890-105694912 TGGGAGGCTGTGATTTGTAAAGG + Intronic
1196153091 X:112395898-112395920 ATTGAGGTTGAGATTGGTGAGGG + Intergenic
1196202485 X:112901114-112901136 CTGGAGCCTGAGAATTGTACAGG + Intergenic
1196610017 X:117702100-117702122 CTGGAGGCTGATATGGGTAATGG + Intergenic
1197806505 X:130403181-130403203 GTGGAAGCAGAGGTTTGTGATGG + Intronic
1199731134 X:150633070-150633092 TTTAAGGCTGAGATTTCTGAGGG - Intronic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic